Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 42
Filtrar
1.
Heliyon ; 10(15): e35238, 2024 Aug 15.
Artigo em Inglês | MEDLINE | ID: mdl-39170429

RESUMO

Objective: The primary objective of this study was to scrutinise the disparities in the diversity, structure, and function of the oral microbiome among caries-free children from the Zhuang and Han ethnic groups with a focus on the influence of ethnically distinct oral health behaviours on the composition of the oral microbiota. Methods: A questionnaire survey was conducted to assess oral health behaviours and dental plaque samples were collected from 96 Zhuang and Han children aged 4-5 years living in Guangxi, southern China for high-throughput sequencing. PCR amplification was performed for sequencing of the V4 region of the 16S rDNA gene, and second-generation sequencing was performed using the Illumina MiSeq platform to compare and analyse the diversity, structure and function of the microbiota. Results: Single-factor analysis revealed significant differences between the Zhuang and Han ethnic groups regarding juice consumption, the frequency of consuming sugar-sweetened food or beverages before bedtime, the age that individuals started toothbrushing, the frequency of toothbrushing and the frequency of parental assistance with toothbrushing (p < 0.001). The dominant phyla were Proteobacteria, Firmicutes, etc., and the dominant genera included Streptococcus and Neisseria. The dental plaques of the caries-free Zhuang and Han ethnic groups had similar core microbiomes, with no significant differences in the diversity and structure of the microbiota and no significant differences in the abundance of the dominant genera. In addition, no significant difference in metabolic function was observed between the Zhuang and Han ethnic groups. Conclusion: The core oral microbiota was consistent in caries-free Zhuang and Han children. Despite differences in dietary habits and oral hygiene behaviours between the Zhuang and Han ethnic groups, with a high frequency of sugary food intake but better oral health behaviours in the Zhuang group, there were no significant differences in the diversity, structure and function of the oral microbiota of caries-free children in the Zhuang and Han ethnic groups.

2.
Cancer Control ; 31: 10732748241278485, 2024.
Artigo em Inglês | MEDLINE | ID: mdl-39159955

RESUMO

OBJECTIVES: Signet ring cell carcinoma (SRCC) of the urinary bladder is a rare and highly aggressive form of bladder cancer, with no widely agreed-upon treatment strategy. The aim of this study was to identify important factors influencing patient prognosis and to assess how various treatment approaches affect survival outcomes. METHODS: A retrospective study was conducted using data from the Surveillance, Epidemiology, and End Results (SEER) Program, including patients with bladder primary SRCC who were presented between 2000 and 2017. Univariate and multivariate Cox regression models were used to examine the impact of various factors on cancer-specific survival (CSS) and overall survival (OS). Propensity score matching (PSM) and inverse probability of treatment weighting (IPTW) were applied to homogenize both groups. The impact of different treatment regimens on patient CSS and OS was analyzed using the Kaplan-Meier method. RESULTS: A total of 33 cases of non-muscular invasive SRCC and 210 cases of muscular invasive SRCC were included in this study. Multivariate analysis identified race, TNM stage, and surgical method as independent variables influencing both OS and CSS. In non-muscle invasive bladder SRCC patients, radical cystectomy showed no CSS benefit compared to transurethral resection of bladder tumors (P = 0.304). For muscle invasive SRCC, patients who underwent partial cystectomy had better OS and CSS compared to those who underwent radical cystectomy (P = 0.019, P = 0.024). However, after conducting a PSM analysis, the differences between the two surgical outcomes were not statistically significant (P = 0.504, P = 0.335). Lymphadenectomy, chemotherapy, and radiation did not show any benefit to the prognosis of patients. CONCLUSION: This study identified race, TNM stage, and surgical approach as significant independent predictors for SRCC outcomes. Simple radical cystectomy and partial cystectomy proved to be effective treatments for SRCC. The optimal treatment option still needs to be supported by a number of prospective research trials.


Assuntos
Carcinoma de Células em Anel de Sinete , Cistectomia , Programa de SEER , Neoplasias da Bexiga Urinária , Humanos , Neoplasias da Bexiga Urinária/terapia , Neoplasias da Bexiga Urinária/patologia , Neoplasias da Bexiga Urinária/mortalidade , Neoplasias da Bexiga Urinária/cirurgia , Feminino , Masculino , Carcinoma de Células em Anel de Sinete/patologia , Carcinoma de Células em Anel de Sinete/terapia , Carcinoma de Células em Anel de Sinete/mortalidade , Carcinoma de Células em Anel de Sinete/cirurgia , Estudos Retrospectivos , Pessoa de Meia-Idade , Idoso , Cistectomia/métodos , Prognóstico , Estadiamento de Neoplasias , Pontuação de Propensão , Estimativa de Kaplan-Meier , Adulto
3.
J Environ Manage ; 366: 121813, 2024 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-39018854

RESUMO

For many years, the Weihe River Basin (WRB) has struggled to achieve a balance between ecological protection and economic growth. Constructing an Ecological Security Pattern (ESP) is extremely important for ensuring ecological security (ES). This study employed a coupling of multi-objective programming (MOP) and the patch-generating land use simulation (PLUS) model to project land use change (LUCC) in 2040 across three scenarios. Leveraging circuit theory, we generated ecological corridors and identified key ecological nodes, enabling a comparative analysis of ESPs within the WRB. The main results showed that: (1) The Ecological Protection (EP) scenario showed the highest proportions of forestland, grassland, and water, indicating an optimal ecological environment. Conversely, the Economic Development (ED) scenario features the greatest proportion of construction land, particularly evident in the rapid urban expansion. The Natural Development (ND) scenario exhibits a more balanced change, aligning closely with historical trends. (2) The ecological source areas in the EP scenario is 13,856.70 km2, with the largest and most intact patch area. The ecological source patches that have been identified in the ED scenario exhibit fragmentation and dispersion, encompassing a total area of 8018.82 km2. The ecological source areas in the ND scenario is most similar to the actual situation in 2020, encompassing 8474.99 km2. (3) The EP scenario demonstrates minimal landscape fragmentation. The ED scenario presents a more intricate corridor pattern, hindering species and energy flow efficiency. The ND scenario is more similar to the actual distribution in 2020. Protecting and restoring key ecological nodes, and ensuring the integrity and connectivity of ecological sources are crucial for ESP optimization in various scenarios. Combining all results, we categorize the WRB's spatial pattern into "three zones, three belts, and one center" and offer strategic suggestions for ecological preservation, promoting sustainable local ecological and socioeconomic development.


Assuntos
Conservação dos Recursos Naturais , Ecologia , Rios , Ecossistema , Desenvolvimento Econômico , Florestas
4.
J Hazard Mater ; 477: 135174, 2024 Sep 15.
Artigo em Inglês | MEDLINE | ID: mdl-39059295

RESUMO

Comprehensive and effective water quality monitoring is vital to water environment management and prevention of water quality from degradation. Unmanned aerial vehicle (UAV) remote sensing techniques have gradually matured and prevailed in monitoring water quality of urban rivers, posing great opportunity for more effective and flexible quantitative estimation of water quality parameter (WQP) than satellite remote sensing techniques. However, current UAV remote sensing methods often entail large quantities of cost-prohibitive in-situ collected training samples with corresponding chemical analysis in different monitoring watersheds, laying time and fiscal pressure on local environmental protection department. They suffer relatively low calculation accuracy and stability and their applicability in various watersheds is constrained. This study developed a unified two-stage method, multidirectional pairwise coupling (MDPC) with information sharing and delivery of different modeling stages to efficiently predict concentrations of WQPs including total phosphorus (TP), total nitrogen (TN), and chlorophyll-a (Chl-a) from hyperspectral data. MDPC incorporates exterior and interior feature interaction and gravity model variant to improve prediction accuracy and stability with consideration of mutual effect in the proximity. The structure design and workflow of MDPC ensure high robustness and application prospect due to achievement of good performance with less training samples, improving applicability and feasibility. The experiments show that MDPC has achieved good performance on retrieval of WQPs concentrations including TP, TN, and Chl-a, the results mean absolute percent error (MAPE) and coefficient of determination (R2) ranging from 6.34 % to 11.94 % and from 0.74 to 0.93. This study provides a systematic and scientific reference to formulate a feasible and efficient water environment management scheme.

5.
Mycoses ; 67(7): e13770, 2024 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-39054731

RESUMO

BACKGROUND: Fungal skin diseases are the most common and widespread fungal infections, exerting a significant impact on patients' socio-psychological health and the quality of life. OBJECTIVES: To assess and compare the global burden of fungal skin diseases in 2019 and over the past 30 years. METHODS: Data were retrieved from the Global Burden of Disease Study 2019. Incidence and years lived with disability (YLDs) were used to assess the burden of fungal skin diseases. A total of 204 countries and territories were hierarchically organised into 21 regions and seven super-regions. Data were presented as absolute numbers and rates per 100,000 population, stratified by sex, age, year and location. RESULTS: In 2019, the global incidence rate and YLD rate of fungal skin diseases were 21,277 (95% UI 19 298-23,399) and 42 (95% UI 17-88) per 100,000 population, respectively. Sub-Saharan Africa bore the heaviest disease burden, especially children aged 5-9 years had a significantly higher incidence rate, YLD rate and YLDs to incidence ratio compared to other regions. Moreover, more than half of the incident cases among the elderly came from high-income regions and Southeast Asia, East Asia, and Oceania. Over the past 30 years, the number of incident cases and YLDs of fungal skin diseases has been continuously increasing worldwide, but the incidence rates and YLD rates have not shown significant changes. CONCLUSIONS: The global burden of fungal skin diseases has been continuously rising. Children in Sub-Saharan Africa are experiencing higher disease incidence and severity compared to other regions.


Assuntos
Dermatomicoses , Carga Global da Doença , Saúde Global , Humanos , Criança , Pré-Escolar , Adolescente , Masculino , Adulto , Feminino , Incidência , Dermatomicoses/epidemiologia , Dermatomicoses/microbiologia , Pessoa de Meia-Idade , Adulto Jovem , Idoso , Lactente , Saúde Global/estatística & dados numéricos , Recém-Nascido , Efeitos Psicossociais da Doença , Idoso de 80 Anos ou mais , Qualidade de Vida , África Subsaariana/epidemiologia
6.
Chem Sci ; 15(24): 9087-9095, 2024 Jun 19.
Artigo em Inglês | MEDLINE | ID: mdl-38903229

RESUMO

Synthesis of conjugated compounds with unusual shape-persistent structures remains a challenge. Herein, utilizing thermodynamically reversible intermolecular Friedel-Crafts alkylation, a dynamic covalent chemistry (DCC) reaction, we facilely synthesized a figure-eight shaped macrocycle FEM and cage molecules CATPA/CACz. X-ray crystallographic analysis confirmed the chemical geometries of tetracation FEM4+(PF6 -)4 and hexacation CACz6+(SbF6 -)6. FEM and CATPA displayed higher photoluminescence quantum yield in solid states compared to that in solution, whereas CACz gave the reverse result. DFT calculations showed that fluorescence-related frontier molecular orbital profiles are mainly localized on their arms consisting of a p-quinodimethane (p-QDM) unit and two benzene rings of triphenylamine or carbazole. Owing to their space-confined structures, variable-temperature 1H NMR measurements showed that FEM, CATPA and FEM4+ have intramolecular restricted motion of phenyl rings on their chromophore arms. Accordingly, FEM and CATPA with flexible triphenylamine subunits displayed aggregation-induced emission behavior (AIE), whereas CACz with a rigid carbazole subunits structure showed no AIE behavior.

7.
Front Chem ; 11: 1213507, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-38025053

RESUMO

Graphene and its derivatives have attracted much attention as nanomaterials in bone tissue engineering because of their remarkable ability to induce cell osteogenic differentiation. However, graphene quantum dots (GQDs), as graphene derivatives, little is known about their osteodifferentiation- and osteoinduction-promoting capabilities, especially in the restoration of bone defect caused by periodontitis. Therefore, there is a growing need to investigate the effect of GQDs on periodontal ligament stem cells (PDLSCs). Here, we postulated that GQDs are a promising biocompatible nanomaterial that facilitated the migration and differentiation of PDLSCs, and use laboratory methods like CCK-8, transwell experiments, qRT-PCR, Alizarin red staining and immunofluorescence staining to evaluate. Our experiments confirmed that GQDs did not inhibit cell viability, with most cells remaining viable even at GQDs concentrations of up to 30 µg mL-1. Moreover, GQDs were found to significantly enhance PDLSC migration, with the peak effect observed at concentrations of 5 and 10 µg mL-1. Furthermore, GQDs accelerated osteoblastic differentiation in PDLSCs and induced the mineralization of calcium nodules. Additionally, GQDs were shown to promote fibroblast differentiation in PDLSCs compared to the control group. Thus, GQDs not only possessed low cytotoxicity and good biocompatibility, but also displayed the beneficial capability to migration and differentiation of PDLSCs, which indicated GQDs might be a potential nanomaterial for bone regeneration.

8.
J Environ Manage ; 342: 118283, 2023 Sep 15.
Artigo em Inglês | MEDLINE | ID: mdl-37290307

RESUMO

Quantitative prediction by unmanned aerial vehicle (UAV) remote sensing on water quality parameters (WQPs) including phosphorus, nitrogen, chemical oxygen demand (COD), biochemical oxygen demand (BOD), and chlorophyll a (Chl-a), total suspended solids (TSS), and turbidity provides a flexible and effective approach to monitor the variation in water quality. In this study, a deep learning-based method integrating graph convolution network (GCN), gravity model variant, and dual feedback machine involving parametric probability analysis and spatial distribution pattern analysis, named Graph Convolution Network with Superposition of Multi-point Effect (SMPE-GCN) has been developed to calculate concentrations of WQPs through UAV hyperspectral reflectance data on large scale efficiently. With an end-to-end structure, our proposed method has been applied to assisting environmental protection department to trace potential pollution sources in real time. The proposed method is trained on a real-world dataset and its effectiveness is validated on an equal amount of testing dataset with respect to three evaluation metrics including root of mean squared error (RMSE), mean absolute percent error (MAPE), and coefficient of determination (R2). The experimental results demonstrate that our proposed model achieves better performance in comparison with state-of-the-art baseline models in terms of RMSE, MAPE, and R2. The proposed method is applicable for quantifying seven various WQPs and has achieved good performance for each WQP. The resulting MAPE ranges from 7.16% to 10.96% and R2 ranges from 0.80 to 0.94 for all WQPs. This approach brings a novel and systematic insight into real-time quantitative water quality monitoring of urban rivers, and provides a unified framework for in-situ data acquisition, feature engineering, data conversion, and data modeling for further research. It provides fundamental support to assist environmental managers to efficiently monitor water quality of urban rivers.


Assuntos
Rios , Qualidade da Água , Clorofila A , Análise da Demanda Biológica de Oxigênio , Tecnologia de Sensoriamento Remoto , Monitoramento Ambiental/métodos
9.
J Cancer Res Clin Oncol ; 149(13): 11013-11023, 2023 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-37335336

RESUMO

PURPOSE: Recent studies have revealed that primary tumor resection (PTR) surgery could improve prognosis in some solid tumors. Thus, we aimed to investigate whether patients with stage IVB cervical carcinoma can benefit from PTR surgery and who can benefit. METHODS: We extracted and obtained data on patients with stage IVB cervical carcinoma from the SEER database from 2010 to 2017 and classified them into two groups: the surgery and the non-surgery group. The overall survival (OS) and cancer-specific survival (CSS) of the two groups were compared before and after propensity score matching (PSM). The independent prognostic variables were identified using univariate and multivariate Cox regression analyses. Then, the model was established to select the optimal patients to receive PTR surgery using multivariate logistic regression. RESULTS: After PSM, the study included 476 cervical carcinoma (stage IVB) patients, of whom 238 underwent PTR surgery. Compared to the non-surgery group, the surgery group's median OS and median CSS were both longer (median OS: 27 months vs. 13 months, P < 0.001; median CSS: 52 months vs. 21 months, P < 0.001). The model showed no organ metastasis, adenocarcinoma, G1/2, and chemotherapy were more supportive of performing PTR surgery. The calibration curves and DCA showed that the model had high predictive accuracy and excellent clinical applicability. Finally, the "surgery benefit" group had the OS that was approximately four times better than "surgery non-benefit" group. CONCLUSION: PTR surgery can potentially improve the prognosis of patients with cervical carcinoma at stage IVB. The model could probably select optimal candidates and provide a new perspective on individualized treatment.


Assuntos
Adenocarcinoma , Humanos , Programa de SEER , Prognóstico
10.
Cancer Med ; 12(11): 12084-12094, 2023 06.
Artigo em Inglês | MEDLINE | ID: mdl-37062074

RESUMO

PURPOSE: To clarify the necessity and effect of a single intraoperative instillation of chemotherapy during radical cystectomy. METHODS: Patients who underwent radical cystectomy for bladder cancer between January 2013 and April 2019 were retrospectively evaluated and divided into a non-instillation group and an instillation group according to the intraoperative instillation of chemotherapy. Univariate and multivariate Cox regression was used to determine the clinical predictors of overall survival and disease-free survival. Kaplan-Meier analysis and log-rank tests were performed to analyze overall survival and disease-free survival. RESULTS: Of the 320 patients who were enrolled in the study, 113 underwent radical cystectomy with intraoperative instillation of chemotherapy. Univariate Cox analysis showed that intraoperative instillation was not a risk factor for overall survival or disease-free survival (HR: 1.04, 95% CI: 0.66-1.63, p = 0.864; HR: 1.11, 95% CI: 0.76-1.62, p = 0.602, respectively). As shown in the Kaplan-Meier analysis, no significant differences were noted in overall survival (p = 0.857) and disease-free survival (p = 0.600) between the two groups. A subgroup analysis demonstrated that intraoperative instillation was not associated with a statistically better overall survival and disease-free survival in the nonmuscle invasive (p = 0.852 and 0.836) and muscle-invasive (p = 0.929 and 0.805) patients. CONCLUSION: A single intraoperative instillation of chemotherapy during radical cystectomy was not related to better disease-free survival or overall survival. It is unnecessary to consider single instillation of chemotherapy as a regular procedure during radical cystectomy.


Assuntos
Neoplasias da Bexiga Urinária , Humanos , Estudos Retrospectivos , Resultado do Tratamento , Neoplasias da Bexiga Urinária/tratamento farmacológico , Neoplasias da Bexiga Urinária/cirurgia , Bexiga Urinária/cirurgia , Cistectomia/métodos
11.
Virulence ; 14(1): 2190645, 2023 12.
Artigo em Inglês | MEDLINE | ID: mdl-36914568

RESUMO

Sepsis is a leading cause of fatality in invasive candidiasis. The magnitude of the inflammatory response is a determinant of sepsis outcomes, and inflammatory cytokine imbalances are central to the pathophysiological processes. We previously demonstrated that a Candida albicans F1Fo-ATP synthase α subunit deletion mutant was nonlethal to mice. Here, the potential effects of the F1Fo-ATP synthase α subunit on host inflammatory responses and the mechanism were studied. Compared with wild-type strain, the F1Fo-ATP synthase α subunit deletion mutant failed to induce inflammatory responses in Galleria mellonella and murine systemic candidiasis models and significantly decreased the mRNA levels of the proinflammatory cytokines IL-1ß, IL-6 and increased those of the anti-inflammatory cytokine IL-4 in the kidney. During C. albicans-macrophage co-culture, the F1Fo-ATP synthase α subunit deletion mutant was trapped inside macrophages in yeast form, and its filamentation, a key factor in inducing inflammatory responses, was inhibited. In the macrophage-mimicking microenvironment, the F1Fo-ATP synthase α subunit deletion mutant blocked the cAMP/PKA pathway, the core filamentation-regulating pathway, because it failed to alkalinize environment by catabolizing amino acids, an important alternative carbon source inside macrophages. The mutant downregulated Put1 and Put2, two essential amino acid catabolic enzymes, possibly due to severely impaired oxidative phosphorylation. Our findings reveal that the C. albicans F1Fo-ATP synthase α subunit induces host inflammatory responses by controlling its own amino acid catabolism and it is significant to find drugs that inhibit F1Fo-ATP synthase α subunit activity to control the induction of host inflammatory responses.


Assuntos
Candida albicans , Citocinas , Camundongos , Animais , Candida albicans/genética , Candida albicans/metabolismo , Citocinas/genética , Citocinas/metabolismo , Trifosfato de Adenosina/metabolismo , Aminoácidos
12.
Plant Dis ; 2023 Feb 01.
Artigo em Inglês | MEDLINE | ID: mdl-36723962

RESUMO

Fusarium head blight (FHB), predominantly caused by Fusarium graminearum is one of the most economically important fungal diseases of small-grain cereals. Since the early 1990s, FHB has been a devastating wheat disease in parts of Canada and the United States, causing significant economic impacts on the cereal grain industry through reduced seed quality and yield, and grain contamination with fungal toxins (Brar et al. 2019). Spikes of wheat and barley with bleached spikelets and pinkish coloration were observed with low incidence and high severity in August 2021 field stripe rust nursery at UBC Totem Plant Science Farm in Vancouver, Canada (Supplementary File 1). FHB-like Symptomatic spikes were collected during the growing season. The Fusarium damaged kernels (FDK) were surface-sterilized with 1% sodium hypochlorite (NaOCl) for 1.5 min, rinsed three times in distilled water and dried using sterile filter paper discs in Biological Safety Cabinet. The kernels were placed on Petri dishes containing three layers of moist blotter papers and incubated in the dark at 22-25°C for 24 hours. The Petri dishes were transferred into a -20°C freezer for 24 hours, followed by five days of incubation at 22-25°C under fluorescent light, during which distilled water was added onto blotter papers every day to maintain moisture. After incubation, mycelium growing on kernels was transferred to potato dextrose agar (PDA) media and subcultured based on the colony and conidial morphology of F. graminearum (Leslie and Summerell 2006). The colonies selected grew white mycelia with a pink pigment at the bottom. Macroconidia with five to six septate were produced after seven days and microconidia were absent. Seven isolates derived from different wheat samples were derived from single conidia and identified based on amplicon sequencing using a MinION Flongle flow cell described by Boutigny et al. (2019). Reads which passed the integrated MinKNOW quality control step were mapped to the Partial translation elongation factor 1- α (EF1a) gene, using primers EF1-F2 (5'TCATC GGCCACGTCGACTCT3') and EF1-R3 (5'TACCAGCCTCGAACTCACCA3'). The consensus sequence for each sample was aligned to the reference sequence (JF740867.1) using BLASTn, revealing all the similarities of more than 99.5% (Supplementary File 2). The morphological characteristics (colony, pink pigment, shape of macroconidia, absence of microconidia) (Leslie and Summerell, 2006) and sequencing results indicated that the seven isolates from wheat were F. graminearum of the 3ADON chemotype. Besides, Koch's postulates were performed by spray-inoculating healthy inflorescences of eight wheat plants derived from the cross Avocet/CDC Silex at half anthesis stage (one isolate per plant and one non-inoculated control). Each spike was thoroughly sprayed with 1ml of spore suspension containing 5 × 104 conidia per ml (4-5 spikes per plant). The spikes on one plant were treated with distilled water (1 ml per spike) as a blank control. The inoculated spikes were covered with moist plastic bags for 48 hours, and the plants were placed in a growth chamber under a 12-h photoperiod at 18°C. Seven days later, spikes of the spores-treated plants exhibited bleached spikelets, which is a typical symptom of FHB, and there was no disease on the control plant. F. graminearum was re-isolated from FDK of diseased spikes using the isolation methodology and identified by morphology described above. To our knowledge and based on a literature review, this is the first report of F. graminearum causing FHB on wheat and barley in the Lower Mainland of British Columbia. The reason for the concealment of F. graminearum in BC might be the small acreage of commercially grown small-grain cereals. Further, there is limited cultivation of winter wheat and barley in the region for forage/silage, but the crops are harvested at the soft dough stage leaving limited grain/spike residue for the next crop. While presently there is very low acreage of cereal host crops of F. gramineraum in Lower Mainland, this acreage might increase in future years as winter cereals are slowly expanding in the region as cover crops, forages, and even grain production for sale to forgae producers or for local breweries in case of barley; therefore, finding of F. gramineraum could have economic consequences on cereal production in the region in future. Further investigation is needed to better understand the aggressiveness of the strains and their population structure of the pathogen in the Region.

13.
Orthod Craniofac Res ; 26(1): 91-99, 2023 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-35491965

RESUMO

OBJECTIVE: The purpose of this study was to investigate associations between alveolar bone height changes on the labial and lingual sides in mandibular incisors and three-dimensional orthodontic tooth movement, involving apex displacement, tooth inclination, and angulation. MATERIALS AND METHODS: The samples consisted of 43 adult patients treated with Invisalign aligners. All subjects were skeletal Class I patients without extraction in mandible. Pre-treatment and post-treatment cone-beam computed tomographic images were obtained to measure labial and lingual alveolar bone height and bone thickness at apex level in four mandibular incisors. An x, y, z coordinate system, superimposing on mandibular body, was established to analyse three-dimensional apex movement and tooth inclination and angulation changes. Multiple linear regression was applied to identify the determining factors of marginal bone changes during orthodontic treatment. RESULTS: Three directions of apex movement (anteroposterior, vertical, transverse) significantly associated with alveolar bone height changes. Inclination changes had a strong effect on lingual marginal bone, while tooth angulation had no significant effect on alveolar bone height. Incisors with lingual bodily movement were more susceptible to lingual marginal bone recession compared with lingual tipping movement. CONCLUSIONS: Alveolar bone height changes on the labial and lingual sides were associated with three-dimensional apex movement, inclination changes, and movement patterns. Appropriate tooth movement should be considered to avoid excessive marginal bone loss around mandibular incisors.


Assuntos
Incisivo , Aparelhos Ortodônticos Removíveis , Adulto , Humanos , Incisivo/diagnóstico por imagem , Técnicas de Movimentação Dentária/métodos , Mandíbula/diagnóstico por imagem , Cabeça , Tomografia Computadorizada de Feixe Cônico/métodos
14.
Aust Endod J ; 49(2): 332-343, 2023 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-35877114

RESUMO

The study aims to investigate and compare the success rate of concentrated growth factor (CGF) and blood clot (BC) as scaffolds in regenerative endodontic procedures (REPs). Immature permanent necrotic teeth treated by REPs with at least a 6-month follow-up were included. These teeth were divided into the CGF (53 teeth) and BC (68 teeth) groups. Treatment outcomes were assessed using a combined clinical and radiographic scoring system. The total success rate was 91.74% over a mean follow-up period of 23.15 months. There was no significant difference between the CGF group (86.79%) and BC group (95.59%). The success rate of traumatic teeth (84.31%) was significantly lower than that of teeth with developmental dental anomalies (98.39%) (p < 0.05). CGF may be a suitable alternative scaffold in REPs when adequate bleeding cannot be achieved. Moreover, compared to developmental dental anomalies, traumatic teeth treated by REPs may be more vulnerable to failure.


Assuntos
Endodontia Regenerativa , Trombose , Humanos , Necrose da Polpa Dentária/terapia , Estudos Retrospectivos , Peptídeos e Proteínas de Sinalização Intercelular
15.
Artigo em Inglês | MEDLINE | ID: mdl-36293864

RESUMO

Epidemics represent a threat to human life and economy. Meanwhile, medical and non-medical approaches to fight against them may result in additional economic shocks. In this paper, we examine the economic impact of the 2003 SARS outbreak in China and associated government policies. Although the epidemic caused a substantial economic loss in the short term, the interventions for medical purposes positively impacted the economy of the severely affected regions through the increase in investments such as other fiscal stimuli. There is strong and robust evidence suggesting that the SARS epidemic and its associated countermeasure policies boosted local output by around 4% and industrial production by around 5%. The positive growth was mainly derived from the increase in investment and government activity, especially government expenditure. Besides that, lagged impacts were particularly pronounced to the economic system and lasted for longer even than the epidemic period in a biological sense. We attribute this to the relatively aggressive stance of policymakers in the face of the epidemic situation.


Assuntos
Epidemias , Síndrome Respiratória Aguda Grave , Humanos , Síndrome Respiratória Aguda Grave/epidemiologia , Surtos de Doenças , China/epidemiologia , Governo , Desenvolvimento Econômico
16.
Curr Oncol ; 29(10): 6834-6846, 2022 09 23.
Artigo em Inglês | MEDLINE | ID: mdl-36290816

RESUMO

(1) Purpose: The purpose of this study was to evaluate the prognostic capacity of the pathological N status (pN), lymph node ratio (LNR), and the log odds of positive lymph nodes (LODDS), and to build a prognostic nomogram to predict overall survival (OS) for bladder cancer patients treated by radical cystectomy. (2) Methods: The clinical and pathological characteristics of 10,938 patients with bladder cancer were identified from the Surveillance, Epidemiology, and End Results (SEER) database from 2004 to 2017. The predictive capacity was assessed by univariate and multivariate Cox regression analyses, the area under the receiver operating characteristic curve (AUC), and C-index. Calibration curves, decision curve analysis (DCA), and risk-grouping were utilized to evaluate the predictive accuracy and discriminative ability of the nomogram. (3) Results: LODDS was an independent risk factor for bladder cancer (all p < 0.001) and demonstrated the highest values of C-index and AUC. The values of AUCs in the training cohort were 0.747, 0.743, and 0.735 for predicting 1-, 3-, and 5-year OS, respectively. Calibration curves and DCA curves suggested the excellent clinical application value of our nomogram. (4) Conclusions: LODDS is a better predictive indicator for bladder cancer patients compared to pN and LNR. The LODDS-incorporated nomogram has excellent accuracy and promising clinical application value for non-metastatic bladder cancer after radical cystectomy.


Assuntos
Nomogramas , Neoplasias da Bexiga Urinária , Humanos , Prognóstico , Metástase Linfática/patologia , Estadiamento de Neoplasias , Linfonodos/cirurgia , Linfonodos/patologia , Cistectomia , Neoplasias da Bexiga Urinária/cirurgia
17.
Int Urol Nephrol ; 54(7): 1537-1543, 2022 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-35552976

RESUMO

PURPOSE: To evaluate urinary outcomes of pelvic construction and lateral capsule sparing techniques in robot-assisted radical cystectomy with orthotopic ileal neobladder (RARC-OIN). METHODS: A total of 107 male patients who underwent RARC-OIN during January 2017 and February 2021 in Sun Yat-sen Memorial Hospital were analyzed retrospectively. Standard RARC-OIN with or without nerve sparing technique was performed in 44 patients (standard group), lateral prostate capsule sparing technique was performed in 20 patients (LCS group), combined pelvic reconstruction (CPR) technique including anterior suspension and posterior reconstruction were performed in 43 patients (CPR group). The urinary function was assessed by the use of pads and the Bladder Cancer Index (BCI). Continence was defined as the use of 0-1 pad during daytime or night-time. RESULTS: There was no statistical difference between the three groups regarding demographic, perioperative, and pathological data. Continence rates were 6.8, 50.0 and 34.9% for daytime, 4.6, 40.0 and 32.6% for night-time in the standard group, LCS group and CPR group at 1 month post-operation, respectively. Continence rates were 34.1, 80.0 and 69.8% for daytime, 27.3, 75.0 and 65.1% for night-time in the standard group, LCS group and CPR group at 3 month post-operation, respectively. No statistically significant difference was observed in the daytime and night-time continence rates at 12 months. CONCLUSIONS: Lateral capsule-sparing and combined pelvic reconstruction techniques are feasible to improve early daytime and night-time continence rates in RARC with orthotopic neobladder. CLINICAL TRIAL REGISTRATION: The trial registration number: ChiCTR2100047606.


Assuntos
Robótica , Neoplasias da Bexiga Urinária , Derivação Urinária , Cistectomia/efeitos adversos , Cistectomia/métodos , Humanos , Masculino , Próstata/patologia , Estudos Retrospectivos , Resultado do Tratamento , Neoplasias da Bexiga Urinária/patologia , Neoplasias da Bexiga Urinária/cirurgia , Derivação Urinária/métodos
18.
Cancer Med ; 11(12): 2356-2365, 2022 06.
Artigo em Inglês | MEDLINE | ID: mdl-35301806

RESUMO

OBJECTIVE: Conventional survival analysis plays a limited role in patients who have survived a period after initial treatment. The present study analyzed how conditional survival (CS) predicted survival rate over time for nonmetastatic muscle-invasive bladder cancer (MIBC) patients after trimodal treatment. METHOD: This retrospective study from the SEER database included consecutive patients with nonmetastatic MIBC who received trimodal therapy (TMT) between January 2010 and December 2017. Kaplan-Meier analysis was used to estimate overall survival (OS) and cancer-specific survival (CSS). CS was defined as the rate of surviving y years after already surviving for x years. Multivariate Cox regression analysis was used to identify prognostic factors. RESULT: A total of 1110 nonmetastatic MIBC patients treated with TMT were included. Given a 1-, 2-, 3-, and 4-year after TMT, the rate of surviving to 5-year, respectively, improved by +5.0 (20.0%), +17.0 (32.0%), +30.0 (45.0%), and +52.8 (67.8%) from those calculated at baseline (15.0%). The 2-year CS rate of patients who had survived 1-, 2-, or 3-year after TMT improved, respectively, compared to 3-, 4-, or 5-year actual survival. Multivariate Cox regression analysis demonstrated that adverse variables (T stage, age) of OS and CSS lost their prognostic significance over time. DISCUSSION AND CONCLUSION: Conditional survival rate of surviving to 5-year after TMT kept a relatively stable level over time. In addition, those adverse variables were not always the prognostic factors over time. Only age was always the significant prognostic factor for conditional OS from baseline to 5-year survival. Our results provided real-time survival information and prognosis estimates to adjust follow-up plans for nonmetastatic MIBC patients after TMT.


Assuntos
Neoplasias da Bexiga Urinária , Cistectomia , Humanos , Músculos/patologia , Invasividade Neoplásica , Prognóstico , Estudos Retrospectivos , Taxa de Sobrevida , Neoplasias da Bexiga Urinária/patologia
19.
Front Oncol ; 12: 814512, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-35127544

RESUMO

BACKGROUND: Currently, the progress of targeted drugs in the treatment of metastatic clear cell renal cell carcinoma (mccRCC) is limited. Cytoreductive nephrectomy (CN), as an alternative treatment, can improve the prognosis of patients with metastatic renal cell carcinoma to some extent. However, it is unclear which patients would benefit from this tumor reduction operation. As a consequence, we developed a predictive model to identify patients who may well benefit from CN in terms of survival. METHODS: We identified patients with metastatic clear cell renal cell carcinoma retrospectively from the Surveillance, Epidemiology, and End Results (SEER) database (2010-2015) and classified them into surgery and non-surgery groups. Propensity score matching (PSM) was performed to balance the baseline characteristics. Patients who survived longer than the median overall survival (OS) of no-surgery group were defined as surgical-benefit patients. Then, we developed a predictive model based on preoperative characteristics using multivariable Logistic regression. Calibration curves and the area under the receiver operating characteristic (AUC) were used to evaluate the efficiency of the predictive model. The clinical value of the nomogram was assessed utilizing decision curve analysis (DCA). RESULTS: Our study collected 5544 patients from the SEER database, with 2352(42.4%) receiving cytoreductive surgery. Overall survival (OS) was longer in the CN group than in the non-surgery group after 1:1 propensity scoring matching (median OS: 19 months vs 7 months; hazard ratio (HR) =0.4106, P< 0.001). In the matched surgery group, 65.7% (367) patients survived more than 7 months after the operation and they were considered to benefit from CN. The predictive model performed well on both the training group (AUC=73.4%) and the validation group (AUC=71.9%) and the calibration curves indicated a high degree of consistency. The decision curve analysis curve demonstrated the clinical utility. We classified surgical patients into the beneficial group and non-beneficial group by using the predictive model, then discovered a substantial difference in OS between the two groups. CONCLUSIONS: We developed a nomogram to select ideal mccRCC patients who might benefit from cytoreductive nephrectomy. Clinicians could make a more precise treatment strategy for mccRCC patients.

20.
Mol Plant Microbe Interact ; 35(3): 244-256, 2022 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-34813706

RESUMO

Most plant fungal pathogens that cause worldwide crop losses are understudied, due to various technical challenges. With the increasing availability of sequenced whole genomes of these non-model fungi, effective genetic analysis methods are highly desirable. Here, we describe a newly developed pipeline, which combines forward genetic screening with high-throughput next-generation sequencing to enable quick gene discovery. We applied this pipeline in the notorious soilborne phytopathogen Sclerotinia sclerotiorum and identified 32 mutants with various developmental and growth deficiencies. Detailed molecular studies of three melanization-deficient mutants provide a proof of concept for the effectiveness of our method. A master transcription factor was found to regulate melanization of sclerotia through the DHN (1,8-dihydroxynaphthalene) melanin biosynthesis pathway. In addition, these mutants revealed that sclerotial melanization is important for sclerotia survival under abiotic stresses, sclerotial surface structure, and sexual reproduction. Foreseeably, this pipeline can be applied to facilitate efficient in-depth studies of other non-model fungal species in the future.[Formula: see text] Copyright © 2022 The Author(s). This is an open access article distributed under the CC BY 4.0 International license.


Assuntos
Ascomicetos , Basidiomycota , Ascomicetos/fisiologia , Basidiomycota/genética , Regulação da Expressão Gênica , Testes Genéticos
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA