RESUMO

Resumen: La tendinopatía cálcica es causada por el depósito patológico de cristales de hidroxiapatita de calcio en los tendones y es una causa común de dolor en las articulaciones. Afecta más frecuentemente al hombro y la cadera, con hallazgos característicos en imágenes; sin embargo, cualquier tendón puede estar involucrado. Ocasionalmente, la tendinopatía cálcica puede simular patología agresiva, como infección o neoplasia, especialmente en RM. Fisiotpatológicamente, las calcificaciones provendrían de una diferenciación anormal de las células madre del tendón, que comienzan a producir calcio, aunque todavía no es del todo claro. Los radiólogos deben estar familiarizados con los hallazgos de las imágenes para distinguir la tendinopatía cálcica de procesos más agresivos. La aspiración y lavado guiado bajo ecografía es una técnica útil realizada por el radiólogo para el tratamiento de casos sintomáticos. La familiaridad con estos procedimientos y su apariencia en imágenes es un aspecto importante en el manejo de esta enfermedad. El propósito de esta revisión es analizar la etiopatogenia de la tendinopatía cálcica, la evaluación con imágenes en los sitios de presentación más comunes y también en los menos frecuentes, así como el papel que desempeña la ecografía en el tratamiento de la patología.

Abstract: Calcific tendinitis is caused by abnormal deposition of calcium hydroxyapatite crystals in tendons and is a common cause of joint pain. The disease typically affects the shoulder and hip, with characteristic imaging findings; however, any tendon can be involved. Occasionally, calcific tendinitis can mimic aggressive disorders, such as infection and neoplasm, especially on MRI. Apparently, the calcifications come from an abnormal differentiation of the tendon stem cells, which begin to produce calcium. Radiologists should be familiar with the imaging findings to distinguish calcific tendinitis from more aggressive processes. Image-guided percutaneous needle aspiration is a useful technique performed by the radiologist for the treatment of symptomatic cases. Being familiar with these processes and their imaging appearance is an important aspect in the management of this common disease. The purpose of this review is to analyze the pathogenesis of calcium tendinopathy, the evaluation of images in both the most common and less frequent presentation sites, as well as the role played by ultrasound in the treatment of pathology.

Assuntos

RESUMO

In this work, we present a thorough study of the thermoelectric properties of silicene nanoribbons in the presence of a random distribution of atomic vacancies. By using a linear approach within the Landauer formalism, we calculate phonon and electron thermal conductances, the electric conductance, the Seebeck coefficient and the figure of merit of the nanoribbons. We found a sizable reduction of the phonon thermal conductance as a function of the vacancy concentration over a wide range of temperature. At the same time, the electric properties are not severely deteriorated, leading to an overall remarkable thermoelectric efficiency. We conclude that the incorporation of vacancies paves the way for designing better and more efficient nanoscale thermoelectric devices.

RESUMO

We isolated and compared three tomato spotted wilt virus (TSWV) isolates from lettuce (TSWV-Let), pepper (TSWV-Pep), and tomato (TSWV-Tom) from central Mexico to determine their ability to infect a set of eighteen differential plant species from seven families. TWSV-Let was an aggressive isolate with the ability to infect up to 52% of the differential plants, including maize, under greenhouse conditions. The nucleotide (nt) sequences of the three isolates are more than 90% similar in the M and S RNA segments. In the M segment of the TSWV-Let isolate, we detected nt changes in their intergenic region (IGR) and, in the Gc gene, a region containing a recombination site, as well as a synapomorphy associated with one of three sites under positive selection with a change in one aa residue (a cysteine-to-valine mutation). We speculate on the association of these features in the Gc gene with host selection, adaptation, aggressiveness, and ability to infect maize plants.

Assuntos

RESUMO

We explore proximity-induced ferromagnetism on transition metal dichalcogenides (TMDs), focusing on molybdenum ditelluride ribbons with zigzag edges, deposited on ferromagnetic europium oxide (EuO). A tight-binding model incorporates exchange and Rashba fields induced by proximity to EuO or similar substrates. For in-gap Fermi levels, electronic modes in the nanoribbon are localized along the edges, acting as one-dimensional (1D) conducting channels with tunable spin-polarized currents. TMDs on magnetic substrates can become very useful in spintronics, providing versatile platforms to study the proximity effects and electronic interactions in complex 1D systems.

RESUMO

In recent years, the enhancement of thermoelectric efficiencies has been accomplished in nanoscale systems by making use of quantum effects. We exploit the presence of quantum interference phenomena such as bound states in the continuum and Fano antiresonances in trilayer silicene flakes to produce sharp changes in the electronic transmission of the system. By applying symmetric gate voltages the thermoelectric properties can be tuned and, for particular flake lengths, a great enhancement of the figure of merit can be achieved. We show that the most favorable configurations are those in which the electronic transmission is dominated by the coupling of bound states to the continuum, tuned by an external gate.

RESUMO

En el año 2013, la Organización Panamericana de la Salud (OPS), Oficina Regional de la Organización Mundial de la Salud (OMS) en las Américas, orientó su enfoque relacionado con los Recursos Humanos para la Salud en un esfuerzo para lograr el Acceso Universal a la Salud y la Cobertura Universal de Salud, que en conjunto se identifican como Salud universal. Los Estados miembros de la OPS/OMS aprobaron la Resolución CD52.R13 « Recursos Humanos para la Salud: Aumentar el Acceso al Personal Sanitario Capacitado en Sistemas de Salud Basados en la Atención Primaria de Salud ¼ con el objeto de fortalecer los sistemas de salud de estos países. En esta resolución se insta a que "los Estados Miembros faculten y brinden apoyo a los equipos colaborativos multiprofesionales de atención primaria de salud sobre la base de modelos establecidos de atención, mejoren el alcance de la práctica de cada profesión hasta su máximo potencial según sus competencias". También, se insta que "estimulen reformas en la educación de las profesiones de atención de salud para apoyar los sistemas de salud basados en la atención primaria de salud y aumentar el número de plazas en las profesiones de atención de salud pertinentes para la atención primaria de salud, incluidos los médicos de familia, las enfermeras de práctica avanzada y los especialistas clínicos que no son médicos, de acuerdo con las prioridades y las políticas públicas en la atención primaria de salud".

Assuntos

RESUMO

El objetivo de este artículo es dar a conocer los resultados de un estudio analítico1 acerca del manejo del paciente con disfagia por parte de técnicos paramédicos en el Hospital San Juan de Dios de Santiago, Chile, y del desarrollo de competencias tras la aplicación de un programa de capacitación. En primera instancia, se aplicó una encuesta validada por tres fonoaudiólogas para determinar el nivel de conocimiento e idoneidad de 145 funcionarios de la Unidad de Paciente Crítico, Cirugía y Medicina, la que evidenció que un 61 por ciento de los encuestados poseía un manejo “no deseable” del paciente y un 39 por ciento de ellos un manejo “regular”. Posteriormente se les impartió un programa de capacitación teórico-práctico con una duración de 21 horas pedagógicas dictadas por el equipo interdisciplinario (médico, enfermero, fonoaudiólogo, kinesiólogo, terapeuta ocupacional y nutricionista) durante tres jornadas. Al término de estas, se les aplicó nuevamente la encuesta, con el fin de comparar los datos con la información inicial. Tras la intervención, el 57 por ciento logró un nivel “deseable”, 41 por ciento un nivel “regular” y solo un 2 por ciento un nivel “no deseable”. Como conclusión, la formación técnica de los paramédicos no les brinda las herramientas suficientes para el manejo de los pacientes con disfagia, por lo que es labor de la institución de salud capacitarlos continuamente para evitar riesgos en los usuarios.

The aim of this article is to present the results of an analytical study in the management of patients with dysphagia by paramedics at San Juan de Dios Hospital in Santiago, Chile, and the development of skills after the implementation of a training program. First of all, a survey validated by three speech therapists was applied to determine the level of knowledge and suitability of 145 paramedics of the Critical Patient Unit, Surgery and Medicine. This survey found that 61 percent had a “non-desirable” management in patients, and 39 percent a “middle” level. Secondly, they participated in a 3-days theoretical and practical program, which lasted 21 hours. The classes were taught by an interdisciplinary team that attend the pathology (Doctor, Nurse, Speech Therapist, Physiotherapist, Occupational Therapist and Nutritionist), where at the end they were re-applied the survey to determine the new data by statistical analysis. After the intervention, 57 percent achieved a “desirable” level, 41 percent a “middle” level, while only 2 percent a “non-desirable” level. In conclusion, the technical training of paramedics does not provide them with the necessary tools for the management of patients with dysphagia; therefore, it is the health institution’s work to train them in order to avoid risks in patients.

Assuntos

RESUMO

Over 5% of the world's population has varying degrees of hearing loss. Mutations in GJB2 are the most common cause of autosomal recessive non-syndromic hearing loss (ARNHL) in many populations. The frequency and type of mutations are influenced by ethnicity. Guatemala is a multi-ethnic country with four major populations: Maya, Ladino, Xinca, and Garifuna. To determine the mutation profile of GJB2 in a ARNHL population from Guatemala, we sequenced both exons of GJB2 in 133 unrelated families. A total of six pathogenic variants were detected. The most frequent pathogenic variant is c.131G>A (p.Trp44*) detected in 21 of 266 alleles. We show that c.131G>A is associated with a conserved haplotype in Guatemala suggesting a single founder. The majority of Mayan population lives in the west region of the country from where all c.131G>A carriers originated. Further analysis of genome-wide variation of individuals carrying the c.131G>A mutation compared with those of Native American, European, and African populations shows a close match with the Mayan population.

RESUMO

Mexico contributes 20% of the total worldwide pepper exports (1). Impatiens necrotic spot virus (INSV) (genus Tospovirus; family Bunyaviridae) has emerged and has possibly caused diseases in various crops and ornamentals in Mexico. INSV was treated as a quarantine virus in Mexico (2) but not anymore. During the growing seasons of 2009 to 2011, surveys were conducted in the counties of Guanajuato and Querétaro in the states of the same names. Sampling included tomatillo (Physalis ixocarpa) and pepper (Capsicum spp.) plantations where plants with possible viral symptoms were observed. The symptoms observed were dark necrotic spots on some leaves and on the stems. These were similar to those observed elsewhere (3). Leaf spots further developed into localized necrotic areas. Using ELISA (Agdia, Elkhart, IN) with polyclonal antibodies, all collected samples showing symptoms tested positive for INSV and negative for Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV), Potato X virus (PVX), Potato Y virus (PVY), Tobacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV), Tobacco ringspot virus (TRSV), and Tomato ringspot virus (ToRSV). In order to identify the causal agent of these symptoms, INSV-specific sequences available for the S genomic fragments were obtained from NCBI GenBank. They were aligned and used to design primers to amplify a 250-bp fragment from total extracted RNA from healthy and symptomatic plants using reverse transcription (RT)-PCR. Primers used were INSVF (5'CCCAACTGCCTCTTTAGTGC3') and INSVR (5'GGACAATGGATCTGCTCTGA3'). Three extracted plasmids, each containing an amplified and cloned fragment for the pepper and tomatillo isolates, were sequenced (GenBank Accession Nos. KC503051 and KC503052, respectively). Both nucleotide sequences showed 95% identity with the Chinese, Italian, and Japanese INSV sequences (FN400773, DQ425096, and AB207803, respectively) and 94% identity to other INSV isolates (4). The putative Mexican INSV pepper isolate, derived from a necrotic spot, was mechanically inoculated to other experimental host plants after grinding 1 g of symptomatic leaf tissue in 3 ml of a buffer with quaternary ammonium salts at 0.5%, pH 7.8. Ten plants, at the second true-leaf stage, of each Capsicum annuum cv. cannon and Citrullus lanatus were inoculated after carborundum abrasion of the second true leaf. At 15 days post inoculation, systemic chlorotic necrotic spots, stunting, and apical malformation were observed in capsicum plants while wilting was shown in watermelon plants. RT-PCR analyses and nucleotide sequence of the amplified product confirmed the presence and identity of both virus isolates. To our knowledge, this is the first report of INSV in Mexico found naturally in tomatillo and pepper and experimentally in watermelon plants. Derived from this report, INSV distribution in Mexico should be studied due to its potential impact on these two economically important crops. References: (1) Food and Agriculture Organization of the United Nations. FAOSTAT, retrieved online at http://faostat.fao.org , 2013. (2) DGSV-CNRF. Impatiens necrotic spot virus (INSV). SAGARPA-SENASICA. México, 2011. (3) M. Ding et al. Plant Dis. 95:357, 2011. (4) I. Mavric et al. Plant Dis. 85:12, 2001.

RESUMO

For phytosanitary purposes, the prevalence and incidence of viruses found in strawberry production within a centralized breeding program was investigated in Abasolo and Irapuato Counties, Guanajuato State, Mexico. Single and mixed infections of Strawberry mottle virus (SMoV) and Strawberry crinkle virus (SCV) were originally reported in the area (3), and subsequently, Strawberry latent ringspot virus (SLRSV) was also found (4). Samples of strawberry plants showing viral symptoms: stunting, mild chlorosis and reddening, occasional wrinkled, curled, and deformed leaves that may exhibit mottling, and chlorotic spots, forming a putative virus complex were collected in April and December 2007 and July and December 2008. The detection and identification of viruses reported in the United States, the country of origin of most of the imported plantlets, was carried out with sets of primers for 11 viruses, through reverse transcription (RT)-PCR (developed by Robert Martin and Ioannis Tzanetakis in Corvallis, OR). The endogenous NADH 2 subunit was employed to test the quality of the RNA extracted. Amplification conditions were: 40 cycles of 1 min at each temperature, denaturation at 95°C, annealing at 50°C for Strawberry necrotic shock virus (SNSV); 52°C for Strawberry mild yellow edge virus (SMYEV); 55°C for Fragaria chiloensis latent virus (FClLV), Strawberry pallidosis associated virus (SPaV), Fragaria chiloensis cryptic virus (FClCV), and SMoV; and 58°C for SCV and NADH dehydrogenase, followed by a final extension at 72°C of 5 min after completion of the 40 cycles. The cloning and nucleotide sequencing of amplified fragments revealed the presence of seven viral species in 40 samples collected. These were FClLV, SCV, SMoV, SNSV, SPaV, and SMYEV, which were allocated GenBank accession numbers of JQ629412, JQ629413, JQ629414, JQ629415, JQ629416, and JQ629417, respectively. Strawberry UC-4 and UC-10 (1,2) were planted as indicators of viral infections on an experimental plot. All seven viruses were detected in single or mixed infections. SMoV was the most commonly found in combination with other viruses. Out of 40 samples, 35 were positive for the presence of viruses and six had single infections, of which five had SMoV and one had SPaV. The remaining 29 samples had mixed infections with two or more viruses in a total of 22 combinations. The combination of FCICV + SMoV was present in five samples, whereas the combination of SMoV + SMYEV was in two samples. All other samples had two and up to six different viruses per plant. SMoV was detected in 26 out of the 40 samples tested. SNSV and FClCV were detected in 14 samples. SMYEV was present in 13 samples. SCV was present in nine samples, whereas SPaV and FClLV were found in eight samples each. To the best of our knowledge, this is the first report of FClLV, FClCV, SNSV, SMYEV, and SPaV in Mexico. References: (1) N. W. Frazier. Plant Dis. Rep. 58:28, 1974. (2) N. W. Frazier. Plant Dis. Rep. 58:203, 1974. (3) D. Teliz-Ortiz and A. Trejo-Reyes. Rev. Mex. Fitopatol. 7:38, 1989. (4) L. Pérez-Moreno et al. Rev. Mex. Fitopatol. 22:187, 2004.

RESUMO

OBJECTIVE: Genetical characterization of human Cryptosporidium isolates to determine species diversity. PATIENTS AND METHODS: A cross-sectional study in Valparaiso, Chile, was performed. A total of 458 patients participated in the study: 259 immunodeficient (HIV, cancer, renal transplant hyper-IgM syndrome, HIV and unintended pregnancy) and 178 immunocompetent individuals provided stool samples and 21 patients bile samples. RESULTS: We obtained 29 (6.3%) positive samples. 25 (9.7%) derived from immunodeficient patients: 18 (7.3%) from HIV patients and 7 from patients with other immunodeficiencies. The remaining 4 (2.2%) samples originated from immunocompetent individuals. Cryptosporidium genotyping was performed by nested polymerase chain reaction (PCR) and restriction fragments length polymorphism and/or PCR followed by sequencing of the SSU rRNA from oocysts in stool samples. 4 species were identified: C. parvum, C. hominis, C. muris, and C. meleagridis. In immunodeficient patients, 16 C. parvum, 8 C. hominis, and 1 C. muris strain were identified. In immunocompetent participants, 3 C. hominis and 1 C. meleagridis isolate were found. CONCLUSION: The results indicate that zoonotic and anthroponotic transmission occurs and that C. parvum is the predominant species in our study population. Cryptosporidium species of zoonotic transmission accounted for 62% of the human infections detected in this study.

Assuntos

RESUMO

Objective: Genetical characterization of human Cryptosporidium isolates to determine species diversity. Patients and Methods: A cross-sectional study in Valparaiso, Chile, was performed. A total of 458 patients participated in the study: 259 immunodeficient (HIV, cancer, renal transplant hyper-IgM syndrome, HIV and unintended pregnancy) and 178 immunocompetent individuals provided stool samples and 21 patients bile samples. Results: We obtained 29 (6.3%) positive samples. 25 (9.7%) derived from immunodeficient patients: 18 (7.3%) from HIV patients and 7 from patients with other immunodeficiencies. The remaining 4 (2.2%) samples originated from immunocompetent individuals. Cryptosporidium genotyping was performed by nested polymerase chain reaction (PCR) and restriction fragments length polymorphism and/or PCR followed by sequencing of the SSU rRNA from oocysts in stool samples. 4 species were identified: C. parvum, C. hominis, C. muris, and C. meleagridis. In immunodeficient patients, 16 C. parvum, 8 C. hominis, and 1 C. muris strain were identified. In immunocompetent participants, 3 C. hominis and 1 C. meleagridis isolate were found. Conclusion: The results indicate that zoonotic and anthroponotic transmission occurs and that C. parvum is the predominant species in our study population. Cryptosporidium species of zoonotic transmission accounted for 62% of the human infections detected in this study.

Objetivo: Caracterizar genéticamente Cryptosporidium spp para determinar la diversidad de especies en seres humanos. Pacientes y Métodos: estudio transversal realizado en Valparaíso, Chile, Un total de 458 pacientes participaron del estudio; 259 inmunodeficientes (pacientes con infección por VIH, oncológicos, con trasplante renal, síndrome de hiper IgM y una mujer embarazada sin infección por VIH) y 178 inmunocompetentes proporcionaron muestras fecales y 21 muestras de bilis. Resultados: Se obtuvieron 29 (6,3%) muestras positivas; 25 (9,7%) de inmunodeficientes: 18 (7,3%) de pacientes con infección por VIH y 7 con otras inmunodeficiencias; los restantes 4 (2,2%) fueron de personas inmunocompetentes. La genotipificación de Cryptosporidium se efectuó mediante reacción de polimerasa en cadena (RPC) anidada y el polimorfismo de la longitud de los fragmentos de restricción y/o RPC - secuenciación de la SSU ARNr, a partir de ooquistes en la muestra fecal. Se identificaron 4 especies: C. parvum, C. hominis, C. muris y C. meleagridis. En pacientes inmunodeficientes, se caracterizaron 16 C. parvum, 8 C. hominis y un C. muris; en inmunocompetentes: 3 C. hominis y un C. meleagridis. Conclusión: Los resultados indican que se produce transmisión zoonótica y antroponótica y que C. parvum es la especie predominante en este estudio. Las especies de Cryptosporidium de transmisión zoonótica representan el 62% en los seres humanos participantes de este estudio.

Assuntos

RESUMO

Ultrasound is a useful diagnostic modality to study many structures such as subcutaneous tissue, tendons, muscles, joints, and nerves. It has low cost, wide availability and high resolution. These advantages make ultrasound a good modality in interventional procedures like soft tissue tumors biopsy, aspiration of cysts and other collections, and also in treating symptomatic calcifications like deposition of hidroxiapatite crystals in the rotator cuff, among other indications. Our objetive is to present the experience of the authors in performing musculoskeletal interventional procedures by ultrasound.

El ultrasonido es una modalidad imaginológica útil para el estudio de múltiples estructuras, tales como tejidos subcutáneos, tendones, músculos, articulaciones y nervios. Tiene un bajo costo, amplia disponibilidad y alta resolución. Estas ventajas hacen del ultrasonido una excelente modalidad en procedimientos intervencionales tales como biopsias de tejidos de partes blandas, aspiración de quistes y otras colecciones y también en el tratamiento de calcificaciones sintomáticas, tales como depósitos de cristales de hidroxiapatita de calcio en el manguito rotador. Este artículo desea mostrar la experiencia de los autores en la realización de procedimientos intervencionales musculoesqueléticos guiados por ultrasonido.

Assuntos

RESUMO

Cryptosporidium sp oocysts were detected in snails (Helix aspersa Miller) and slug (Deroceras reticulatum Miller) from the Valparaiso Region, Chile. Snails and slug were collected from public squares and private domestic gardens. Cryptosporidium sp oocysts were recovered from faeces of both species. Ziehl Neelsen stain, nested PCR, and sequencing analysis demonstrated a profile similar to that described for genotype C or 2 of the parasite. These results demonstrate that snails and slug could act as a reservoir and mechanic vector of C. parvum infection for humans and animals. Moreover, gastropods could serve as bioindicators of fecal soil contamination.

Assuntos

RESUMO

La criptosporid iosis es una zoonosis parasitaria provocada por diversas especies de Cryptosporidium. Esta coccidiosis afecta a múltiples vertebrados, incluido el ser humano. En Chile, al igual que en otros países, es una infección poco frecuente en inmunocompetentes y adquiere gran relevancia en pacientes inmunocom-prometidos. Se presenta el caso de una egresada de la carrera de Medicina Veterinaria, embarazada, con 20 semanas de gestación, procedente del sector de Laguna Verde, Región de Valparaíso, que fuera infectada por Cryptosporidium sp. El diagnostico etiológico se realizó con tinción de Ziehl Neelsen, RPC anidada y posterior secuenciación. En el mismo periodo se detectó la infección en sus gatos asintomáticos. En ella y los animales se identificó a C. parvum. Su cónyuge así como sus otras mascotas no estaban infectados. Este corresponde al primer reporte de una posible transmisión de criptos-poridiosis entre ser humano y gato.

Cryptosporidioses is a parasitic zoonoses generated by diverse Cryptosporidium species. This coccidiosis affects multiple vertebrate species, including human beings. In Chile, as it happens in other countries, cryptosporidioses is a low frequency infection in immunocompetent individuals, acquiring a big relevance in immunocompromised ones. We present the following case: a recently graduated student from Veterinary medical school, with a 20 week pregnancy, living in “Laguna Verde” area in the Region of Valparaíso and who was infected with Cryptosporidium sp. Etiologic diagnosis was made by Ziehl Neelsen, and nested PCR followed by PCR product sequencing. During the same period, the infection was detected in her cats which were asymptomatic. In all of them, her and the cats, the species identified was Cryptosporidium parvum. Her husband and her other pets were all asymptomatic and non infected. This is the first report of a possible cryptosporidioses transmission between humans and cat.

Assuntos

RESUMO

Cryptosporidium sp oocysts were detected in snails (Helix aspersa Milller) and slug (Deroceras reticulatum Milller) from the Valparaiso Region, Chile. Snails and slug were collected from public squares and private domestic gardens. Cryptosporidium sp oocysts were recovered from faeces of both species. Ziehl Neelsen stain, nested PCR, and sequencing analysis demonstrated a profile similar to that described for genotype C or 2 of the parasite. These results demonstrate that snails and slug could act as a reservoir and mechanic vector of C. parvum infection for humans and animals. Moreover, gastropods could serve as bioindicators of fecal soil contamination.

Se detectó ooquistes de Cryptosporidium sp en caracoles (Helix aspersa Müller) y babosas (Deroce-ras reticulatum Müller) de la Región de Valparaíso, Chile. La recolección de caracoles y babosas se efectuó en parques públicos y jardines de diferentes hogares. Los ooquistes de Cryptosporidium sp fueron recuperados de las deposiciones de ambas especies. Después de la tinción de Ziehl Neelsen y la RPC anidada, el análisis de secuenciación demostró un patrón similar a lo descrito para el genotipo C o 2 del parásito. Estos resultados demuestran que los caracoles y babosas podrían actuar como reservorio y vectores mecánicos de la infección por Cryptosporidium. parvum para humanos y animales. Además, estos gastrópodos podrían ser usados como bio-indicadores de contaminación fecal del suelo.

Assuntos

RESUMO

The transport properties of graphene nanoribbons with linear benzene-based molecules pinned at the ribbon edges are studied. The systems are described by a single pi-band tight-binding Hamiltonian and by using the Green functions formalism based on real-space renormalization techniques. Different configurations have been considered, such as two and three attached molecules separated by a variable distance d, and the case of a finite array of molecules attached to the ribbon in different geometries (one-side and alternated sequence). In the latter case the conductance behavior is compared with the case of a molecular superlattice-like structure. In these hybrid systems of ribbons with a large number of regular attached foreign structures, we have shown the formation of well-defined energy gaps for which the conductance is completely suppressed. These gaps can be tuned by varying the number, relative distance, and length of the attached molecules. An analysis is performed to understand the nature of the conductance gap and its relation with the foreign molecular structures, providing a mechanism to delineate novel molecular sensors.

Assuntos

RESUMO

Introduction: Anterior Cruciate Ligament (ACL) reconstruction is frequently evaluated using Magnetic Resonance Imaging (MRI). In order to do this, it becomes very important to recognize the changes of the graft along the first postoperative months. Objective and Hypothesis: Establish the maturation pattern of the ST-G graft after reconstruction of the ACL on the third and sixth month after surgery by means of MRI. Materials and Methods: 32 ACL reconstructions were evaluated by MRI on the 3rd and 6th month after surgery. The graft was analyzed at the level of the femoral tunnel and the articular segment. The maturation criteria used in this study were a low and homogeneous intrasubstance signal and the absence of ligament-to-bone interface. Results: At the 31d month after surgery, 44 percent of the patients had a low intensity signal in the femoral tunnel and 63 percent articular. The signal was homogeneously low in 6 percent of the patients at the femoral tunnel and in 53 percent of the patients at the articular segment. The absence of a ligament-to-bone interface was found in 44 percent of the patients. Six months after surgery, we found low intensity signals in 78 percent of the patients at the femoral tunnel and in 94 percent of the patients at the articular segment. The signal was homogeneously low in 41 percent of the patients in the femoral tunnel and in 78 percent of the patients within the articular segment. The absence of a ligament-to-bone interface was found in 66 percent of the patients. Conclusions: The graft matured during the period of observation and the number of homogeneous low-intensity signals increased between the third and sixth month, thus our hypothesis is confirmed. According to all the criteria employed in this study, the intrarticular segment matures earlier than the intra-tunnel segment.

Introducción: La evaluación de la reconstrucción de ligamento cruzado anterior (LCA) por medio de la resonancia magnética (RM) es un método frecuentemente utilizado. Resulta por tanto fundamental conocer los cambios evolutivos del injerto en los primeros meses del postoperatorio. Objetivo e Hipótesis: Determinar un patrón de maduración mediante RIVI del injerto semitendinoso-gracilis (ST-G) en la reconstrucción de LCA at tercer y sexto mes postcirugía. Pacientes y Métodos: 32 pacientes sometidos a reconstrucción de LCA, fueron estudiados mediante RM a los 3 y 6 meses postcirugía. Se evaluaron las características del injerto, a nivel del túnel femoral y segmento articular, definiendo como criterios de maduración la obtención de una baja intensidad de señal intra sustancia, de aspecto homogéneo y con ausencia de interfase osteoligamentosa. Resultados: Al tercer mes de la cirugía, encontramos 44 por ciento de señal de baja intensidad a nivel del túnel femoral y 63 por ciento articular. La señal fue homogénea en 6 por ciento de los pacientes a nivel del túnel femoral y 53 por ciento articular. La ausencia de interfase osteoligamentosa se pesquisó en 44 por ciento de los pacientes. Al sexto mes, encontramos 78 por ciento de señal de baja intensidad a nivel del túnel femoral y 94 por ciento articular. La señal fue homogénea en 41 por ciento de los pacientes a nivel del túnel femoral y 78 por ciento articular. La ausencia de interfase osteoligamentosa se pesquisó en 66 por ciento de los pacientes. Conclusiones: Se observa que el injerto evoluciona, madurando entre el tercer y sexto mes de acuerdo a los criterios utilizados, confirmando así la hipótesis de que existe un patrón de maduración definido. El segmento intrarticular, madura más precozmente que el segmento intra-túnel.

Assuntos

RESUMO

ETHNOPHARMACOLOGICAL RELEVANCE: Buddleja globosa, known as "matico", is employed in Chile for wound healing. AIM OF THE STUDY: To validate the traditional use of the crude drug through in vivo and in vitro evaluation of the anti-inflammatory, analgesic and antioxidant properties of its extracts. MATERIALS AND METHODS: Sequential hexane, dichloromethane, methanol and total methanol extracts were studied using bioguided fractionation. The following activities were investigated: analgesic (writhing test), oral and topic anti-inflammatory (paw- and ear-induced edema), free radical scavenging and antioxidant activities (1,1-diphenyl-2-picrylhydrazyl, DPPH, superoxide anion, lipid peroxidation and xanthine oxidase inhibition). Sodium naproxen, nimesulide, indomethacin were used as reference drugs for in vivo, quercetin and allopurinol for in vitro assays. RESULTS: A mixture of alpha- and beta-amyrins was isolated from the hexane extract that showed 41.2% of analgesic effect at 600 mg/kg, inhibited by 47.7 and 79.0% the arachidonic acid (AA) and 12-deoxyphorbol-13-decanoate (TPA)-induced inflammation at 3mg/20 microL/ear, respectively. A mixture of beta-sitosterol, stigmasterol, stigmastenol, stigmastanol and campesterol was isolated from the fraction CD4-N and beta-sitosterol-glycoside from the fraction CD5-N, reducing TPA-induced inflammation by 78.2 and 83.7% at 1mg/20 microL/ear, respectively. The fraction CD4-N at 300 mg/kg also showed analgesic activity (38.7%). The methanol extract at 600mg/kg per os showed anti-inflammatory effect (61.4%), topic anti-inflammatory (56.7% on TPA) and analgesic activity (38.5%). Verbascoside and luteolin-7-O-glucoside were the major components of the methanol extract; apigenin 7-O-glucoside was also detected. Inhibition of superoxide anion, lipoperoxidation, and DPPH bleaching effect was found in the methanol serial and global extracts. CONCLUSIONS: The present report demonstrate the analgesic and anti-inflammatory properties of Buddleja globosa and validate its use in Chilean traditional medicine.

Assuntos

RESUMO

In this work we address the effects on the conductance of graphene nanoribbons (GNRs) of organic molecules adsorbed at the ribbon edge. We studied the case of armchair and zigzag GNRs with quasi-one-dimensional side-attached molecules, such as linear poly-aromatic hydrocarbons and poly(para-phenylene). These nanostructures are described using a single-band tight-binding Hamiltonian and their electronic conductance and density of states are calculated within the Green's function formalism based on real-space renormalization techniques. We found that the conductance exhibits an even-odd parity effect as a function of the length of the attached molecules. Furthermore, the corresponding energy spectrum of the molecules can be obtained as a series of Fano antiresonances in the conductance of the system. The latter result suggests that GNRs can be used as a spectrograph sensor device.