Your browser doesn't support javascript.
loading
Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex.
McQuaid, Kane T; Takahashi, Shuntaro; Baumgaertner, Lena; Cardin, David J; Paterson, Neil G; Hall, James P; Sugimoto, Naoki; Cardin, Christine J.
Afiliación
  • McQuaid KT; Department of Chemistry, University of Reading, Whiteknights, Reading RG6 6AD, U.K.
  • Takahashi S; FIBER (Frontier Institute for Biomolecular Engineering Research), Konan University, 7-1-20 Minatojima-minamimachi, Chuo-ku, Kobe 650-0047, Japan.
  • Baumgaertner L; Department of Chemistry, University of Reading, Whiteknights, Reading RG6 6AD, U.K.
  • Cardin DJ; Department of Chemistry, University of Reading, Whiteknights, Reading RG6 6AD, U.K.
  • Paterson NG; Diamond Light Source Ltd., Harwell Science and Innovation Campus, Didcot, Oxfordshire OX11 0DE, U.K.
  • Hall JP; School of Pharmacy, University of Reading, Whiteknights, Reading RG6 6AD, U.K.
  • Sugimoto N; FIBER (Frontier Institute for Biomolecular Engineering Research), Konan University, 7-1-20 Minatojima-minamimachi, Chuo-ku, Kobe 650-0047, Japan.
  • Cardin CJ; FIRST (Graduate School of Frontiers of Innovative Research in Science and Technology), Konan University, 7-1-20 Minatojima-Minamimashi, Chuo-Ku, Kobe 650-0047, Japan.
J Am Chem Soc ; 144(13): 5956-5964, 2022 04 06.
Article en En | MEDLINE | ID: mdl-35324198
The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.
Asunto(s)
Texto completo
Añadir a Mi BVS
Imprimir
XML
PubMed Links
Buscar en Google

Texto completo: 1 Colección: 01-internacional Base de datos: MEDLINE Asunto principal: Rutenio / G-Cuádruplex Límite: Humans Idioma: En Revista: J Am Chem Soc Año: 2022 Tipo del documento: Article Pais de publicación: Estados Unidos
Texto completo
Añadir a Mi BVS
Imprimir
XML
PubMed Links
Buscar en Google

Texto completo: 1 Colección: 01-internacional Base de datos: MEDLINE Asunto principal: Rutenio / G-Cuádruplex Límite: Humans Idioma: En Revista: J Am Chem Soc Año: 2022 Tipo del documento: Article Pais de publicación: Estados Unidos