RESUMO

Los cereales integrales son una categoría de alimentos fundamental para la dieta humana y representan una fuente invaluable de carbohidratos, proteínas, fibras, fitoquímicos, minerales y vitaminas. Muchos estudios han demostrado que el consumo de cereales integrales está relacionado con un menor riesgo de enfermedades crónicas no transmisibles. Sin embargo, varios de sus efectos positivos para la salud parecen desaparecer cuando se refinan los cereales. La pregunta de investigación es cuál sería el efecto de los cereales integrales en la prevención de enfermedades crónicas no transmisibles. Este artículo describe los efectos positivos del consumo de cereales integrales en la prevención de estas enfermedades. Para ello, se realiza una descripción narrativa que revisa los antecedentes disponibles sobre: a) situación epidemiológica en Chile y su relación con la alimentación; b) consumo de cereales integrales en el mundo y en Chile; y c) el efecto del consumo de cereales integrales en la reducción del riesgo de enfermedad cardiovascular. obesidad, diabetes tipo 2 y cáncer. Los antecedentes generales son muy alentadores sobre el efecto positivo del consumo de cereales integrales sobre determinadas enfermedades, especialmente las de origen metabólico. Sin embargo, la incertidumbre de algunas asociaciones negativas merece mayor atención.

Whole grains are a fundamental food category for the human diet and represent an invaluable source of carbohydrates, proteins, fibers, phytochemicals, minerals and vitamins. Many studies have shown that consumption of whole grains is linked to a lower risk of chronic non-communicable diseases. However, several of its positive health effects seem to disappear when grains are refined. The research question is what would be the effect of whole grains in the prevention of Chronic Non-Communicable Diseases. This article describes the positive effects of whole grain consumption in these diseases.To this end, a narrative description is made that reviews the available background on: a) epidemiological situation in Chile and its relationship with diet; b) consumption of whole grains in the world and in Chile; and c) the effect of whole grain consumption on reducing the risk of cardiovascular disease. obesity, type 2 diabetes, and cancer. The general background is very encouraging for a positive effect of whole grain consumption on certain diseases, especially those of metabolic origin. However, the uncertainty of some negative associations deserves further attention.

RESUMO

Protein concentrates obtained from discarded grain flours of white chickpea Sinaloa (Cicer arietinum) (CC), "Azufrazin" bean (Phaseolus vulgaris) (BC), and white corn (Zea mays) (MC), were characterized biochemically through bromatological analyses (protein, lipid, fiber, moisture, ashes, and nitrogen free extract), HPLC techniques (amino acids content), and spectrophotometry (anti-nutrients: phytic acid, trypsin inhibitors, and saponins). The percentage of protein obtained from CC, BC, and MC was 71.23, 81.10, and 55.69%, respectively. Most peptides in the BC and CC flours had a molecular weight of <1.35 kDa, meanwhile, MC peptides were heavier (1.35 to 17 kDa). The amino acids (AA) profile of flours and protein concentrates were similar; however, all the protein concentrates showed an increased AA accumulation (300 to -400%) compared with their flours. The protein concentrates from BC registered the highest AA accumulation (77.4 g of AA/100 g of protein concentrates). Except for the phytic acid in CC and trypsin inhibitor in CC and MC, respectively, the rest of the protein concentrates exhibited higher amounts of the anti-nutrients compared with their flours; however, these levels do not exceed the reported toxicity for some animals, mainly when used in combination with other ingredients for feed formulations. It is concluded that CC and BC protein concentrates showed better nutritional characteristics than MC (level of protein, size of peptides, and AA profile). After biochemical characterization, protein concentrates derived from by-products have nutritional potential for the animal feed industry.

RESUMO

Introducción. La calidad de los carbohidratos consumidos juega un papel importante en la prevención de las enfermedades crónicas no transmisibles (ECNT). Objetivo. Analizar el índice de calidad de los carbohidratos (ICC) en la población urbana costarricense y su relación con las variables sociodemográficas, antropométricas y la calidad y la diversidad de la dieta. Materiales y métodos. Los datos provienen del Estudio Latinoamericano de Nutrición y Salud, en una muestra representativa de 798 personas entre 15 y 65 años que residen en zonas urbanas de Costa Rica (2014- 2015). En una visita domiciliaria se administró un cuestionario para recolectar los datos sociodemográficos y se pesó y midió a los participantes. El consumo dietético se obtuvo mediante dos recordatorios de 24 horas en días no consecutivos. El ICC se calculó mediante el consumo de fibra, el índice glicémico, la relación carbohidratos sólidos/líquidos y la relación granos enteros/granos totales. Se comparó el ICC según el sexo, el grupo de edad, el nivel socioeconómico, el estado nutricional, la circunferencia de cintura y la calidad y diversidad de la dieta de los participantes. Resultados. El ICC se asoció positivamente con un mayor consumo de energía, carbohidratos totales, proteínas, grasas, colesterol, frutas, vegetales y leguminosas (p<0,001). Un mayor ICC se asoció positivamente con un mayor porcentaje de adecuación de micronutrientes y mayor índice de diversidad y calidad de la dieta (p<0,001), así como con un menor índice de masa corporal y una menor circunferencia de cintura al ajustar por sexo y edad (p<0,005). Conclusiones. El presente estudio demostró que un mayor ICC se asocia significativamente con mejores indicadores dietéticos e índice de masa corporal, por lo que resulta fundamental establecer en Costa Rica pautas dietéticas que permitan aumentar la calidad de los carbohidratos de la dieta con el fin de contribuir en la prevención de las ECNT(AU)

Introduction. The carbohydrate quality index (CQI) plays an important role in the prevention of chronic non-communicable diseases (NCD) and adequate macro and micronutrient intake. Objective. To analyze the carbohydrate quality index (CCI) in the Costa Rican urban population and its relationship with sociodemographic and anthropometric variables and the quality and diversity of the diet. Materials and methods. Data come from the Latin American Nutrition and Health Study (ELANS), in a representative sample of 798 people between 15 and 65 years of age who reside in urban areas of Costa Rica (2014-2015). During a home visit, a questionnaire was administered to collect sociodemographic data, and participants were measured and weighed. Dietary intake was obtained through two 24-hour recalls in non- consecutive days. The CQI was calculated using fiber intake, glycemic index, liquid/solid carbohydrate ratio, and whole grain/total grains. CCI was then compared according to sex, age-group, socioeconomic level, nutritional status and diet quality and diet diversity. Results. The CQI was positively associated with energy intake, total carbohydrates, proteins, fats, cholesterol, fruits, vegetables, and legumes (p<0,001). Also, CQI was associated with a higher percentage of micronutrient adequacy and diet quality and diversity (p<0,001), as well as with a lower body mass index and lower waist circumference when adjusting for sex and age (p<0,005). Conclusions. The present study showed that higher CQI is associated with better dietary and body mass index, which shows that it is essential to establish dietary guidelines for public health in Costa Rica that allows increasing the quality of carbohydrates in the diet to contribute to the prevention of chronic NCD(AU)

Assuntos

RESUMO

The use of biopolymeric materials is restricted for some applications due to their deficient properties in comparison to synthetic polymers. Blending different biopolymers is an alternative approach to overcome these limitations. In this study, we developed new biopolymeric blend materials based on the entire biomasses of water kefir grains and yeast. Film-forming dispersions with varying ratios of water kefir to yeast (100/0, 75/25, 50/50 25/75 and 0/100) underwent ultrasonic homogenisation and thermal treatment, resulting in homogeneous dispersions with pseudoplastic behaviour and interaction between both biomasses. Films obtained by casting had a continuous microstructure without cracks or phase separation. Infrared spectroscopy revealed the interaction between the blend components, leading to a homogeneous matrix. As the water kefir content in the film increased, transparency, thermal stability, glass transition temperature and elongation at break also increased. The thermogravimetric analyses and the mechanical tests showed that the combination of water kefir and yeast biomasses resulted in stronger interpolymeric interactions compared to single biomass films. The ratio of the components did not drastically alter hydration and water transport. Our results revealed that blending water kefir grains and yeast biomasses enhanced thermal and mechanical properties. These studies provided evidence that the developed materials are suitable candidates for food packaging applications.

RESUMO

PREMISE: Distyly is a condition in which individual plants in a population express two floral morphs, L- and S-morph, characterized by reciprocal placements of anthers and stigmas between morphs. The function of distyly requires that pollinators collect pollen from L- and S-morphs on different parts along their bodies to then deposit it on the stigmas of the opposite morph, known as legitimate pollination. However, different pollinator groups might differ in the ability to transfer pollen legitimately. METHODS: We investigated patterns of pollen pickup along the body of different functional groups (hummingbirds and bees) using preserved specimens to analyze their role in the reproductive success of Palicourea rigida. We measured pollen deposition on the body of pollinators, on stigmas, and fruit production after a single visit. RESULTS: Pollen from L- and S-flowers appeared segregated on different body parts of the hummingbird and bee used in the study. S-pollen was deposited primarily on the proximal regions (near the head), and L-pollen was placed in the distal regions (tip of the proboscis and bill). Hummingbirds were more efficient at legitimate pollination than bees, particularly to S-stigmas. However, fruit formation after single visits by both pollinators was similar. CONCLUSIONS: The morphology of distylous flowers allows the segregated placement of L-and S-pollen on different body parts of the animal specimens used, facilitating the promotion of legitimate pollen transfer, an observation consistent between the two functional pollinator groups. Also, the results show that full fruit set requires more than one visit.

Assuntos

RESUMO

BACKGROUND: The application of allyl isothiocyanate (AITC) has been proposed as an alternative to control stored-grain insects. However, AITC is a compound with a low diffusion coefficient, making its distribution throughout the grain mass difficult. Therefore, the objective of the present study was to evaluate the effectiveness of AITC applied in systems with or without recirculation for controlling Sitophilus zeamais (Mots. 1855) (Coleoptera: Curculionidae), Rhyzopertha dominica (Fabr.) (Coleoptera: Bostrichidae), and Tribolium castaneum (Herbst) (Coleoptera: Tenebrionidae) infesting a corn grain mass. The assays used a polyvinyl chloride (PVC) prototype, dimensioned 1.60 m in length, 0.30 m in diameter, and a static capacity of 60 kg of grains. AITC toxicity to insects was evaluated at the base, 0.5 m from the base, and top of the grain column (1.0 m). Different concentrations of AITC were tested for an exposure period of 48 h. RESULTS: In the system without AITC recirculation, insect mortality was verified only at the base of the grain column. However, insect mortality was considered uniform at the different positions of the column when the AITC recirculation system was adopted. In this system, there was also a marked reduction in the instantaneous population growth rate of S. zeamais, T. castaneum, and R. dominica, and a decrease in the dry matter loss of the grains, when the AITC concentrations were increased. CONCLUSION: AITC recirculation proved to be a viable strategy for protecting grains against the species S. zeamais, R. dominica, and T. castaneum. AITC fumigation ultimately did not cause changes in grain quality. © 2023 Society of Chemical Industry.

Assuntos

RESUMO

Genipa americana L., commonly known as genipap, belongs to the Rubiaceae family. This study aimed to describe the pollen morphology of the species, evaluate its meiotic behavior and pollen viability, and provide information to help the maintenance and conservation of the species in its natural habitat. Flower buds were collected from 20 individuals in Alta Floresta and Matupá municipalities, Mato Grosso, Brazil. Pollen morphology was characterized using acetolysis and compared to existing literature. Meiotic and post-meiotic phases were analyzed using 2% acetocarmine stain, and pollen viability was estimated using Sudan IV, Alexander's stain, Lugol's solution (1%), and 2% acetocarmine stain. G. americana has medium-sized, 3-colporate pollen with reticulated exine and few meiotic irregularities. Acetocarmine stain showed the highest mean percentage of pollen viability (97.96%). Stain tests revealed significant differences, indicating high pollen viability and meiotic regularity. However, conservation and recovery of degraded areas are still necessary as there is no guarantee of successful reproduction due to factors associated with fragmentation, genetic drift, reduced gene flow, and inbreeding.

RESUMO

ABSTRACT OBJECTIVE This study aims to evaluate the use of "whole grains" claims in food products marketed in Brazil and evaluate the nutrient profile of these products. METHODS Data from 775 grain-based packaged foods collected in Brazil from April to July 2017 were analyzed. Based on the INFORMAS protocol for food labeling, the prevalence of packaged foods with "whole grains" claims was estimated. Information on the list of ingredients was analyzed to evaluate the presence and amount of whole or refined grains in six food groups. The nutrient profiles of the products with and without "whole grains" claims were compared using the Pan American Health Organization (PAHO) nutrient profile model. RESULTS The packages of about 19% of the evaluated products showed "whole grains" claims in their front panel. Of these, 35% lacked any whole grains among their top three ingredients. Breakfast cereals, granola bars, bread, cakes and other bakery products, cookies, and pasta had higher amounts of refined flour than whole grain ingredients in their compositions.We found 66% of products with "whole grains" claims were high in nutrients of concern according to PAHO's criteria. CONCLUSION Our results showed that over a third of the products in Brazil with "whole grains" claims lacked whole grains as one of their main ingredients. Most had a high content of nutrients associated with noncommunicable chronic disease risk factors, indicating the overestimation of their health benefits.

Assuntos

RESUMO

Nowadays, the use of biomass to produce cathode materials for lithium-sulfur (Li-S) batteries is an excellent alternative due to its numerous advantages. Generally, biomass-derived materials are abundant, and their production processes are environmentally friendly, inexpensive, safe, and easily scalable. Herein, a novel biomass-derived material was used as the cathode material in Li-S batteries. The synthesis of the new carbonaceous materials by simple carbonization and washing of water kefir grains, i.e., a mixed culture of micro-organisms, is reported. The carbonaceous materials were characterized morphologically, texturally and chemically by using scanning electron microscopy, N2 adsorption-desorption, thermogravimetric analysis, X-ray diffraction, and both Raman and X-ray photoelectron spectroscopy. After sulfur infiltration using the melt diffusion method, a high sulfur content of ~70% was achieved. Results demonstrated that the cell fitted with a cathode prepared following a washing step with distilled water after carbonization of the water kefir grains only, i.e., not subjected to any chemical activation, achieved good electrochemical performance at 0.1 C. The cell reached capacity values of 1019 and 500 mAh g-1 sulfur for the first cycle and after 200 cycles, respectively, at a high mass loading of 2.5 mgS cm-2. Finally, a mass loading study was carried out.

RESUMO

ABSTRACTThis study evaluated the effectiveness of a semi-continuous flow-through subcritical water hydrolysis (SWH) pretreatment of brewer's spent grains (BSG) for subsequent application in the anaerobic digestion (AD) process. BSG pretreatment was conducted at 160 °C and 15 MPa with a flow rate of 10 mL water min-1 and 15 g water g-1 BSG. The results revealed that SWH attacked the hemicellulose structure, releasing arabinose (46.54 mg g-1) and xylose (39.90 mg g-1) sugars, and proteins (34.89 mg g-1). The start-up of anaerobic reactors using pretreated BSG (747.71 L CH4 kg-1 TVS) increased the methane yield compared with the reactor without pretreatment (53.21 L CH4 kg-1 TVS). For the process with pretreatment, the generation of electricity (134 kWh t-1 BSG) and heat (604 MJ t-1) are responsible for the mitigation of 43.90 kg CO2 eq t-1 BSG. The adoption of SWH as an eco-friendly pretreatment of biomass for AD could be a technological route to increase methane-rich biogas and bioenergy production, supporting the circular economy transition by reducing the carbon footprint of the beer industry.

RESUMO

A study was conducted to assess the chemical composition and apparent metabolizable energy (AME), nitrogen-corrected AME (AMEn), and their respective coefficients of dry brewery residue (DBR) for broilers. A second study was conducted to evaluate the increasing inclusions of DBR in broiler diets and its effects on growth performance, carcass traits, blood metabolites, and meat quality. In the first trial (metabolism assay), a total of 250 male broilers were assigned to 5 diets (0, 100, 200, 300, and 400 g DBR/kg) composed by 5 replications with 10 animals per cage in a completely randomized design in the period from days 11 to 21. There was an increasing linear effect for AME, AMEn, metabolizable coefficient of gross energy (MCGE), and MCGE corrected for N (MCGEn). In the second experiment, a total of 840 one-day-old male broiler chickens were assigned to 6 treatments (0, 20, 40, 60, 80, and 100 g DBR/kg) with 7 replications and 20 animals per pen, from days 0 to 42. Growth performance was determined at days 21 and 42. There was an increasing linear effect for weight gain in the period from days 0 to 21 and for feed intake from days 0 to 42. A linear decreasing effect was observed at day 21 for cholesterol and quadratic effect for uric acid (UA), aspartate aminotransferase, and albumin. At day 42, there was a quadratic effect for UA and creatinine. At day 21, an increasing linear effect was observed for protein deposition rate. In conclusion, the inclusion of DBR up to 100 g/kg improved WG in the starter phase and did not negatively affect the productive parameters of broilers from days 0 to 42.

Assuntos

RESUMO

The aim of this work was to study the production of kefir-like beverages via the fed-batch fermentation of red table grape juice at initial pHs of 3.99 (fermentation A) and 5.99 (fermentation B) with kefir grains during 4 repeated 24-h fed-batch subcultures. All kefir-like beverages (KLB) were characterized by low alcoholic grade (≤3.6%, v/v) and lactic and acetic acid concentrations. The beverages obtained from fermentation B had lower concentrations of sugars and higher microbial counts than the KLB obtained in fermentation A. Additionally, the KLB samples from fermentation B were the most aromatic and had the highest contents of alcohols, esters, aldehydes and organic acids, in contrast with the nonfermented juice and KLB from fermentation A. These results indicate the possibility of obtaining red table grape KLB with their own distinctive aromatic characteristics and high content in probiotic viable cells, contributing to the valorization of this fruit.

RESUMO

Bag storage of wheat is common in Asian countries, and common types of such bags include jute bags, woven plastic bags, and hermetic plastic bags. In order to assess infestation by two serious pests, namely Rhyzopertha dominica (Coleoptera: Bostrichidae) and Trogoderma granarium (Coleoptera: Dermestidae) in these bags, two experiments were performed. In the first experiment, three popular wheat varieties, namely Akbar, Dilkash, and Bakhar star were filled in above-mentioned miniature-size bags which were then placed in jars with three replicates per bag type and variety. Forty insects (adults for R. dominica and larvae for T. granarium) were released in the center of the jars for a period of 30 d in two different setups for both species. Data were recorded twice: after 15 d and 30 d. Results showed insects entered the jute bags only (made invasions due to its loose fibers and openings). Inside the bags, R. dominica caused more weight loss and live insects in Dilkash and Akbar varieties, while T. granarium preferred Bakhar star and Dilkash compared with their third variety. In the second experiment, only two bags, namely woven plastic bags and hermetic plastic bags filled with one variety, were tested to check damage (penetrations because no openings are present in these bags as in jute bags) to the bags. Results showed both species created holes in woven plastic bags but not in hermetic plastic bags. These results showed hermetic plastic bags remained safe from external infestation compared with the other two bags. Sometimes if insects are already present in the grains inside the bags, fumigation is needed from outside to kill the pests inside. To evaluate this, all three bags were filled with a wheat variety and were also infested with both insect species and placed in a fumigation container with nine replicates per bag type. A phosphine tablet (3.0 g) wrapped in muslin cloth was placed in a container which was then sealed, and the fumigation-induced mortality after 24 h was recorded. Results showed mortality was >95% to 100% in woven and jute bags, respectively, while mortality in hermetic plastic bags remained very low (<3%). These results revealed the least fumigant gas permeation in hermetic plastic bags compared with jute and woven plastic bags. Results of all three experiments demand immediate alteration in creation of all three bags to curtail infestation from outside (jute and woven plastic bags) as well as to generate maximum fumigation efficacy when the source of infestation is with the grains (hermetic bags).

RESUMO

Botanical repellents are, usually, considered safe to control Sitophilus zeamais, the main pest of stored maize, as they do not leave toxic residues in food, in addition to having lower costs than chemical insecticides. The aim of this study was to evaluate the repellency potential and the reduction of emerged offspring of botanical extracts, of Schinus terebinthifolius, Ludwigia sericea, L. tomentosa, L. nervosa, L. longifolia, and use them as botanical insecticides for S. zeamais. For the repellency test, arenas were set up, containing 50 g of maize kernels exposed to aqueous extract, besides a control treatment. At the center of each arena, 100 insects were released. After 48 h, the proportion of insects in the treated grains was determined. To test the effects of the extracts on insect mating and egg-laying, free-choice and no-choice tests were performed. Insects in both tests remained for ten days for mating and egg-laying. After this period, insects were removed to evaluate the offspring emergence. Sixty days after grain infestation, the number of emerged insects was counted. All selected botanical extracts demonstrated repellent action against S. zeamais, even after 48 h of application. The L. nervosa aqueous extract significantly reduced the emergence of S. zeamais.

RESUMO

This study aimed to analyze the effect of including increasing levels of distiller grains (DG) in beef cattle feeding diets on meat quality from an integral approach. To this end, we analyzed the meat from 36 yearling steers fed with four dietary treatments: 0DG (control corn-based diet), 15DG, 30DG, and 45DG (containing 15%, 30%, or 45% of DG on DM basis). Crude protein, ash, and fat contents of diets increased with DG level. The fatty acid profile of DG diets was reflected in the fatty acid profile of plasma samples. Feeding diets with DG had no effect on the biochemical parameters analyzed in plasma. In addition, it did not influence the water holding capacity, the muscle or fat color at 72 h post mortem or at retail display, or the contents of SFAs, MUFAs, and PUFAs in beef. The DG diets led to lower values of cooking loss. Meat from 15DG and 30DG showed greater percentage of troponin C and fragments of 30 to 27 kDa than meat from 45DG. Also, meat from 30DG showed the lowest values of Warner-Bratzler shear force. Hence, including up to 30% corn DG in beef cattle feeding diets had positive effects on meat quality.

Assuntos

RESUMO

Maize (Zea mays L.) is the main cereal food of humans and animals in Brazil. In 2020 and 2021, a severe infestation of corn leafhoppers (Dalbulus maidis; Hemiptera: Cicadellidae) was observed in Santa Catarina State (South of Brazil). Subsequently, symptoms of chlorotic stripes limited in leaf veins started to appear in maize plants. Given the similarity of symptoms and the presence of high populations of corn leafhoppers in corn production areas, 30 plants in reproductive stage showing systemic symptoms were collected in summer and autumn from commercial fields of five municipalities in Santa Catarina: Campos Novos (27°23'18.0"S, 51°12'52.7"W), Lages (27°47'17.8"S, 50°18'16.9"W), Mafra (26°06'42"S, 49°48'25"W), Fraiburgo (27°01'36"S, 50°55'19"W), and Abelardo Luz (26°34'02"S, 52°20'02"W). The young leaves of these samples were used for molecular analyses targeting the maize rayado fino virus (MRFV; Tymoviridae: Marafivirus). Total nucleic acids were extracted using TRIzol® (Invitrogen, USA), following the manufacturer's instructions. These were used as a template for cDNA synthesis with the enzyme MMLV-RT (Promega, USA), following the manufacturer's instructions. The polymerase chain reaction (PCR) was performed using Gotaq® DNA polymerase (Promega, USA) and MRFV-09/MRFV-10 primers (Hammond et al. 1997). All PCR products were subjected to electrophoresis in 1% agarose gel and were visualized under ultraviolet light. Twenty-eight of the 30 tested plants were MRFV-positive, showing a fragment with an expected size of ~633 bp. To confirm our results, all MRFV-positive samples were sent for sequencing (GenBank accession numbers OM763708 - OM763710 and ON730784 - ON730806) and submitted to BLASTn search (https://blast.ncbi.nlm.nih.gov/Blast.cgi), resulting in identities ranging from 96.21% to 99.21% with the isolate "Brazil 26" of MRFV, which was detected in 2005 in São Paulo, Brazil (GenBank accession nº: AF186178) (Hammond and Bedendo 2005). A second set of primers was used to validate the first PCR, confirming MRFV infection (data not shown).Moreover, whitish streaks and leaf reddening were observed on the leaves of some plants; therefore, the identification for phytoplasmas (Candidatus Phytoplasma asteris) and spiroplasmas (Spiroplasma kunkelii) from the corn stunt complex was performed. For this, previously extracted nucleic acids from each sample were used as templates for a multiplex PCR using the primers CSSR6/CSSF2 and R16F2n/R16R2 (Gundersen and Lee 1996; Barros et al. 2001). Two plants were infected with only spiroplasma, 17 samples were infected with Spiroplasma and MRFV, and three samples were infected by these three pathogens. An increasing incidence of corn stunt has been observed in commercial fields in Santa Catarina in recent years. Mollicutes are commonly found and mostly studied as causal agents of corn stunt disease. On the contrary, despite being present in Brazil since the 1970s, the virus is less studied because its contribution to the corn stunt complex is still unknown (Hammond and Bedendo 2001). In this report, indications that the virus is expanding to different regions in southern Brazil were observed, which raises an opportunity for further evaluation and its consideration in monitoring programs. Moreover, to the best of our knowledge, this is the first report of MRFV in Santa Catarina, Brazil.

RESUMO

Bioactive compounds, such as phenolic compounds, are phytochemicals found in significant amounts in cereals and pseudocereals and are usually evaluated by spectrophotometric (UV-VIS), HPLC, and LC-MS techniques. However, their bioavailability in grains is quite limited. This restriction on bioavailability and bioaccessibility occurs because they are in conjugated polymeric forms. Additionally, they can be linked through chemical esterification and etherification to macro components. Techniques such as thermoplastic extrusion, germination, fermentation, and hydrolysis have been widely studied to release phenolic compounds in favor of their bioavailability and bioaccessibility, minimizing the loss of these thermosensitive components during processing. The increased availability of phenolic compounds increases the antioxidant capacity and favor their documented health promoting.

RESUMO

The antidiabetic potential of bioactive peptides derived from simulated gastrointestinal digestion (SGID) of proteins present in amaranth quinoa and chia was evaluated using their bioactivity profile and theoretical interaction with DPP-IV and α-glucosidases. In silico SGID generated 52 different fragments with in vitro antidiabetic activity where fragments PW, PF, PPG, PM, SW, IW, SF, PP, PPL, PG, PY, VW and PL scored highly in bioactivity probability, with molecular weights ranging from 172.2 to 325.44 Da; positive bulkiness index and hydrophobicity (except PP and PY) and no toxic properties. Fragments IW and PW presented the lowest free energy values for enzymes DPP-IV, maltase-glucoamylase, pancreatic α-amylase and sucrase-isomaltase (-8.2, -7.5, -7.7 and -7.5 kcal/mol; and -7.8, -7.4, -8.2, -7.4 kcal/mol respectively) We can conclude that proteins from amaranth, quinoa and chia may be a good source of antidiabetic BP and may exert antidiabetic activity through the release of BP after digestion.

Assuntos

RESUMO

Wheat yellow (stripe) rust caused by Puccinia striiformis Westend. f. sp. tritici Eriks. (Pst) is an important disease worldwide (Chen 2005; Afzal et al., 2007; Hovmøller et al. 2011). In Latin America, the disease has been reported in Argentina, Bolivia, Chile, Colombia, Ecuador, Peru, Brazil, and Uruguay (van Beuningen and Kohli, 1986; German et al., 2007). The disease was observed for the first time in Paraguay at Capitán Miranda (Itapúa) (27°12'07.5888''S, 55°47'20.3640''W) in an environment with average minimum temperature below 10°C in July 2021 (coldest month). Symptoms were yellow rust pustules distributed linearly on the leaves of adult host plants (Fig. 1). Oval-shaped uredinia contained unicellular, yellow to orange, spherical urediniospores (28, 82 × 26, 83 µm), within the range reported by Rioux et al. (2015). Black telia produced yellow to orange teliospores (64, 12 × 15, 46 µm), which were within the range reported by Chen et al. (2014). All susceptible wheat cultivars had up to 100% disease severity. Ten- day-old seedlings of the susceptible cultivars were inoculated in a greenhouse using urediniospores collected from the field. Two weeks after inoculation, extensive sporulation was observed on the seedlings. For pathogen identification, DNA was extracted from wheat leaf segments containing urediniospores using the PureLink® Plant Total DNA Purification Kit (Invitrogen). PCR and sequencing were carried out by Macrogen (Korea), using the following species-specific primers: PSF (5`-GGATGTTGAGTGCTGCTGTAA-3`) / PSR (5`-TTGAGGTCTTAAGGTTAAAATTG-3`), which amplifies an internal transcribed spacer (ITS) region (Zhao et al. 2007); LidPs9 (TCGGTAAAACTGCACCAATACCT) / LidPs10 (TCCCAACAGTCCCCTTCTGT), which amplifies a fragment of the RNA polymerase II gene encoding the second largest subunit (rpb2); and LidPs11 (TTACGACATCTGCTTCCGCA) / LisPs12 (TGCGATGTCAACTCTGGGAC) and LidPs13 (TACGACATCTGCTTCCGCAC) / LidPs14 (GATTGCCCGGTATTGTTGGC), both pairs amplifying fragments of the ß-tubulin 1 gene (tub1) (Kuzdralinski et al. 2017). The sequences obtained were OM631935, OM638432, OM718000, and OM718001 and were aligned using the GenBank BLAST tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi), obtaining a 100% match with the following sequences: KC677574.1, KY411522.1, KY411533.1, and KY411542.1, respectively. Yellow-rust-infected leaf samples were collected from a field trial and sent to the Global Rust Reference Center (GRRC), Denmark. Simple sequence repeat (SSR) genotyping of samples from two different cultivars exhibited the genetic lineage PstS13 (www.wheatrust.org), which had previously been detected in South America (Carmona et al., 2019), thereby confirming the first report of wheat yellow rust in Paraguay. Considering that the Paraguayan wheat germplasm is highly susceptible to yellow rust, further studies are required to monitor potential spread and establishment of yellow rust in Paraguay and to explore potential sources of resistance to prevent future epidemics.

RESUMO

The aim of this work was to study the effect of finishing diets including distiller grains (DG) on color and oxidative stability of beef after being exposed to aerobic retail display conditions, with or without previous aging. For this purpose, beef samples from animals fed with finishing diets including 0%, 15%, 30%, and 45% DG (on a dry matter basis), which had been exposed to aerobic retail display conditions, with or without previous aging under vacuum packaging, were evaluated. The content of γ-tocopherol, ß-carotene, and lutein in diet samples increased with the level of DG. Beef evaluated at 72 h post-mortem showed greater content of γ-tocopherol and retinol as the DG level increased. Meat color was not affected by DG inclusion, but color parameters decreased with retail conditions. Meat from animals fed with DG showed the lowest values of thiobarbituric acid reactive substances (TBARS), independently of the retail display conditions. However, all samples were below the threshold associated with rancid aromas and above the a* value related to meat color acceptance. Thus, feeding diets including up to 45% of DG improved the antioxidant status of meat, preserving the color, and delaying lipid oxidation in meat samples under the display conditions evaluated.