RESUMEN

Cell polarity is used to guide asymmetric divisions and create morphologically diverse cells. We find that two oppositely oriented cortical polarity domains present during the asymmetric divisions in the Arabidopsis stomatal lineage are reconfigured into polar domains marking ventral (pore-forming) and outward-facing domains of maturing stomatal guard cells. Proteins that define these opposing polarity domains were used as baits in miniTurboID-based proximity labeling. Among differentially enriched proteins, we find kinases, putative microtubule-interacting proteins, and polar SOSEKIs with their effector ANGUSTIFOLIA. Using AI-facilitated protein structure prediction models, we identify potential protein-protein interaction interfaces among them. Functional and localization analyses of the polarity protein OPL2 and its putative interaction partners suggest a positive interaction with mitotic microtubules and a role in cytokinesis. This combination of proteomics and structural modeling with live-cell imaging provides insights into how polarity is rewired in different cell types and cell-cycle stages.

Asunto(s)

RESUMEN

Purpose: In this study, we aimed to investigate the potential prognostic molecular marker in patients with "pan-driver-gene-negative" lung adenocarcinoma (PDGN-LUAD). LUAD patients who were negative for mutations in EGFR, KRAS, BRAF, HER2, MET, ALK, RET and ROS1 were identified as PDGN-LUAD. Methods: In the screening phase, we profiled the mRNA expression levels in 52 paired PDGN-LUAD tumor tissues and adjacent normal tissues using a genome-wide microarray, and the results revealed that the expression level of dishevelled segment polarity protein 3 (DVL3) was higher in PDGN-LUAD tumor tissues than in normal lung tissues. Then, we enrolled 626 PDGN-LUAD patients from three independent hospital centers and divided them into a training cohort, an internal validation cohort and two external validation cohorts. In the training cohort, tissue microarrays (TMAs) were used to confirm the protein expression level of DVL3. Statistical methods were applied to explore the prognostic role of DVL3. Results: The results indicated that the level of DVL3 could be used to classify patients with PDGN-LUAD in the training cohort into a high-risk group (high expression level of DVL3) and a low-risk group (low expression level of DVL3). In the training cohort, high-risk patients had shorter overall survival (OS) times (hazard ratio [HR] 2.27; 95% CI, 1.57-2.97; p<0.001) than low-risk patients. In the validation phase, the performance of DVL3 as a prognostic marker was successfully validated in the internal and external cohorts. Conclusions: In conclusion, DVL3 is an important prognostic indicator for PDGN-LUAD and may provide new insights into the treatment of PDGN-LUAD.

RESUMEN

The primary cilium plays important roles in regulating cell differentiation, signal transduction, and tissue organization. Dysfunction of the primary cilium can lead to ciliopathies and cancer. The formation and organization of the primary cilium are highly associated with cell polarity proteins, such as the apical polarity protein CRB3. However, the molecular mechanisms by which CRB3 regulates ciliogenesis and the location of CRB3 remain unknown. Here, we show that CRB3, as a navigator, regulates vesicle trafficking in γ-tubulin ring complex (γTuRC) assembly during ciliogenesis and cilium-related Hh and Wnt signaling pathways in tumorigenesis. Crb3 knockout mice display severe defects of the primary cilium in the mammary ductal lumen and renal tubule, while mammary epithelial-specific Crb3 knockout mice exhibit the promotion of ductal epithelial hyperplasia and tumorigenesis. CRB3 is essential for lumen formation and ciliary assembly in the mammary epithelium. We demonstrate that CRB3 localizes to the basal body and that CRB3 trafficking is mediated by Rab11-positive endosomes. Significantly, CRB3 interacts with Rab11 to navigate GCP6/Rab11 trafficking vesicles to CEP290, resulting in intact γTuRC assembly. In addition, CRB3-depleted cells are unresponsive to the activation of the Hh signaling pathway, while CRB3 regulates the Wnt signaling pathway. Therefore, our studies reveal the molecular mechanisms by which CRB3 recognizes Rab11-positive endosomes to facilitate ciliogenesis and regulates cilium-related signaling pathways in tumorigenesis.

Asunto(s)

RESUMEN

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

Asunto(s)

RESUMEN

Circular RNA_0001777 (circ_0001777) is reported to be down-regulated in lung cancer. Nevertheless, the function of circ_0001777 in lung adenocarcinoma is largely unclear. We explored the role of circ_0001777 in lung adenocarcinoma progression and the underlying molecular mechanism. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and Western blot assay were conducted to determine the expression of RNAs and proteins. 3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide, 5-ethynyl-20-deoxyuridine, and colony formation assays were conducted to analyze cell proliferation ability. Flow cytometry was carried out to assess cell apoptosis rate. Cell migration and invasion abilities were analyzed by wound healing assay and transwell assays. Cell glycolytic metabolism was measured using a fluorescence-based glucose assay kit and a lactate oxidase-based colorimetric assay kit. Dual-luciferase reporter assay and RNA immunoprecipitation assay were implemented to verify the intermolecular interactions. Circ_0001777 expression was reduced in lung adenocarcinoma tissues and cell lines. Circ_0001777 overexpression restrained the proliferation, migration, invasion, and glycolysis and promoted the apoptosis of lung adenocarcinoma cells. Circ_0001777 could directly bind to microRNA-942-5p (miR-942-5p). The anti-tumor effects of circ_0001777 overexpression in lung adenocarcinoma cells were reversed after miR-942-5p accumulation. miR-942-5p directly bound to the 3' untranslated region (3'UTR) of prickle planar cell polarity protein 2 (PRICKLE2), and PRICKLE2 silencing reversed the anti-tumor effects of miR-942-5p knockdown in lung adenocarcinoma cells. Circ_0001777 could regulate PRICKLE2 expression by absorbing miR-942-5p. Circ_0001777 overexpression markedly hampered tumor progression in vivo. Circ_0001777 suppressed the progression of lung adenocarcinoma by binding to miR-942-5p to induce PRICKLE2 expression.

Asunto(s)

RESUMEN

Protein tyrosine kinase 7 (PTK7) expression has been reported to be dysregulated and to regulate various cellular activities in numerous types of cancer. However, to the best of our knowledge, the status and role of PTK7 in oral squamous cell carcinoma (OSCC) remains largely unknown. The present study aimed to investigate the involvement of PTK7 in OSCC progression and to determine the potential underlying mechanisms of action. The expression levels of PTK7 and dishevelled segment polarity protein 3 (DVL3) in OSCC cell lines were analyzed using reverse transcription-quantitative PCR and western blotting. A co-immunoprecipitation assay was used to verify the binding association between PTK7 and DVL3. In addition, OSCC cells were transfected with a short hairpin RNA targeting PTK7 or pcDNA-DVL3 overexpression vectors. The effect of PTK7 on OSCC cell viability, proliferation, migration and invasion, and the underlying mechanisms, were investigated using Cell Counting Kit-8, colony formation, wound healing and Transwell assays, respectively. Western blotting was used to analyze the expression levels of proliferation- and migration-associated proteins. The results revealed that the expression levels of both PTK7 and DVL3 were significantly upregulated in OSCC cell lines. In addition, a binding association was identified between PTK7 and DVL3 in SCC-9 cells. The knockdown of PTK7 expression inhibited OSCC cell viability, proliferation, invasion and migration, while the overexpression of DVL3 reversed the inhibitory effects of PTK7-knockdown on OSCC cells. In conclusion, the results of the present study suggested that PTK7 may be a key regulator of OSCC proliferation, migration and invasion, and PTK7-knockdown may inhibit OSCC cell viability, proliferation, invasion and migration by downregulating DVL3 expression. Therefore, PTK7 and DVL3 may represent potential biomarkers for diagnosis and treatment, as well as promising drug targets for OSCC.

RESUMEN

It has been reported that loss of Hugl-2 contributes to tumour formation and progression in vitro and in vivo. However, whether Hugl-2 levels decrease during kidney renal clear cell carcinoma (KIRC) and the mechanism involved remain unknown. This study aimed to investigate whether DNA methylation of Hugl-2 reduces its expression, leading to the progression and poor prognosis of KIRC. Hugl-2 methylation and mRNA expression and KIRC clinicopathological data were extracted from The Cancer Genome Atlas (TCGA), and relationships among these factors were analyzed using UALCAN, MethHC, Wanderer and LinkedOmics web tools. We found that Hugl-2 mRNA and protein levels were reduced in KIRC tissues. Moreover, Hugl-2 mRNA levels were related to tumour grade and overall survival, and Hugl-2 methylation was increased in KIRC. According to the results of methylation-specific PCR, KIRC cells had higher Hugl-2 DNA methylation levels than HKC cells. Moreover, Hugl-2 DNA methylation correlated negatively with Hugl-2 mRNA and was also related to the pathology and T stage of KIRC patients. KIRC patients with high Hugl-2 DNA methylation also had shorter overall survival. Additionally, methylation of cg08827674, a Hugl-2 probe, was related to pathologic stage, T stage, neoplasm histologic grade, serum calcium level without laterality, M stage, N stage, and ethnicity. Furthermore, treatment with the DNA methylation inhibitor decitabine resulted in upregulation of Hugl-2 mRNA and protein levels in KIRC cell lines. These results indicate that Hugl-2 DNA methylation may be both a prognostic marker and a therapeutic target in KIRC.

RESUMEN

Introduction: The Pals1-associated tight junction (PATJ) is a Crumbs (CRB) complex component that regulates epithelial cell apico-basal polarity and directional migration. This study assessed PATJ expression in clear cell renal cell carcinoma (ccRCC) vs. normal tissues and associated with ccRCC progression and prognosis. Methods: The effects of PATJ knockdown were investigated on regulation of normal kidney epithelial cell viability and protein expression in vitro. The PATJ mRNA data in ccRCC were obtained from The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) databases and analyzed with UALCAN, LinkedOmics, Kaplan-Meier Plotter, GEPIA, and SurvExpress tools. Immunohistochemistry was performed for PATJ in tissue microarray sections (n = 150 ccRCC and 30 normal renal specimens). Normal human kidney tubular epithelial cell (HKC) cells were transfected with PATJ and negative control siRNA for cell viability CCK-8 assay, flow cytometry, and western blots. Results: The data showed that PATJ mRNA and protein were downregulated in ccRCC tissues and cell lines. Downregulation of PATJ mRNA was associated with male patients, advanced tumor stages, grades, and ccB subtypes as well as poorer overall and disease-free survival of patients. Furthermore, PATJ protein was also significantly downregulated in ccRCC tissues and associated with advanced tumor pathologic, TNM stages and poorer overall. In vitro, knockdown of PATJ expression promoted HKC proliferation and the activation of mitogen-activated protein kinases (MAPK) pathway proteins. Conclusions: This study revealed that a decrease of PATJ in ccRCC, which was associated with male patients, advanced tumor, and poorer survival, suggesting that PATJ may be a useful prognostic biomarker and therapeutic target for ccRCC.

RESUMEN

Cell polarity is indispensable for forming complex multicellular organisms. Proteins that polarize at specific plasma membrane domains can either serve as scaffolds for effectors or coordinate intercellular communication and transport. Here, I give an overview of polarity protein complexes and their fundamental importance for plant development, and summarize novel mechanistic insights into their molecular networks. Examples are presented for proteins that polarize at specific plasma membrane domains to orient cell division planes, alter cell fate progression, control transport, direct cell growth, read global polarity axes, or integrate external stimuli into plant growth. The recent advances in characterizing protein polarity during plant development enable a better understanding of coordinated plant growth and open up intriguing paths that could provide a means to modulate plant morphology and adaptability in the future.

Asunto(s)

RESUMEN

Despite its prevalence and the severity of symptoms, little is known about the pathogenesis and etiology of adenomyosis. In previous studies, the protein expression level of the polarity protein Scribble in the eutopic endometrium of patients with adenomyosis was found to be significantly decreased; however, little is known about its regulatory mechanism. In consideration of the important role of supraphysiologic estrogen production in the endometrium in the development of adenomyosis, we analyzed the effect and mechanism of estrogen on the expression of Scribble in vivo and in vitro. Firstly, we found Scribble was downregulated in eutopic endometrium and negatively related with aromatase P450 in tamoxifen-induced adenomyosis. Then, we established a 3D culture of primary endometrial epithelial cells and found that estrogen could disrupt apical-basal polarity of endometrial glandular epithelial cells. Based on the following experiments and GEO dataset screening, we found that estrogen regulates the expression level of Scribble by HECW1 through ubiquitination of Scribble protein. At last, we verified the expression of Scribble, HECW1, and aromatase P450 in eutopic endometrium of human and mouse specimens and found that the expression of HECW1 and aromatase P450 was significantly increased, while the expression of Scribble was significantly downregulated. Furthermore, a positive correlation was found between HECW1 and aromatase P450, while a negative correlation was found between HECW1 and Scribble in human clinical tissue specimens. Therefore, our research may provide a new understanding of the pathogenesis of adenomyosis.

Asunto(s)

RESUMEN

Our previous study revealed that CRB3 protein expression was reduced in clear cell renal cell carcinoma (ccRCC) and was associated with TNM stage, pathological grade, and poor prognosis of ccRCC. This study aimed to investigate if DNA methylation of CRB3 decreases its expression, subsequently leading to the progression and poor prognosis of ccRCC. Data for DNA methylation of CRB3, CRB3 mRNA expression, and ccRCC clinicopathological parameters were extracted from the cancer genome atlas (TCGA) database. The relationships among DNA methylation of CRB3, CRB3 mRNA expression, and ccRCC clinicopathological parameters were analyzed using UALCAN, MethHC, LinkedOmics, and Wanderer. We found that CRB3 mRNA levels were lower in ccRCC compared to normal tissues. Methylation of CRB3 increased in ccRCC, with all probes showing differences between ccRCC and normal tissues. Furthermore, CRB3 DNA methylation negatively correlated with CRB3 mRNA expression. CRB3 DNA methylation was also related to pathologic stage, T stage, N stage, and M stage of ccRCC. Overall survival was shorter in ccRCC patients with high CRB3 DNA methylation compared to ccRCC patients with low CRB3 DNA methylation. Methylation of cg24798010, a CRB3 probe, was related to laterality, pathologic stage, T stage, M stage, neoplasm-histologic-grade without N stage, and race. Furthermore, treatment with the DNA methylation inhibitor Decitabine resulted in the upregulation of CRB3 mRNA in ccRCC cell lines. These results indicate that DNA methylation of CRB3 may be both a prognostic marker and therapeutic target for ccRCC.

Asunto(s)

RESUMEN

Lysyl oxidase-like 2 (LOXL2) has shown to promote metastasis and poor prognosis in hepatocellular carcinoma (HCC). Also, we have previously reported that vasculogenic mimicry (VM) is associated with invasion, metastasis and poor survival in HCC patients. In the present study, we investigated molecular function of LOXL2 in HCC and VM. We used the immunohistochemical and CD31/periodic acid-Schiff double staining to detect the relationship between LOXL2 and VM formation. We performed the gain and loss of function studies and analysed the migratory, invasion and tube formation in HCC cell lines. We analysed the function of LOXL2 in VM formation and HCC metastasis both in vitro and in vivo. We have showed that LOXL2 was overexpression in HCC and was positively correlated with tumour grade, metastasis, VM formation and poor survival in 201 HCC patients. Secondly, our studies have showed that LOXL2 overexpression in HCC cells significantly promoted migration, invasion and tube formation. Finally, we found that LOXL2 may increase SNAIL expression, thereby enabling VM. Our study indicated that LOXL2 may promote VM formation and tumour metastasis by collaborating with SNAIL in HCC. What's more, the overexpression of LOXL2 indicated a poor prognosis in HCC patients.

Asunto(s)

RESUMEN

Objective: To clarify the role of discs large homolog 5 (DLG5) in the diagnosis and prognosis of renal clear cell carcinoma (ccRCC) by studying the expression of DLG5 in the clinical tissue of ccRCC. Methods: DLG5 expression in ccRCC tissues and normal renal tissue was measured by using the Cancer Genome Atlas (TCGA) Database and Gene Expression Omnibus (GEO) Database. The correlation of DLG5 expression with the prognosis and clinicopathological parameters of ccRCC was analyzed by LinkedOmics and GEPIA. The interactions protein network of DLG5 was predicted by String-DB. Results: Compared with that of the normal kidney tissues, DLG5 expression was significantly upregulated in the ccRCC tissues (P<0.05). The high DLG5 expression was an independent prognostic factor affecting the overall survival rate of ccRCC based on TCGA (P=2.997×10-5). Furthermore, DLG5 expression had a positive correlation with the TNM stage, ethnicity, tumor purity, year-to-birth, PCNA (P=1.1×10-6, R=0.19), and RAD1 (P=5.7×10-6, R=0.18) expression of ccRCC. Conclusion: In ccRCC, the high expression of DLG5 is a significant index of poor prognosis. Therefore, DLG5 can be a potential biomarker for predicting the metastasis, recurrence and prognosis of the patients.

RESUMEN

In the course of their development from neuroepithelial cells to mature neurons, neuronal progenitors proliferate, delaminate, differentiate, migrate, and extend processes to form a complex neuronal network. In addition to supporting the morphology of the neuroepithelium and radial glia, polarity proteins contribute to the remodeling of processes and support the architectural reorganizations that result in axon extension and dendrite formation. While a good amount of evidence highlights a rheostat-like regulation by signaling events leading to local activation and/or redistribution of polarity proteins, recent studies demonstrate a new paradigm involving a switch-like regulation directly controlling the availability of polarity protein at specific stage by transcriptional regulation and/or targeted ubiquitin proteasome degradation. During the process of differentiation, most neurons will adopt a morphology with reduced polarity which suggests that polarity complex proteins are strongly repressed during key step of development. Here we review the different mechanisms that directly impact the levels of polarity complex proteins in neurons in relation to the polarization context and discuss why this transient loss of polarity is essential to understand neural development and how this knowledge could be relevant for some neuropathy.

Asunto(s)

RESUMEN

OBJECTIVE: To identify new biomarkers for biochemical recurrence (BCR) of prostate adenocarcinoma. PATIENTS AND METHODS: Clinical information of 500 patients with prostate adenocarcinoma and their 152 RNA-sequencing and protein-array data from The Cancer Genome Atlas (TCGA) were separated into a discovery set and a validation set. Each dataset was analysed according to the Gleason grade groups reflecting BCR. The results obtained from the analysis using TCGA dataset were confirmed by immunohistochemistry analyses of a confirmation cohort composed of 395 patients with localised prostate adenocarcinoma. RESULTS: TCGA discovery set was subgrouped into lower- and higher-risk groups for recurrence-free survival (RFS) (P < 0.001). Cyclin B1 (CCNB1), dishevelled segment polarity protein 3 (DVL3), paxillin (PXN), RAF1, transferrin, X-ray repair cross complementing 5 (XRCC5) and BIM had lower expression in the lower-risk group than that in the higher-risk group (all, P < 0.05). In TCGA validation set, CCNB1, DVL3, transferrin, XRCC5 and BIM were also differently expressed between the two groups. Immunohistochemically, DVL3 positivity was associated with high prostate-specific antigen (PSA) levels, resection margin involvement, and BCR (all, P < 0.05). A high Gleason score indicated a marginal relationship (P = 0.055). BIM positivity was related to high PSA levels, lymphovascular invasion, and BCR (all, P < 0.05). Both DVL3 positivity (P = 0.010) and BIM positivity (P = 0.024) were associated with shorter RFS, but statistical significance was lost when the multivariate Cox regression model included all patients. In the lower-risk group, the multivariate Cox model confirmed that DVL3 was an independent predictor for poor RFS (hazard ratio 1.80, P = 0.040), and the concordance index (C-index) was 0.805. CONCLUSIONS: DVL3 and BIM were expressed in patients with a higher risk of BCR. DVL3 may be a novel and easily applicable recurrence predictor of localised prostate adenocarcinoma.

Asunto(s)

RESUMEN

Cell polarization is commonly used for the regulation of stem cell asymmetric division in both animals and plants. Stomatal development in Arabidopsis, a process that produces breathing pores in the epidermis, requires asymmetric cell division to differentiate highly specialized guard cells while maintaining a stem cell population [1, 2]. The BREAKING OF ASYMMETRY IN THE STOMATAL LINEAGE (BASL) protein exhibits a polarized localization pattern in the cell and is required for differential cell fates resulting from asymmetric cell division [3]. The polarization of BASL is made possible by a positive feedback loop with a canonical mitogen-activated protein kinase (MAPK) pathway that recruits the MAPKK kinase YODA (YDA) and MAPK 6 (MPK6) to the cortical polarity site [4]. Here, we study BASL intracellular dynamics and show that the membrane-associated BASL is slowly replenished at the cortical polarity site and that the mobility is tightly linked to its phosphorylation status. Because BASL polarity is only exhibited by one daughter cell after an asymmetric cell division, we study how BASL differentially functions in the two daughter cells. The YDA MAPK cascade transduces upstream ligand-receptor signaling [5-13] to the transcription factor SPEECHLESS (SPCH), which controls stomatal initiation and is directly suppressed by MPK3/6-mediated phosphorylation [14, 15]. We show that BASL polarization leads to elevated nuclear MPK6 signaling and lowered SPCH abundance in one of the two daughter cells. Therefore, two daughter cells are differentiated by BASL polarity-mediated differential suppression of SPCH, which may provide developmental plasticity in plant stem cell asymmetric cell division (ACD).

Asunto(s)

RESUMEN

Cell polarity is crucial to development since apico-basal polarity conferred by the 3 polarity protein modules (or complexes) is essential during embryogenesis, namely the Par (partition defective)-, the CRB (Crumbs)-, and the Scribble-based polarity protein modules. While these protein complexes and their component proteins have been extensively studied in Drosophila and C. elegans and also other mammalian tissues and/or cells, their presence and physiological significance in the testis remain unexplored until the first paper on the Par-based protein published in 2008. Since then, the Par-, the Scribble- and the CRB-based protein complexes and their component proteins in the testis have been studied. These proteins are known to confer Sertoli and spermatid polarity in the seminiferous epithelium, and they are also integrated components of the tight junction (TJ) and the basal ectoplasmic specialization (ES) at the Sertoli cell-cell interface near the basement membrane, which in turn constitute the blood-testis barrier (BTB). These proteins are also found at the apical ES at the Sertoli-spermatid interface. Thus, these polarity proteins also play a significant role in regulating Sertoli and spermatid adhesion in the testis through their actions on actin-based cytoskeletal function. Recent studies have shown that these polarity proteins are having antagonistic effects on the BTB integrity in which the Par6- and CRB3-based polarity complexes promotes the integrity of the Sertoli cell TJ-permeability barrier, whereas the Scribble-based complex promotes restructuring/remodeling of the Sertoli TJ-barrier function. Herein, we carefully evaluate these findings and provide a hypothetic model regarding their role in the testis in the context of the functions of these polarity proteins in other epithelia, so that better experiments can be designed in future studies to explore their significance in spermatogenesis.

RESUMEN

Cell polarity is a prerequisite for asymmetric cell divisions (ACDs) that generate cell type diversity during development of multicellular organisms. In Arabidopsis, stomatal lineage ACDs are regulated by the plant-specific protein BREAKING OF ASYMMETRY IN THE STOMATAL LINEAGE (BASL). BASL exhibits dynamic subcellular localization, accumulating initially in the nucleus, but then additionally in a highly polarized crescent at the cell cortex before division. BASL polarization requires a phosphorylation-mediated activation process, but how this is achieved remains unknown. In this study, we performed a fine-scale dissection of BASL protein subdomains and elucidated a nuclear localization sequence for nuclear import and a critical FxFP motif for cortical polarity formation, respectively. Artificially tethering BASL subdomains to the plasma membrane suggests that novel protein partner/s might exist and bind to an internal region of BASL. In addition, we suspect the existence of a protein degradation mechanism associated with the amino terminal domain of BASL that accounts for restricting its predominant expression to the stomatal lineage cells of the epidermis. Taken together, our results revealed that BASL, through its distinct subdomains, integrates multiple regulatory inputs to provide a mechanism that promotes difference during stomatal lineage ACDs.

Asunto(s)

RESUMEN

Recessive CRB2 mutations were recently reported to cause both steroid resistant nephrotic syndrome and prenatal onset ventriculomegaly with kidney disease. We report two Ashkenazi Jewish siblings clinically diagnosed with ciliopathy. Both presented with severe congenital hydrocephalus and mild urinary tract anomalies. One affected sibling also has lung hypoplasia and heart defects. Exome sequencing and further CRB2 analysis revealed that both siblings are compound heterozygotes for CRB2 mutations p.N800K and p.Gly1036Alafs*43, and heterozygous for a deleterious splice variant in the ciliopathy gene TTCB21. CRB2 is a polarity protein which plays a role in ciliogenesis and ciliary function. Biallelic CRB2 mutations in animal models result in phenotypes consistent with ciliopathy. This report expands the phenotype of CRB2 mutations to include lung hypoplasia and uretero-pelvic renal anomalies, and confirms cardiac malformation as a feature. We suggest that CRB2-associated disease is a new ciliopathy syndrome with possible digenic/triallelic inheritance, as observed in other ciliopathies. Clinically, CRB2 should be assessed when ciliopathy is suspected, especially in Ashkenazi Jews, where we found that p.N800K carrier frequency is 1 of 64. Patients harboring CRB2 mutations should be tested for the complete range of ciliopathy manifestations.

Asunto(s)

RESUMEN

Epithelial architecture is formed in tissues and organs when groups of epithelial cells are organized into polarized structures.The epithelial function as well as signaling across the epithelial layer is organized by polarity proteins.Epithelial polarity complexes form and regulate epithelial integrity.Polarity proteins establish and maintain cell polarity,regulate tight junctions and adherens junctions.Polarity proteins act as neoplasms suppressors in mammals and interact with oncogenes,disrupt cell polarity,induce tumorigenesis.Therefore,polarity mechanisms of epithelial cell could therapeutic targets for clinical therapy.