RESUMO

Oxidative/nitrosative damage takes part in chronic disease development, which generates an urgent need for intervention and better therapies to manage them. The scientific community has demanded easy-to-run, cheap, and reliable methods for cellular antioxidant activity assays. This work standardised and validated an erythrocyte cellular antioxidant activity and membrane protection/injury (HERYCA-P) protocol to study food-derive extracts. The method measures intracellular reactive oxygen species (ROS) generation, lipoperoxidation, and haemolysis induced by 2,2'-azobis(2-amidinopropane) dihydrochloride. Quercetin decreased ROS generation by 50.4% and haemolysis by 2.2%, while ascorbic acid inhibited lipid peroxidation by 40.1%. Total phenolic contents of teas were correlated with decreased ROS generation (r = -0.924), lipoperoxidation (r = -0.951), and haemolysis (r = -0.869). The erythrocyte ROS generation and lipoperoxidation were also associated with CUPRAC (r = -0.925; r = -0.951) and hydroxyl radical scavenging activity (r = -0.936; r = -0.949). The precision rates of antioxidant standards and tea samples were below 15%. HERYCA-P is feasible as a complementary antioxidant assay for food matrices.

Assuntos

RESUMO

Resumen ANTECEDENTES: El síndrome HELLP es una complicación severa de la preeclampsia, potencialmente mortal, caracterizada por hemólisis, enzimas hepáticas elevadas y bajo recuento de plaquetas. La prevalecia de este síndrome es de, aproximadamente, 0.5 al 0.9% de los embarazos y del 10 al 20% de los embarazos complicados por preeclampsia con criterios de severidad. CASO CLÍNICO: Paciente de 25 años, originaria de Lima, Perú, sin antecedentes personales ni familiares de interés. Antecedentes ginecoobstétricos: embarazo durante la adolescencia que finalizó por cesárea debido a preeclampsia con criterios de severidad a las 30 semanas que ameritó cuidados intensivos, con un recién nacido de 1170 gramos, que se ha desarrollado con aparente normalidad. El embarazo actual de 22 semanas, determinado por ecografía del primer trimestre, sin registro de controles prenatales. Con base en los reportes de laboratorio se estableció el diagnóstico de preeclampsia con criterios de severidad complicada y síndrome HELLP. Ante la evolución rápida y tórpida de la enfermedad se decidió finalizar el embarazo mediante cesárea, previa transfusión de una aféresis de plaquetas. El estudio anatomopatológico reportó: placenta con maduración vellosa acelerada, incremento de fibrina perivellosa y focos de infarto antiguo. CONCLUSIONES: El síndrome HELLP es una complicación grave del embarazo, con elevada morbilidad y mortalidad materno-perinatal; sobre todo si éste se inicia en semanas tempranas de la gestación, por debajo del nivel de viabilidad del feto; de ahí la necesidad del diagnóstico oportuno y el tratamiento individualizado.

Abstract BACKGROUND: HELLP syndrome is a severe, life-threatening complication of pre-eclampsia characterized by hemolysis, elevated liver enzymes and low platelet count. The prevalence of this syndrome is approximately 0.5-0.9% of pregnancies and 10-20% of pregnancies complicated by severe pre-eclampsia. CLINICAL CASE: 25-year-old female patient, originally from Lima, Peru, with no personal or family history. Obstetric and gynecological history: adolescent pregnancy terminated by caesarean section due to pre-eclampsia with severe criteria at 30 weeks, requiring intensive care, with a newborn weighing 1170 grams who has developed with apparent normality. The current pregnancy is 22 weeks, determined by first trimester ultrasound, with no record of antenatal checks. Based on laboratory reports, a diagnosis of pre-eclampsia with criteria of complicated severity and HELLP syndrome was established. Given the rapid and torpid evolution of the disease, it was decided to terminate the pregnancy by caesarean section after transfusion of platelet apheresis. Anatomopathological examination revealed: placenta with accelerated villous maturation, increased perivillous fibrin and foci of old infarction. CONCLUSIONS: HELLP syndrome is a serious complication of pregnancy with high maternal and perinatal morbidity and mortality, especially when it occurs early in pregnancy.

RESUMO

BACKGROUND: Critically ill patients frequently need blood transfusions. For safety, blood must be delivered via syringe infusion pumps, yet this can cause red cell damage and increase the rate of haemolysis. AIMS AND OBJECTIVES: To evaluate biochemical and haemolytic markers of red blood cells transfused in three different types of syringe infusion pumps at two different infusion rates (10 and 100 mL/h). DESIGN AND METHODS: A lab-based study using aliquots of 16 red blood cell bags was undertaken. Haemolysis markers (total haemoglobin [g/dL], haematocrit [%], free haemoglobin [g/dL], potassium [mmol/L], lactate dehydrogenase [U/L], osmolality [mOsm/kg], pH, degree of haemolysis [%]) were measured before and after red blood cell infusion and exposure. Three different syringe infusion pumps brands (A, B, and C) were compared at two different infusion rates (10 and 100 mL/h). RESULTS: Total haemoglobin fell significantly in all red blood cell units during manipulation (pre-infusion: 26.44 ± 5.74; post-exposure: 22.62 ± 4.00; P = .026). The degree of haemolysis significantly increased by 40% after manipulation of the red blood cells. Syringe infusion pump A caused a 3-fold increase in potassium levels (3.78 ± 6.10) when compared with B (-0.14 ± 1.46) and C (1.63 ± 1.98) (P = .015). This pump also produced the worst changes, with an increase in free haemoglobin (0.05 ± 0.05; P = .038) and more haemolysis (0.08 ± 0.07; P = .033). There were significant differences and an increase in the degree of haemolysis (P = .004) at the infusion rate of 100 mL/h. CONCLUSIONS: Syringe infusion pumps may cause significant red blood cell damage during infusion, with increases in free haemoglobin, potassium, and the degree of haemolysis. Some pump types, with a cassette mechanism, caused more damage. RELEVANCE TO CLINICAL PRACTICE: In many intensive care units, bedside nurses are able to consider infusion pump choice, and understanding the impact of different pump types on red blood cells during a transfusion provides the nurses with more information to enhance decision-making and improve the quality of the transfusion.

Assuntos

RESUMO

Antimicrobial peptides (AMPs) represent a promising and effective alternative for combating pathogens, having some advantages compared to conventional antibiotics. However, AMPs must also contend with complex and specialised Gram-negative bacteria envelops. The variety of lipopolysaccharide and phospholipid composition in Gram-negative bacteria strains and species are decisive characteristics regarding their susceptibility or resistance to AMPs. Such biological and structural barriers have created delays in tuning AMPs to deal with Gram-negative bacteria. This becomes even more acute because little is known about the interaction AMP-Gram-negative bacteria and/or AMPs' physicochemical characteristics, which could lead to obtaining selective molecules against Gram-negative bacteria. As a consequence, available AMPs usually have highly associated haemolytic and/or cytotoxic activity. Only one AMP has so far been FDA approved and another two are currently in clinical trials against Gram-negative bacteria. Such a pessimistic panorama suggests that efforts should be concentrated on the search for new molecules, designs and strategies for combating infection caused by this type of microorganism. This review has therefore been aimed at describing the currently available AMPs for combating Gram-negative bacteria, exploring the characteristics of these bacteria's cell envelop hampering the development of new AMPs, and offers a perspective regarding the challenges for designing new AMPs against Gram-negative bacteria.

RESUMO

BACKGROUND: The incidence of malaria in the Americas has decreased markedly in recent years. Honduras and the other countries of Mesoamerica and the island of Hispaniola have set the goal of eliminating native malaria by the year 2020. To achieve this goal, Honduras has recently approved national regulations to expand the possibilities of a shortened double dose primaquine (PQ) treatment for vivax malaria. Considering this new shortened anti-malarial treatment, the high frequency of G6PDd genotypes in Honduras, and the lack of routinely assessment of the G6PD deficiency status, this study aimed at investigating the potential association between the intake of PQ and haemolysis in malaria-infected G6PDd subjects. METHODS: This was a prospective cohort and open-label study. Participants with malaria were recruited. Plasmodium vivax infection was treated with 0.25 mg/kg of PQ daily for 14 days. Safety and signs of haemolysis were evaluated by clinical criteria and laboratory values before and during the 3rd and 7th day of PQ treatment. G6PD status was assessed by a rapid test (CareStart™) and two molecular approaches. RESULTS: Overall 55 participants were enrolled. The frequency of G6PD deficient genotypes was 7/55 (12.7%), where 5/7 (71.4%) were hemizygous A- males and 2/7 (28.6%) heterozygous A- females. Haemoglobin concentrations were compared between G6PD wild type (B) and G6PDd A- subjects, showing a significant difference between the means of both groups in the 3rd and 7th days. Furthermore, a statistically significant difference was evident in the change in haemoglobin concentration between the 3rd day and the 1st day for both genotypes, but there was no statistical difference for the change in haemoglobin concentration between the 7th day and the 1st day. Besides these changes in the haemoglobin concentrations, none of the patients showed signs or symptoms associated with severe haemolysis, and none needed to be admitted to a hospital for further medical attention. CONCLUSIONS: The findings support that the intake of PQ during 14 days of treatment against vivax malaria is safe in patients with a class III variant of G6PDd. In view of the new national regulations in the shortened treatment of vivax malaria for 7 days, it is advisable to be alert of potential cases of severe haemolysis that could occur among G6PD deficient hemizygous males with a class II mutation such as the Santamaria variant, previously reported in the country.

Assuntos

Assuntos

RESUMO

Resumen El síndrome de HELLP es una complicación multisistémica del embarazo que se distingue por el trastorno hipertensivo más la triada: Hemólisis microangiopática, elevación de enzimas hepáticas y disminución del conteo de plaquetas. Está asociado con la aparición de graves complicaciones perinatales e incremento de la mortalidad materna. Ocurre en 0,5 a 0,9% de todos los embarazos y en 10 a 20% de las pacientes con preeclampsia-eclampsia. Complicaciones obstétricas como ésta pueden pasarse por alto en la práctica clínica, generando situaciones de alto riesgo tanto para la madre como para el embrión, por lo que debe tenerse en cuenta su sintomatología y semiología dadas las dificultades en el diagnóstico diferencial.

Abstract HELLP syndrome is a multisystem complication of pregnancy that is characterized by hypertensive disorder plus the triad: microangiopathic hemolysis, elevation of liver enzymes, and decreased platelet count. It is associated with the appearance of serious perinatal complications and increased maternal mortality. It occurs in 0.5 to 0.9% of all pregnancies and in 10 to 20% of patients with pre-eclampsia/eclampsia. Obstetric complications can be overlooked in clinical practice, generating high risk situations for both the mother and the embryo, therefore, its symptoms and semiology should be taken into account given the difficulties in the differential diagnosis.

RESUMO

La Hemoglobinuria Paroxística Nocturna (HPN) se caracteriza por hemólisis intravascular crónica mediada por complemento. Cuando se produce la hemolisis se libera a circulación Anhidrasa Carbónica- I (AC-I), una enzima que se halla en alta concentración en el eritrocito y por su bajo peso molecular filtra por el glomérulo. El objetivo del presente trabajo fue detectar la excreción de la AC-I en orina de pacientes con HPN por Electroforesis Bidimensional de Utilidad Clínica (2D UC), y compararla con otras causas de hemólisis, de origen renal y postrenal. Se evaluaron 8 pacientes con HPN sin tratamiento con eculizumab un inhibidor del C5 del complemento, y 5 de ellos postratamiento, 12 orinas de pacientes con nefritis lúpica y 10 orinas de pacientes con hemólisis postrenal. La AC-I puede estar presente en la orina, en los tres grupos, sin embargo la relación AC-I/Hemoglobina en la hemólisis intravascular está invertida en comparación con la hemolisis glomerular y post-renal. Los pacientes con HPN tratados con eculizumab no presentan AC-I, y sería de utilidad en el seguimiento de los pacientes tratados con el inhibidor del C5, para evidenciar posibles escapes hemolíticos.

Paroxysmal Nocturnal Hemoglobinuria (PNH) is characterized by chronic complement mediated haemolysis. In these conditions it might be expected that carbonic anhydrase-I (AC-I) would be liberated into the plasma and excreted in the urine, by its high concentration in the erythrocyte and low molecular weight. The objective of the present study was to detect the urinary excretion of AC-I from patients with PNH by wodimensional clinical utility electrophoresis (2D UC) and to compare it with other causes of renal and post-renal haemolysis. We evaluated 8 patients with PNH without eculizumab, a complement C5 inhibitor, 5 of them posttreatment, 12 urine of patients with lupus nephritis and 10 urine of patients with post-renal hemolysis. AC-I may be present in the urine, in all three groups, however, the AC-I/Haemoglobin ratio in intravascular haemolysis is reversed compared to glomerular and post-renal haemolysis. Patients with PNH treated with eculizumab do not have AC-I and would be useful in monitoring patients treated with the C5 inhibitor to evidence possible haemolytic leaks.

Assuntos

RESUMO

OBJECTIVE: The aim of this study was to estimate the incremental budget impact (IBI) of a rapid diagnostic test to detect G6PDd in male patients infected with Plasmodium vivax in the Brazilian Amazon, as compared with the routine protocol recommended in Brazil which does not include G6PDd testing. METHODS: The budget impact analysis was performed from the perspective of the Brazilian health system, in the Brazilian Amazon for the years 2013, 2014 and 2015. The analysis used a decision model to compare two scenarios: the first consisting of the routine recommended in Brazil which does not include prior diagnosis of dG6PD, and the second based on the use of RDT CareStart™ G6PD (CS-G6PD) in all male subjects diagnosed with vivax malaria. The expected implementation of the diagnostic test was 30% in the first year, 70% the second year and 100% in the third year. RESULTS: The analysis identified negative IBIs which were progressively smaller in the 3 years evaluated. The sensitivity analysis showed that the uncertainties associated with the analytical model did not significantly affect the results. CONCLUSION: A strategy based on the use of CS-G6PD would result in better use of public resources in the Brazilian Amazon.

Assuntos

RESUMO

UNLABELLED: The bactericidal activity (minimum inhibitory concentration (MIC)-test) of Ocimum americanum (inflorescences) essential oil (OAEO) against Aeromonas hydrophila was determined in this study. Also investigated was the potential of OAEO and the main compound found in the oil (linalool) at subinhibitory concentrations to be inhibitors of haemolysis caused by Aer. hydrophila in fish erythrocytes. An in vivo experiment was conducted to evaluate the survival of fish (Rhamdia quelen) experimentally infected with Aer. hydrophila and exposed to OAEO. A second experiment was conducted to evaluate the in vitro and in vivo activity of OAEO (mix from inflorescences and leaves) against the parasite Gyrodactylus sp. The OAEO showed weak in vitro activity against Aer. hydrophila (6400 µg ml(-1) ). Subinhibitory concentrations of OAEO (100 µg ml(-1) ) inhibited haemolysis (90%) caused by Aer. hydrophila in fish erythrocytes, however, linalool did not inhibit haemolysis activity. At the low concentrations (10 and 20 mg l(-1) ) added to the water, OAEO promoted the survival of fish experimentally infected with Aer. hydrophila. Lastly, the OAEO mix (50 mg l(-1) ) was effective against Gyrodactylus sp., significantly reducing (60%) the number of parasites in the fish. SIGNIFICANCE AND IMPACT OF THE STUDY: Phytochemicals, such as essential oils (EOs) are a great source of new molecules and have shown potential to be used in aquaculture systems. However, additional studies focused on the in vivo efficacy, mode of action and identification of the active compounds are needed. This study determined the potential of Ocimum americanum EO for use against two important fish pathogens, Aeromonas hydrophila and Gyrodactylus sp., as well as providing preliminary information about the role of the main EO compound (linalool) against Aer. hydrophila virulence.

Assuntos

RESUMO

The main purpose of the present study is to evaluate the ability of nanoemulsion entrapping pomegranate peel polyphenol-rich ethyl acetate fraction (EAF) prepared from pomegranate seed oil and medium chain triglyceride to protect human erythrocyte membrane from oxidative damage and to assess preliminary in vitro photosafety. In order to evaluate the phototoxic effect of nanoemulsions, human red blood cells (RBCs) are used as a biological model and the rate of haemolysis and photohaemolysis (5 J cm(-2) UVA) is assessed in vitro. The level of protection against oxidative damage caused by the peroxyl radical generator AAPH in human RBCs as well as its effects on bilayer membrane characteristics such as fluidity, protein profile and RBCs morphology are determined. EAF-loaded nanoemulsions do not promote haemolysis or photohaemolysis. Anisotropy measurements show that nanoemulsions significantly retrain the increase in membrane fluidity caused by AAPH. SDS-PAGE analysis reveals that AAPH induced degradation of membrane proteins, but that nanoemulsions reduce the extension of degradation. Scanning electron microscopy examinations corroborate the interaction between AAPH, nanoemulsions and the RBC membrane bilayer. Our work demonstrates that Punica granatum nanoemulsions are photosafe and protect RBCs against oxidative damage and possible disturbance of the lipid bilayer of biomembranes. Moreover it suggests that these nanoemulsions could be promising new topical products to reduce the effects of sunlight on skin.

Assuntos

RESUMO

Trichomonas vaginalis expresses multiple proteinases, mainly of the cysteine type (CPs). A cathepsin L-like 34kDa CP, designated TvCP4, is synthesized as a 305-amino-acid precursor protein. TvCP4 contains the prepro fragment and the catalytic triad that is typical of the papain-like CP family of clan CA. The aim of this work was to determine the function of the recombinant TvCP4 prepro region (ppTvCP4r) as a specific inhibitor of CPs. We cloned, expressed, and purified the recombinant TvCP4 prepro region. The conformation of the purified and refolded ppTvCP4r polypeptide was verified by circular dichroism spectroscopy and fluorescence emission spectra. The inhibitory effect of ppTvCP4r was tested on protease-resistant extracts from T. vaginalis using fluorogenic substrates for cathepsin L and legumain CPs. In 1-D zymograms, the inhibitory effect of ppTvCP4r on trichomonad CP proteolytic activity was observed in the ∼97, 65, 39, and 30 kDa regions. By using 2-D zymograms and mass spectrometry, several of the CPs inhibited by ppTvCP4r were identified. A clear reduction in the proteolytic activity of several cathepsin L-like protein spots (TvCP2, TvCP4, TvCP4-like, and TvCP39) was observed compared with the control zymogram. Moreover, pretreatment of live parasites with ppTvCP4r inhibited trichomonal haemolysis in a concentration dependent manner. These results confirm that the recombinant ppTvCP4 is a specific inhibitor of the proteolytic activity of cathepsin L-like T. vaginalis CPs that is useful for inhibiting virulence properties depending on clan CA papain-like CPs.

Assuntos

RESUMO

Plasmodium vivax radical cure requires the use of primaquine (PQ), a drug that induces haemolysis in glucose-6-phosphate dehydrogenase deficient (G6PDd) individuals, which further hampers malaria control efforts. The aim of this work was to study the G6PDd prevalence and variants in Latin America (LA) and the Caribbean region. A systematic search of the published literature was undertaken in August 2013. Bibliographies of manuscripts were also searched and additional references were identified. Low prevalence rates of G6PDd were documented in Argentina, Bolivia, Mexico, Peru and Uruguay, but studies from Curaçao, Ecuador, Jamaica, Saint Lucia, Suriname and Trinidad, as well as some surveys carried out in areas of Brazil, Colombia and Cuba, have shown a high prevalence (> 10%) of G6PDd. The G6PD A-202A mutation was the variant most broadly distributed across LA and was identified in 81.1% of the deficient individuals surveyed. G6PDd is a frequent phenomenon in LA, although certain Amerindian populations may not be affected, suggesting that PQ could be safely used in these specific populations. Population-wide use of PQ as part of malaria elimination strategies in LA cannot be supported unless a rapid, accurate and field-deployable G6PDd diagnostic test is made available.

Assuntos

RESUMO

Trichomonas vaginalis has multiple proteinases, mainly of the cysteine type (CPs), including a 34 kDa precursor cathepsin L-like CP dubbed TvCP4. TvCP4 is an iron-up-regulated CP. The goal of this work was to identify the role of TvCP4 in the virulence of T. vaginalis. We cloned, expressed, and purified the recombinant mature enzyme region of TvCP4 (TvCP4r) to produce a rabbit polyclonal antibody (α-TvCP4r). This antibody reacted with a ∼24 kDa protein band in total protein extracts that could correspond to the mature enzyme. By two-dimensional western blot assays TvCP4 corresponded to three protein spots of ∼24 kDa with pI values of ∼6.7, 6.9, and 7.0 and two spots of ∼22 and ∼21 kDa with a pI of 6.9, as confirmed by mass spectrometry. As expected, a higher amount of TvCP4 was detected in cytoplasmic vesicles, lysosomes, and on the surface of iron-rich parasites when compared with normal and iron-depleted parasites. The α-TvCP4r antibody protected human erythrocytes from trichomonal lysis. Additionally, TvCP4 is expressed during infection and is part of the released products detected in vaginal fluids of patients with trichomonosis. Thus, data show that TvCP4 is an iron-induced CP that participates in T. vaginalis haemolysis.

Assuntos

RESUMO

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.

Assuntos

RESUMO

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG, R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.(AU)

Assuntos

RESUMO

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.

Assuntos

RESUMO

Fourteen isolates of Corynebacteruim pseudotuberculosis of them 7 were isolated from sheep with Caseous Lymphadenitis "biotype 1" and 7 isolated from buffaloes with Oedematous Skin Disease "biotype 2". All isolates were identified by standard microbiological techniques and by polymerase chain reaction targeting, 16S rRNA and phospholipase D genes. Synergistic haemolytic titers of all isolates were assayed by plate technique. The presences of phospholipase D gene in supernatants of all isolates were performed by sodium dodecyl sulfate polyacrylamide gel electrophoresis immunoblot technique by using hyperimmune serum raised in rabbit immunized with recombinant phospholipase D gene antigen. The concentration of phospholipase D gene was assayed by scanning the bound phospholipase D gene with specific antibodies that appeared at 31.5 kDa. Results presented that there is no correlation between titer of Synergistic haemolytic activity and the actual phospholipase D genes concentration in culture supernatants. Also results presented that Synergistic haemolytic activity and phospholipase D genes produced by biotype 2 (buffalo isolates) was generally higher than those by biotype 1(sheep isolates).

Assuntos

RESUMO

Fourteen isolates of Corynebacteruim pseudotuberculosis of them 7 were isolated from sheep with Caseous Lymphadenitis "biotype 1" and 7 isolated from buffaloes with Oedematous Skin Disease "biotype 2". All isolates were identified by standard microbiological techniques and by polymerase chain reaction targeting, 16S rRNA and phospholipase D genes. Synergistic haemolytic titers of all isolates were assayed by plate technique. The presences of phospholipase D gene in supernatants of all isolates were performed by sodium dodecyl sulfate polyacrylamide gel electrophoresis immunoblot technique by using hyperimmune serum raised in rabbit immunized with recombinant phospholipase D gene antigen. The concentration of phospholipase D gene was assayed by scanning the bound phospholipase D gene with specific antibodies that appeared at 31.5 kDa. Results presented that there is no correlation between titer of Synergistic haemolytic activity and the actual phospholipase D genes concentration in culture supernatants. Also results presented that Synergistic haemolytic activity and phospholipase D genes produced by biotype 2 (buffalo isolates) was generally higher than those by biotype 1(sheep isolates).

RESUMO

Fourteen isolates of Corynebacteruim pseudotuberculosis of them 7 were isolated from sheep with Caseous Lymphadenitis "biotype 1" and 7 isolated from buffaloes with Oedematous Skin Disease "biotype 2". All isolates were identified by standard microbiological techniques and by polymerase chain reaction targeting, 16S rRNA and phospholipase D genes. Synergistic haemolytic titers of all isolates were assayed by plate technique. The presences of phospholipase D gene in supernatants of all isolates were performed by sodium dodecyl sulfate polyacrylamide gel electrophoresis immunoblot technique by using hyperimmune serum raised in rabbit immunized with recombinant phospholipase D gene antigen. The concentration of phospholipase D gene was assayed by scanning the bound phospholipase D gene with specific antibodies that appeared at 31.5 kDa. Results presented that there is no correlation between titer of Synergistic haemolytic activity and the actual phospholipase D genes concentration in culture supernatants. Also results presented that Synergistic haemolytic activity and phospholipase D genes produced by biotype 2 (buffalo isolates) was generally higher than those by biotype 1(sheep isolates).