RESUMO
In this investigation, fecal specimens from children with diarrhea were collected from four community studies conducted between 1982 and 2019 in Belém, Brazilian Amazon. A total of 234 samples were tested by quantitative reverse transcription polymerase chain reaction (RT-qPCR) to detect infections by picornaviruses of the Enterovirus (EV), Parechovirus (HPeV), Cosavirus (HCoSV), Kobuvirus (Aichivirus - AiV) and Salivirus (SalV) genera. The positive samples were subjected to different amplification protocols of the VP1 region of the genome, such as nested PCR or snPCR, and were subsequently genotyped by sequencing VP1 and VP3 of the viral genome. Positivity was observed in 76.5% (179/234) of the samples tested using RT-qPCR for at least one virus, and co-infection was observed in 37.4% (67/179) of the cases. EV was detected in 50.8% (119/234), HPeV in 29.9% (70/234), HCoSV in 27.3% (64/234), and AiV/SalV in 2.1% (5/234) of the specimens tested by RT-qPCR. Using nested PCR and/or snPCR techniques, the positivity rates were 94.11% (112/119) for EV, 72.85% (51/70) for HPeV, and 20.31% (13/64) for HCoSV. It was not possible to amplify the samples that were positive for AiV/SalV. Sequencing revealed 67.2% (80/119) EV, 51.4% (36/70) HPeV, and 20.31% (13/64) HCoSV. Forty-five different types of EV were found among species A, B, and C; HCoSV identified five species, including a possible recombinant strain; all HPeV were identified as belonging to species A, in two samples a possible recombination involving three different strains was verified. This study demonstrated the high circulation and diversity of different types of picornaviruses in fecal samples, including those collected more than 30 years ago. This endorsed the evaluation of important points in the epidemiology of these viruses, such as the presence of co-infection and the possibility of knowing more about these agents, considering that some were recently described; therefore, their detection in older samples can provide more data about their ancestry.
Assuntos
Coinfecção , Infecções por Enterovirus , Enterovirus , Infecções por Picornaviridae , Picornaviridae , Vírus , Criança , Humanos , Idoso , Picornaviridae/genética , Coinfecção/epidemiologia , Brasil/epidemiologia , Infecções por Enterovirus/epidemiologia , Enterovirus/genética , Diarreia/epidemiologiaRESUMO
The first rice virus detected in Argentina was Rice stripe necrosis virus (RSNV), a benyvirus known to cause "entorchamiento" due to its characteristic symptom of leaf crinkling. As part of this study, it was proposed to sequence plants naturally infected with RSNV that presented another symptom such as thickening of veins, serrated edges, chlorosis that turns necrotic and dwarfism to detect the presence of other viruses in mixed infections. We worked with 20 rice plants sampled in the San Javier area (Santa Fe, Argentina) and that were positive for RSNV by serology using anti-RSNV antiserum. Total RNA of 5mg leaf tissue from each plant was extracted separately using a Qiagen RNeasy Plant RNA kit. Ten µg of pooled sample was sent for library preparation using Ribo-Zero Plant Kit + TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 1500, 150 nucleotide (nt) flowcell at the IABIMO-CONICET/INTA (Argentina). The 177,005,442 reads generated were mapped to the Oryza sativa genome (RefSeq GCF_001433935) using Geneious software v.9.1.8 (Biomatters Limited, Auckland, New Zealand) to remove rice reads. The remaining reads (63,756,284) were assembled de novo using rnaviralSPAdes, Galaxy tools (https://usegalaxy.org.au/). Contigs were annotated using the BEST HIT of BLASTN vs. nt and BLASTX vs. the non-redundant sequence database. Forty virus sequences were analyzed using the ORF finder and BLAST tools at NCBI (http://www.ncbi.nlm.nih.gov/). The nt identity was calculated using the SDT 1.2 program (Muhire et al., 2014). The BLASTN results showed the presence of 38 contigs (636 reads) with high nt identity (higher than 97.6%) with Mal de Rio Cuarto virus (MRCV), with 58% genome coverage. Two other contigs (120 reads) had high nt identity to Fuyang picorna-like virus 2 (FpiV2, GenBank access MT317172), with 38% genome coverage. MRCV is a species of the Fijivirus genus, Reoviridae family, with a linear dsRNA genome composed of 10 segments encoding 12 proteins (Matthijnssens et al., 2022). In this work, it was possible to partially sequence the 10 segments of MRCV. Contigs with lengths greater than 1,000nt were detected that correspond to segments S1 (2029nt), S2 (2308nt), S3 (1249nt) and S4 (1067nt) and showed 98.32%, 98.48%, 97.68% and 97.75% nt identity with the reference sequences (GenBank access NC_008733, NC_008730, NC_008732 and NC_008729), respectively. A contig of 400 nt was identified as a capsid protein (CP) gene fragment (S10) with 98.75% nt identity to the reference sequence (NC_008734). The presence of MRCV was confirmed in 3 of the 20 samples by DAS-ELISA serological test using anti-MRCV antiserum. FpiV2 was reported for the first time infecting rice in China and, due to its genomic structure, was proposed as a new member of the Picornaviridae family, but without an assigned genus (Chao et al., 2021). It is a monopartite virus, with a linear ssRNA(+) genome of 9.2kb. Analysis of two sequence fragments (1587nt and 2086nt) revealed that they corresponded to the putative RdRp with 83.9% nt identity (90.2% aa) and the putative CP sequence with 86.7% nt identity (96.3% aa) with the GenBank sequence MT317172, respectively. Detection of this picorna-like virus was further confirmed in 2 of the 20 samples by RT-PCR and Sanger sequencing with virus-specific primers (PL2Fw: 5' TTATTTGTGAGTAACAGCCCAGCAC 3'; PL2Rv: 5' AGACCGAGGACTATGGAAGCCTTTC 3', 540nt). To our knowledge, this is the first report of rice as a natural host of MRCV and may be the second detection of FpiV2 worldwide.
RESUMO
Seneca Valley virus (SVV) is the only representative member of the Senecavirus genus of the Picornaviridae family. Since 2014, SVV has been identified as a causative agent of vesicular disease outbreaks in pigs of different ages from Brazil, the USA, Canada, China, Thailand, Colombia, Vietnam, and India. From May 2020, several pig herds, from the Brazilian states Parana and Santa Catarina reported vesicular disease in different pig categories. This study aimed to report the third wave of SVV outbreaks in pig herds in southern Brazil. A total of 263 biological samples from 150 pigs in 18 pig herds were evaluated. The samples were obtained from pigs with clinical signs of vesicular disease (n = 242) and asymptomatic animals (n = 21). Seneca Valley virus RNA was detected in 96 (36.5%) of the biological samples evaluated, with 89 samples from symptomatic and 7 from asymptomatic pigs. The data show that asymptomatic pigs, but in viremia, are possible sources of infection and can act as carriers and possibly spreaders of SVV to the herd. In this study, we report the third wave of vesicular disease outbreaks caused by SVV in different categories of pigs from herds located in southern Brazil.
Assuntos
Infecções por Picornaviridae , Picornaviridae , Doenças dos Suínos , Animais , Brasil/epidemiologia , Surtos de Doenças/veterinária , Picornaviridae/genética , Infecções por Picornaviridae/epidemiologia , Infecções por Picornaviridae/veterinária , Suínos , Doenças dos Suínos/epidemiologiaRESUMO
2A is an oligopeptide sequence that mediates a ribosome "skipping" effect and can mediate a co-translation cleavage of polyproteins. These sequences are widely distributed from insect to mammalian viruses and could act by accelerating adaptive capacity. These sequences have been used in many heterologous co-expression systems because they are versatile tools for cleaving proteins of biotechnological interest. In this work, we review and update the occurrence of 2A/2A-like sequences in different groups of viruses by screening the sequences available in the National Center for Biotechnology Information database. Interestingly, we reported the occurrence of 2A-like for the first time in 69 sequences. Among these, 62 corresponded to positive single-stranded RNA species, six to double stranded RNA viruses, and one to a negative-sense single-stranded RNA virus. The importance of these sequences for viral evolution and their potential in biotechnological applications are also discussed.
Assuntos
Biotecnologia , Vírus de RNA , Proteínas Virais , Animais , Cisteína Endopeptidases/metabolismo , Evolução Molecular , Picornaviridae/genética , Poliproteínas , Totiviridae/genética , Proteínas Virais/genéticaRESUMO
Members of the Picornaviridae family comprise a significant burden on the poultry industry, causing diseases such as gastroenteritis and hepatitis. However, with the advent of metagenomics, a number of picornaviruses have now been revealed in apparently healthy wild birds. In this study, we identified four novel viruses belonging to the family Picornaviridae in healthy Magellanic penguins, a near threatened species. All samples were subsequently screened by RT-PCR for these new viruses, and approximately 20% of the penguins were infected with at least one of these viruses. The viruses were distantly related to members of the genera Hepatovirus, Tremovirus, Gruhelivirus and Crahelvirus. Further, they had more than 60% amino acid divergence from other picornaviruses, and therefore likely constitute novel genera. Our results demonstrate the vast undersampling of wild birds for viruses, and we expect the discovery of numerous avian viruses that are related to hepatoviruses and tremoviruses in the future.
Assuntos
Infecções por Picornaviridae/epidemiologia , Infecções por Picornaviridae/veterinária , Picornaviridae/classificação , Picornaviridae/isolamento & purificação , Spheniscidae/virologia , Animais , Chile/epidemiologia , Espécies em Perigo de Extinção , Filogenia , Picornaviridae/genéticaRESUMO
Fecal samples from 27 pigs were longitudinally analyzed for Teschovirus A (TV-A), Sapelovirus A (SV-A), and Enterovirus G (EV-G) RNA presence. Suckling piglet fecal samples were negative for the three enteric picornaviruses. However, these picornaviruses were detected in 22/27 weaned pig fecal samples. This study provides new data on TV-A, SV-A, and EV-G infection dynamics.