RESUMEN

PURPOSE: In this study, we will investigate the possible side effects of psoriasis patients using long-term topical corticosteroids (TCS) such as adrenal insufficiency, Cushing's Syndrome (CS) and osteoporosis and determine how these side effects develop. MATERIAL AND METHODS: Forty-nine patients were included in the study. The patients were divided into two groups based on the potency of the topical steroid they took and the patients' ACTH, cortisol and bone densitometer values were evaluated. RESULTS: There was no significant difference between the two groups regarding the development of surrenal insufficiency, CS and osteoporosis. One patient in group 1 and 4 patients in group 2 were evaluated as iatrogenic CS. ACTH stimulation tests of these patients in group 2 showed consistent results with adrenal insufficiency, while no adrenal insufficiency was detected in the patient in Group 1. Patients who used more than 50g of superpotent topical steroids per week compared to patients who used 50g of superpotent topical steroids per week. It was identified that patients who used more than 50g of superpotent topical steroids had significantly lower cortisol levels, with a negatively significant correlation between cortisol level and the amount of topical steroid use (p < .01).Osteoporosis was detected in 3 patients in group 1 and 8 patients in Group 2. Because of the low number of patients between two groups, statistical analysis could not be performed to determine the risk factors. CONCLUSIONS: Our study is the first study that we know of that investigated these three side effects. We have shown that the development of CS, adrenal insufficiency and osteoporosis in patients who use topical steroids for a long time depends on the weekly TCS dosage and the risk increases when it exceeds the threshold of 50 grams per week. therefore, our recommendation would be to avoid long-term use of superpotent steroids and to choose from the medium-potent group if it is to be used.

Asunto(s)

RESUMEN

BACKGROUND: Oral Submucous Fibrosis (OFMF) is an oral potentially malignant disorder (OPMDs), strongly linked to betel quid chewing. It exhibits a significantly higher rate of malignant transformation compared to other OPMDs. The use of Intralesional Triamcinolone Acetonide Injection has emerged as a highly effective treatment option and has become the cornerstone of managing this condition. CASE PRESENTATION: A 44-year-old female and a 40-year-old male presented with burning sensation and limited mouth opening, leading to diagnosis of OSMF. Both patients were treated with Triamcinolone Acetonide (TAC) Intralesional injections. Following a few months of treatment, a significant improvement in mouth opening was observed. However, both patients began experiencing symptoms such as facial rounding (mooning of the face), a buffalo hump, uneven hair growth, and swelling in the lower extremities. Upon recognizing these symptoms as indicative of Cushing's Syndrome, the administration of TAC injection was discontinued. Both patients were referred to a higher-level medical facility for confirmatory tests, which revealed elevated cortisol levels in both morning (Cortisol A.M) and evening (Cortisol P.M). CONCLUSION: TAC injection has been established as an effective treatment for OSMF. However, it is crucial to closely monitor patients for any adverse effects resulting from the treatment, which may arise from high dosage or increased frequency.

Asunto(s)

RESUMEN

Cobicistat, used as a pharmacokinetic booster in therapeutic combination with human immunodeficiency virus (HIV) protease inhibitors and integrase inhibitors, is a strong inhibitor of cytochrome P450 3A4 (CYP3A4). Since most glucocorticoids are metabolized by the isoenzyme of the cytochrome P450 pathway, their plasma concentrations can be highly increased in the presence of cobicistat-boosted darunavir, with subsequent risk of iatrogenic Cushing's syndrome (ICS) and secondary adrenal insufficiency. We report a case of a 45-year-old man with HIV-hepatitis C virus co-infection treated with raltegravir and darunavir/cobicistat since 2019. In May 2021, he underwent a sleeve gastrectomy due to morbid obesity (BMI: 50.9 kg/m2) with multiple comorbidities. Four months after surgery, he was diagnosed with asthma and was started on inhaled budesonide, which was later changed to fluticasone propionate. At the 12-month postoperative visit, the patient referred proximal muscle weakness and asthenia, and suboptimal weight loss (excess weight loss of 39%) and high blood pressure were documented. Moon facies, buffalo hump, and abdominal large vinous striae were evident on physical examination. Laboratory studies showed impaired glucose metabolism and hypokalemia. Cushing's syndrome was suspected and further investigation confirmed its iatrogenic origin. The diagnosis of ICS and consequent secondary adrenal insufficiency due to an interaction between the darunavir/cobicistat combination and budesonide/fluticasone was established. Darunavir/cobicistat therapy was replaced by dolutegravir/doravirine dual therapy, inhaled corticoid was switched to beclomethasone, and glucocorticoid substitutive therapy was introduced. This is a particular case of overt ICS due to cobicistat-inhaled corticosteroid interaction in a superobese patient, developed after he underwent bariatric surgery. The presence of morbid obesity, combined with the rarity of this pharmacological complication in individuals taking cobicistat, made the correct diagnosis even more challenging. A meticulous review of pharmacologic habits and potential interactions is essential to avoid serious harm to patients.

RESUMEN

Introducción: Actualmente no se cuenta con instrumentos clinimétricos para la medición de la gravedad del síndrome de Cushing iatrógeno (SCI). Sonino et al. crearon un índice clínico de gravedad del síndrome de Cushing endógeno (IGC), pero no ha sido aplicado a pacientes con SCI. Objetivo: Validar y determinar la utilidad del IGC y su correlación con variables clínicas en pacientes reumatológicos con uso de glucocorticoides (GC) de forma continua. Sujetos y métodos: Se incluyó a pacientes con antecedentes de uso de GC sistémicos de forma continua indicados para el tratamiento de la enfermedad reumatológica, por lo menos durante 4 semanas. Todos los pacientes rellenaron un cuestionario sobre datos sociodemográficos, características de los GC empleados, la forma de uso y la presencia o ausencia de eventos adversos. Se aplicó el IGC por 2 observadores de forma independiente. Se calculó la consistencia, la concordancia interobservador y un análisis de componentes principales. Resultados: Se estudió a 32 pacientes con edad promedio de 35,72±12,8 años; 29 eran mujeres (90,6%). La calificación promedio del IGC por el primer observador fue de 3,50±2,02 y la del segundo observador fue de 2,31±1,75 (p=0,004). La concordancia interobservador fue baja en los ítems con definiciones imprecisas, por lo cual se modificaron las definiciones para mejorar su desempeño. Los puntajes del IGC correlacionaron con la presencia de efectos adversos y el tipo de dosis utilizada. Conclusiones: El IGC tiene una adecuada correlación con manifestaciones clínicas en pacientes con uso crónico de GC. Las características clinimétricas del cuestionario mejoraron al estandarizar las definiciones de variables clínicas subjetivas.(AU)

Introduction: Currently there are no clinimetric instruments for the measurement of the severity of iatrogenic Cushing's syndrome (ICS). Sonino et al. created a clinical severity index of endogenous Cushing's disease (CSI) but it has not been applied to patients with ICS. Objective: To validate and determine the utility of the CSI and its correlation with clinical variables in rheumatological patients with continuous use of glucocorticoids (GC). Subjects and methods: Patients with a history of continuous systemic GC use (for at least 4 weeks) indicated for treatment of rheumatological disease were included. All the patients filled out a questionnaire on sociodemographic data, characteristics of the CG used; the way of use and the presence or absence of adverse events. The CSI was applied by 2 observers independently. Consistency, interobserver concordance and principal component analysis were calculated. Results: A total of 32 patients with an average age of 35.72±12.8 years were studied; 29 were women (90.6%). The average CSI score by the first observer was 3.50±2.02, and by the second observer was 2.31±1.75 (p=.004). The interobserver concordance was low in the items with imprecise definitions; for which modifications were made in the definitions to improve their performance. The CSI scores correlated with the presence of adverse effects and the type of dose used. Conclusions: The CSI has an adequate correlation with clinical manifestations in patients with chronic use of GC. The clinimetric characteristics of the questionnaire improved by standardising the definitions of subjective clinical variables.(AU)

Asunto(s)

RESUMEN

INTRODUCTION: Currently there are no clinimetric instruments for the measurement of the severity of iatrogenic Cushing's syndrome (ICS). Sonino et al. created a clinical severity index of endogenous Cushing's disease (CSI) but it has not been applied to patients with ICS. OBJECTIVE: To validate and determine the utility of the CSI and its correlation with clinical variables in rheumatological patients with continuous use of glucocorticoids (GC). SUBJECTS AND METHODS: Patients with a history of continuous systemic GC use (for at least 4 weeks) indicated for treatment of rheumatological disease were included. All the patients filled out a questionnaire on sociodemographic data, characteristics of the CG used; the way of use and the presence or absence of adverse events. The CSI was applied by 2 observers independently. Consistency, interobserver concordance and principal component analysis were calculated. RESULTS: A total of 32 patients with an average age of 35.72±12.8 years were studied; 29 were women (90.6%). The average CSI score by the first observer was 3.50±2.02, and by the second observer was 2.31±1.75 (p=.004). The interobserver concordance was low in the items with imprecise definitions; for which modifications were made in the definitions to improve their performance. The CSI scores correlated with the presence of adverse effects and the type of dose used. CONCLUSIONS: The CSI has an adequate correlation with clinical manifestations in patients with chronic use of GC. The clinimetric characteristics of the questionnaire improved by standardising the definitions of subjective clinical variables.

RESUMEN

We report a case of avascular necrosis (AVN), hypercalcemia, and iatrogenic Cushing's syndrome in an HIV-positive patient taking inhaled (ICS) and nasal corticosteroids fluticasone and ritonavir. A 45-year-old HIV-infected African-American woman was seen for initial evaluation for multinodular goiter in December 2015. Relevant medications were ritonavir, raltegravir, darunavir, fluticasone propionate HFA, and nasal fluticasone propionate. Physical examination revealed classical cushingoid appearance but laboratory testing showed abnormal adrenocorticotropic hormone (ACTH) stimulation test. A diagnosis of iatrogenic Cushing's syndrome due to inhibition of fluticasone metabolism from protease inhibitor (PI) therapy with secondary adrenal suppression was made. Fluticasone nasal spray and HFA were discontinued and hydrocortisone replacement dose was initiated. The patient's Cushing's related symptoms improved over several months. Follow-up evaluation showed non-parathyroid hormone-mediated hypercalcemia. A detailed laboratory evaluation looking for the etiology for hypercalcemia was unremarkable except for an elevated urine N-telopeptide/creatinine ratio. Meanwhile, the patient developed a new symptom of hip pain. MRI of both hips showed bilateral AVN. Sickle cell screen was negative and a right hip replacement was completed in May 2017. Since this is the fourth case report of AVN from iatrogenic Cushing's syndrome in an HIV-infected patient taking a PI and ICS concomitantly, there is more likely a causal relationship and not simply a coincidental finding. Extreme caution should be used when considering any ICS therapy in combination with PIs in HIV-infected patients.

RESUMEN

BACKGROUND: Iatrogenic Cushing's syndrome (ICS) typically develops after long-term exposure to corticosteroids, but it can occur after a single dose in patients treated with cobicistat or ritonavir for HIV. We present a patient who developed ICS due to the interaction between cobicistat and triamcinolone, a review of the literature, and what to our knowledge is the first case of ICS presenting as a pulmonary embolism. CASE PRESENTATION: A 55-year old male with a past medical history of human immunodeficiency virus, undetectable for 15 years and currently on elvitegravir/cobicistat/emtricitabine/tenofovir alafenamide, received 2 intra-articular injections of triamcinolone one month apart for a Baker's cyst in his right knee. He used nasal fluticasone for 9 days in-between the injections. After his second knee injection, he developed easy bruising and friable skin. Over the coming months, he experienced weight gain and Cushingoid facies. Four months after the knee injections he developed a pulmonary embolism and deep vein thrombosis treated with warfarin. The Cushingoid facies prompted an evaluation and diagnosis of ICS along with hypothalamic pituitary adrenal axis suppression. CONCLUSION: This case demonstrates the need to monitor patients on pharmacological boosters with any exposure to corticosteroids, whether it be injected, inhaled, topical, oral or intravenous, as it can lead to profound adrenal suppression and ICS.

RESUMEN

Psoriasis vulgaris is a chronic inflammatory disorder that affects the skin and joints. Mild disease is treated with topical corticosteroids (CS) which forms the first line of treatment for localized disease. While it is well established that prolonged use of oral or parenteral corticosteroids can lead to iatrogenic Cushing's syndrome and suppression of hypothalamic pituitary axis; development of these complications secondary to use of topical CS is rarely described. Since steroids have anti-inflammatory properties, their prolonged use can lead to increased susceptibility to develop bacterial and fungal infections. We hereby report a 11-year-old female with psoriasis who presented with septicaemia and features of iatrogenic Cushing's syndrome due to treatment with topical corticosteroids for 2 years. Presentation of ICS as septicemia due to topical steroid use in this age group or in a psoriatic patient has not been described in the literature so far. Patient also developed hypertension and osteopenia, which are known adverse effects of corticosteroids; but occur rarely due to topical corticosteroids.

Asunto(s)

RESUMEN

Asthma is the most common chronic inflammatory disease of children. Inhaled corticosteroids (ICS) are the cornerstone of asthma therapy which are the most effective, commonly used treatment of persistent asthma. Mostly, studies on the relationship between asthma and cortisol have focused on side effects of treatment. Recently, asthmatic patients not treated with ICS have been reported to have an attenuated activity and/or responsiveness of their Hypothalamic-Pituitary- Adrenal (HPA) axis. Moreover, it has been proposed that asthma worsening with stress may be due to a dysfunctional HPA axis, or cortisol insensitivity due to chronic psychological stress through impaired glucocorticoid receptor expression or function. Although long-term ICS treatment might produce adrenal suppression or iatrogenic Cushing syndrome, improvement of adrenal function has also been detected in some of asthmatic cases. Thus, the response scheme of HPA axis still contains undiscovered features in asthma. The management of asthma can be improved by increasing knowledge on the role of HPA axis in asthma pathophysiology. The risk for side effects of ICS can be minimized through increased awareness, early recognition of at-risk patients and regular patient follow-up. This review was written to draw attention to the role of HPA axis in both asthma and its treatment and to illustrate a follow up algorithm of HPA axis in the management of asthma.

Asunto(s)

RESUMEN

INTRODUCTION: Glucocorticoids (GC) are largely used for their anti-inflammatory and immunosuppressive effects. Until recently "local" administration (inhalation, topical, intra-articular, ocular and nasal) was considered devoid of important systemic side effects, but there is no administration form, dosing or treatment duration for which the risk of iatrogenic Cushing's syndrome (CS) and consequent adrenal insufficiency (AI) can be excluded with certainty. PATIENTS AND METHODS: We present the case of a pregnant woman who developed overt CS with secondary AI in the second trimester of pregnancy. She had low morning plasma cortisol 6.95 nmol/L (normal non-pregnant range 166 - 507) and low ACTH level 1.54 pg/mL (normal range 7.2 - 63.3), suggestive for iatrogenic CS. A thorough anamnesis revealed chronic sinusitis long-term treated with high doses of intranasal betamethasone spray (6 - 10 applications/day, approximately 10 mg betamethasone/week, for 5 months). After decreasing the dose and switching to an alpha-1 adrenergic agonist spray, the adrenal function recovered in a few weeks without manifestations of AI. The patient underwent an uneventful delivery of a normal baby. A review of the literature showed that only a few cases with exogenous CS and consequent AI caused by intranasal GC administration were described, mostly in children, but none during pregnancy. CONCLUSION: Long-term high doses of intranasal GC may induce iatrogenic CS and should be avoided. Low levels of ACTH and cortisol should prompt a detailed anamnesis looking for various types of glucocorticoid administration.

RESUMEN

Cystic fibrosis (CF) is not known to directly affect the adrenal gland, but commonly used CF therapies do impact the function of the hypothalamic-pituitary-adrenal (HPA) axis. By binding to the glucocorticoid receptor, medications such as inhaled and oral corticosteroids can enhance the systemic effects of cortisol and result in iatrogenic Cushing syndrome. Prolonged use suppresses the body's ability to make cortisol, resulting in iatrogenic adrenal insufficiency upon medication discontinuation. Chronic use of inhaled and oral corticosteroids can negatively affect bone health, growth, and glucose metabolism. This chapter provides practical guidelines regarding the screening, diagnosis, and treatment of iatrogenic adrenal insufficiency. As the guidelines are mainly derived from the asthma literature, this chapter also highlights the need for studies to evaluate the impact of CF therapies on adrenal function and other CF-endocrinopathies.

Asunto(s)

RESUMEN

BACKGROUND: Glucocorticoids, among the most widely utilized drugs in veterinary medicine, are employed to treat a wide variety of diseases; however, their use often induces adverse events in dogs. The efficacy of glucocorticoids usually depends on dosage, although differences in sensitivity to glucocorticoids in individual animals have been reported. Glucocorticoids bind to the cytoplasmic glucocorticoid receptor (GR), which is expressed in almost all cells. These receptors are key factors in determining individual sensitivity to glucocorticoids. This study examined individual differences in glucocorticoid sensitivity in dogs, focusing on reactivity of the GR to prednisolone. RESULTS: We first molecularly cloned the GR gene from a healthy dog. We discovered a mutant GR in a dog suspected to have iatrogenic Cushing syndrome. The mutant GR had extra nucleotides between exons 6 and 7, resulting in a truncated form of GR that was 98 amino acids shorter than the wild-type dog GR. The truncated GR exhibited very low reactivity to prednisolone, irrespective of concentration. CONCLUSIONS: We have identified the truncated form of canine GR in a dog with iatrogenic Cushing syndrome. This truncated form showed the very less sensitivity to glucocorticoid in vitro, unfortunately, we could not elucidate its clinical significance. However, our data is a first report about the function of canine GR, and will facilitate the analysis of canine glucocorticoid sensitivity.

Asunto(s)

RESUMEN

BACKGROUND: Congenital adrenal hyperplasia (CAH) resulting from steroid 11ß-hydroxylase deficiency (11ß-OHD) is caused by mutations in the CYP11B1 gene. It is the second major form of CAH associated with hypertension and hypopotassemia. The aim of this study was to provide a genetic analysis of 11ß-OHD in a Chinese family. CASE PRESENTATION: A 19-year-old Chinese man was clinically diagnosed with 11ß-OHD. His initial clinical manifestations included precocious puberty, hyperpigmentation, hypertension, and hypopotassemia. The patient had taken an overdose of dexamethasone (0.75 mg/d) for more than 10 years before finally developing iatrogenic Cushing's syndrome. Our aim was to perform a molecular diagnosis of his family. Mutations in the CYP11B1 gene of the patient and his parents were examined using polymerase chain reaction (PCR) resequencing. Additionally, to predict the possible effects of novel mutations on the structure and function of 11ß-hydroxylase, these mutations were analyzed by MutationTaster software. Two novel pathogenic mutations were found in the CYP11B1 gene: a heterozygous in-frame insertion deletion mutation c.1440_1447delinsTAAAAG in exon 9 inherited from the father and a heterozygous mutation c.1094_1120delTGCGTGCGGCCCTCAAGGAGACCTTGC (p.364_372del) in exon 6 inherited from the mother. CONCLUSIONS: A clear genetic diagnosis can be made by analyzing the functional and structural consequences of CYP11B1 gene mutations that lead to 11ß-OHD. Because the dosage of glucocorticoid should be adjusted to minimize the risk of iatrogenic Cushing's syndrome, clinical follow-up should be conducted with these patients.

Asunto(s)

RESUMEN

Prolonged use of topical corticosteroids, particularly in infants, albeit rare, may lead to Cushing syndrome. Central nervous system abnormalities including brain atrophy and delayed myelination on cranial magnetic resonance imaging has been reported in patients with corticosteroid treatment. We herein report a 5-month-old female infant referred to Department of Pediatric Endocrinology, Edirne, Turkey with brain atrophy and myelination delay that might be due to iatrogenic Cushing syndrome caused by topical corticosteroid use.

RESUMEN

Chronic glucocorticoid (GC) treatment represents a widely-prescribed therapy for several diseases in consideration of both anti-inflammatory and immunosuppressive activity but, if used at high doses for prolonged periods, it can determine the systemic effects characteristic of Cushing's syndrome. In addition to signs and symptoms of hypercortisolism, patients on chronic GC therapy are at risk to develop tertiary adrenal insufficiency after the reduction or the withdrawal of corticosteroids or during acute stress. This effect is mediated by the negative feedback loop on the hypothalamus-pituitary-adrenal (HPA) axis, which mainly involves corticotropin-release hormone (CRH), which represents the most important driver of adrenocorticotropic hormone (ACTH) release. In fact, after withdrawal of chronic GC treatment, reactivation of CRH secretion is a necessary prerequisite for the recovery of the HPA axis. In addition to the well-known factors which regulate the degree of inhibition of the HPA during synthetic GC therapy (type of compound, method of administration, cumulative dose, duration of the treatment, concomitant drugs which can increase the bioavailability of GCs), there is a considerable variation in individual physiology, probably related to different genetic profiles which regulate GC receptor activity. This may represent an interesting basis for possible future research fields.

Asunto(s)

RESUMEN

Cushing's syndrome (CS) is common after oral steroid use and has also been reported following topical or inhaled use, but it is extremely uncommon after intranasal administration. This is the case of a 6-year-old child who developed Cushing's syndrome after intranasal application of dexamethasone sodium phosphate for a period of 6 months. Pediatricians and other clinical practitioners should be aware that high-dose and long-term nasal steroid administration may cause iatrogenic Cushing's syndrome characterized by complications of glucocorticoid excess as well as serious and even life-threatening complications of adrenal insufficiency.

RESUMEN

Our case report discusses the usefulness of administering romiplostim as a second-line treatment before splenectomy in a cirrhotic patient with immune thrombocytopenia who developed corticosteroid-induced Cushing's syndrome. Corticosteroids were tapered and consequently withdrawn. The patient made a full recovery postsplenectomy.

RESUMEN

Glucocorticoids are used for the treatment of many diseases, such as inflammatory, allergic, autoimmune, and neoplastic diseases. They can be used in the form of topical, oral, inhalable, rectal, and intra-articular agents. Many topical steroid-related iatrogenic Cushing's syndrome cases affecting especially children have been reported in the literature. Topical steroid-related Cushing's syndrome is rarely seen in adults. In this report, we present the case of a 32-year-old male patient with iatrogenic Cushing's syndrome related to long-term clobetasol propionate treatment for psoriasis. In the context of such treatment, the glucocorticoid withdrawal problem has to be overcome. At present there is no consensus on steroid withdrawal. Patients on long-term glucocorticoid treatment must be evaluated for potential adverse effects and withdrawal symptoms by their physician and their endocrinologist.

RESUMEN

OBJECTIVE: To study the characteristics of infants and children presenting with iatrogenic Cushing's Syndrome due to nappy rash ointments. METHODS: The descriptive study was conducted at the Children's Hospital, Lahore, from April to September 2013, and comprised patients presenting with cushingoid features and history of using nappy rash ointments. Patients having Cushing's Syndrome due to causes other than iatrogenic were excluded and so were those taking oral or parenteral steroids due to skin allergy, renal or respiratory disease. Demographic data, history and examination of all patients were recorded on a proforma and results were analysed using SPSS 16. RESULTS: Of the total 18 patients, 13(72%) were girls and 5(27%) were boys. Eight (44.4%) patients were younger than 6 months, 6(33.3%) were between 6 months to 1 year, while 4(22.2%) were between 12 and 18 months of age. Clobetasol alone was the most frequently used agent responsible in 13(72%) cases. Duration of use of steroid ointment was as short as 3 weeks to as much as 1 year. All the patients were using disposable diapers. Ointment was prescribed by a doctor in 5(27%) cases and self-prescribed (relative or neighbour) in 13(72%). CONCLUSIONS: Self-medication and prolonged use of potent steroid ointments are major contributors in development of iatrogenic Cushing's Syndrome in infants and children. Younger age, female gender and use of disposable diapers were other important predisposing factors.

Asunto(s)

RESUMEN

Massive thoracoabdominal aortic thrombosis is a rare finding in patients with iatrogenic Cushing syndrome in the absence of any coagulation abnormality. It frequently represents an urgent surgical situation. We report the case of an 82-year-old woman with massive aortic thrombosis secondary to iatrogenic Cushing syndrome. A follow-up computed tomography scan showed a decreased amount of thrombus in the aorta after anticoagulation therapy alone.

Asunto(s)