RESUMO
We determined the alleles of ten single nucleotide poly-morphisms (SNPs) in the APOA5/A4/C3/A1 gene cluster and in APOB in Han Chinese from Xinjiang Shihezi, China using MALDI-TOF mass spectrometry, and explored the correlation between these SNPs and dyslipidemia through a case-control study design with 250 pa-tients and 250 normal controls. All SNPs except for APOA5 rs2072560 conformed to Hardy-Weinberg equilibrium (all P > 0.05). APOA5 rs651821, APOA4 rs5104, APOC3 rs734104, and APOC3 rs5128 geno-type and allele frequencies were significantly different between groups (all P < 0.01). For rs651821, the risks of dyslipidemia for the CC or CC+CT genotypes were 9.917 or 1.859 times that of TT, and the risk of the C vs T allele was 2.027. For rs5104, the AG, GG, or AG+GG risks were 1.797, 1.861, and 1.809 times AA, and the G vs A risk was 1.427. For rs734104, the CT, CC, or CC+CT risks were 1.851, 2.570, and 1.958 times TT, and the C vs T risk was 1.610. For rs5128, the GC or CC+GC risks were 1.738 or 1.749 times GG, and the C vs G risk was 1.477. Compared with the wild-type haplotype TATG, the risks of dyslipidemia with CGCC, TGCC, or CATG haplotypes (odds ratios = 2.434, 1.503, and 2.740, respectively) were significantly higher. Our results suggested that these four SNPs were significantly associated with dyslipidemia in Xinjiang Shihezi Han Chinese, and might serve as risk factors for dyslipidemia. Individuals carrying the CGCC, TGCC, or CATG haplotypes were prone to dyslipidemia.
Assuntos
Apolipoproteína C-III/genética , Apolipoproteínas A/genética , Apolipoproteínas B/genética , Dislipidemias/genética , Estudos de Associação Genética , Família Multigênica , Polimorfismo de Nucleotídeo Único , Alelos , Estudos de Casos e Controles , Feminino , Frequência do Gene , Genótipo , Haplótipos , Humanos , Masculino , Pessoa de Meia-Idade , Fatores de RiscoRESUMO
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
RESUMO
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
RESUMO
This study aimed to explore some useful biomarkers to focus on the diagnosis and therapy response judgment in esophageal squamous cell carcinoma in Xinjiang. We used enzyme-linked immunosorbent method and immunohistochemistry to detect the expression of VEGF, EGFR, ES, HER-2, and NF-κBp in the serum and tissue with esophageal squamous cell carcinoma, and to analyze the relationship between biomarkers and clinical pathology and curative effects. Our findings were as follows: 1. The serum levels of VEGF and ES in Han patients were obviously higher than those of Uygur and Kazakh patients (P < 0.05). The VEGF positive rate in patients at a later clinical stage was higher than that of the patients at an earlier clinical stage (stages II-IV were 14.29, 50.00, and 50.00%, respectively, P < 0.05), meanwhile it was higher than that of patients without lymph node metastases (78.13 vs 25.00%, P < 0.05). The curative effective rate of patients with negative expression of VEGF was higher than that of patients with positive expression of VEGF (74.67 vs 41.40%, P < 0.05). 2. The expression of EGFR protein in male patients was higher than that of female patients (69.77 vs 35.29%, P < 0.05). Before treatment, the serum EGFR level in patients was higher than the normal group (P < 0.05). 3. The serum ES level in patients before and after treatment was significantly higher than in the normal group (P < 0.05). 4. The HER-2 positive rate in higher differentiated tumor tissue was lower than that in lower differentiated tumor tissue. (The positive rate of I, II, III grade was 70.00, 30.00, and 20.00%, respectively, P < 0.05). 5. The NF-κB positive rate in patients with lymph node metastases was higher than that of patients without lymph node metastases (65.63 vs 39.27%, P < 0.05), meanwhile median survival in the latter group was higher than that of the former group (P < 0.05). Our data suggest that the expression of VEGF and ES were different in Uygur, Han, and Kazakh patients in Xinjiang. The combined detection of tumor markers in serum and tissue is of direct significance for tumor therapy.
Assuntos
Biomarcadores Tumorais/genética , Carcinoma de Células Escamosas/genética , Neoplasias Esofágicas/genética , Receptores de Estrogênio/genética , Fator A de Crescimento do Endotélio Vascular/genética , Idoso , Antineoplásicos/uso terapêutico , Biomarcadores Tumorais/sangue , Carcinoma de Células Escamosas/etnologia , Carcinoma de Células Escamosas/patologia , Carcinoma de Células Escamosas/terapia , Estudos de Casos e Controles , China , Receptores ErbB/sangue , Receptores ErbB/genética , Neoplasias Esofágicas/etnologia , Neoplasias Esofágicas/patologia , Neoplasias Esofágicas/terapia , Carcinoma de Células Escamosas do Esôfago , Etnicidade , Feminino , Raios gama/uso terapêutico , Expressão Gênica , Humanos , Metástase Linfática , Masculino , Pessoa de Meia-Idade , NF-kappa B/sangue , NF-kappa B/genética , Estadiamento de Neoplasias , Receptor ErbB-2/sangue , Receptor ErbB-2/genética , Receptores de Estrogênio/sangue , Fatores Sexuais , Fator A de Crescimento do Endotélio Vascular/sangueRESUMO
The renin-angiotensin-aldosterone system plays a key role in regulating blood pressure by maintaining vascular tone and the water/sodium balance. Many antihypertensive drugs target the renin-angiotensin-aldosterone system, but the effect differs considerably among hypertensive patients. We investigated whether genetic variants of the angiotensin II type 1 receptor are associated with blood pressure response to angiotensin II receptor blockers in hypertensive Chinese patients. After a 2-week single-blind placebo run-in period, 148 patients with mild-to-moderate primary hypertension received monotherapy with 80 mg/day telmisartan and then were followed up for 8 weeks. The 1166A/C, 573T/C, -810A/T, and -521C/T polymorphisms of the AT1R gene were determined through PCR and RFLP analysis. The relationship between these polymorphisms and changes in blood pressure was observed and evaluated after 8 weeks of treatment. Patients with the AT1R -521CC genotype had a significant reduction in diastolic blood pressure compared to those carrying the T allele. No significant reduction in blood pressure was found in individuals with the 1166A/C, 573T/C, or -810A/T polymorphisms of the AT1R gene. We conclude that only the AT1R -521CC genotype is associated with a significant decrease in blood pressure in response to telmisartan treatment in Chinese hypertensive patients.
Assuntos
Antagonistas de Receptores de Angiotensina/uso terapêutico , Anti-Hipertensivos/uso terapêutico , Benzimidazóis/administração & dosagem , Benzimidazóis/uso terapêutico , Benzoatos/administração & dosagem , Benzoatos/uso terapêutico , Hipertensão/tratamento farmacológico , Hipertensão/genética , Receptor Tipo 1 de Angiotensina/genética , Adulto , Idoso , Angiotensina II/sangue , Angiotensina II/genética , Antagonistas de Receptores de Angiotensina/farmacologia , Anti-Hipertensivos/farmacologia , Povo Asiático , Benzimidazóis/farmacologia , Benzoatos/farmacologia , Pressão Sanguínea/efeitos dos fármacos , Pressão Sanguínea/genética , Esquema de Medicação , Hipertensão Essencial , Feminino , Genótipo , Humanos , Masculino , Pessoa de Meia-Idade , Polimorfismo Genético , Método Simples-Cego , Telmisartan , Adulto JovemRESUMO
The hypoxic-ischemic encephalopathy caused by peripartum asphyxia is a serious disease in newborn infants, and effective therapies need to be developed to reduce injury-related disorders. We evaluated the effects of NEP1-40 and fasudil on Nogo-A expression in neonatal hypoxic-ischemic brain damage (HIBD) rats. Seven-day-old Wistar rats were randomly divided into control, HIBD, NEP1-40, and fasudil groups. NEP1-40 and fasudil groups were injected intraperitoneally with these compounds. Rat brains at 6, 24, 72 h, and 7 days after HIBD were collected to determine histopathological damage and the expression levels of Nogo-A. Histopathological damage was reduced in NEP1-40 and fasudil groups compared with the untreated HIBD group. The expression of Nogo-A in the HIBD group was significantly higher than that in control, NEP1-40 and fasudil groups at the same times. Compared with the fasudil group, the expression levels of Nogo-A were significantly reduced in the NEP1-40 group. We conclude that NPE1-40 and fasudil have potential for neuroprotective effects in the neonatal rat HIBD model, mediated by inhibiting Nogo-A/ Rho pathways.
Assuntos
1-(5-Isoquinolinasulfonil)-2-Metilpiperazina/análogos & derivados , Encéfalo/efeitos dos fármacos , Hipóxia-Isquemia Encefálica/prevenção & controle , Proteínas da Mielina/biossíntese , Proteínas da Mielina/uso terapêutico , Fármacos Neuroprotetores/uso terapêutico , Fragmentos de Peptídeos/uso terapêutico , 1-(5-Isoquinolinasulfonil)-2-Metilpiperazina/administração & dosagem , 1-(5-Isoquinolinasulfonil)-2-Metilpiperazina/uso terapêutico , Animais , Animais Recém-Nascidos , Encéfalo/metabolismo , Encéfalo/patologia , Artérias Carótidas/efeitos dos fármacos , Artérias Carótidas/metabolismo , Artérias Carótidas/patologia , Feminino , Expressão Gênica/efeitos dos fármacos , Hipóxia-Isquemia Encefálica/genética , Hipóxia-Isquemia Encefálica/metabolismo , Hipóxia-Isquemia Encefálica/patologia , Imuno-Histoquímica , Hibridização In Situ , Injeções Intraperitoneais , Ligadura/métodos , Masculino , Proteínas da Mielina/administração & dosagem , Proteínas da Mielina/genética , Neurônios/citologia , Neurônios/efeitos dos fármacos , Neurônios/metabolismo , Fármacos Neuroprotetores/administração & dosagem , Proteínas Nogo , Fragmentos de Peptídeos/administração & dosagem , Ratos , Ratos WistarRESUMO
Suppressor of cytokine signaling (SOCS)-3 is a key negative regulator of cytokine signaling that inhibits the JAK/STAT signal transduction pathway; there are reports describing its role in attenuating arthritis through SOCS-3 overexpression. We examined the relationship between polymorphisms in the coding sequence and promoter region of SOCS-3 and rheumatoid arthritis (RA) in a Chinese Han population. Two single-nucleotide polymorphisms in the SOCS-3 5' region: -1044 C>A within the promoter region and rs12953258 (-920 C>A) in the 5'UTR (exon 2) of SOCS-3 were studied by restriction fragment length polymorphism analysis and tetra-ARMS-PCR in 100 RA patients and 100 healthy adults. The prevalence of the homozygous genotype -1044 CC was 100% in both RA and control groups. The heterozygous genotype (-920 C>A) was present in 89% of RA and in 82% of the control group, which is significantly different from the distribution in Western people. There was no transmission disequilibrium between these two SNPs (r(2) = 0.000). We did not detect significant differences in allele or genotype frequencies for either of these SNPs between the RA group and controls (P > 0.05). There was no association between rheumatoid factor and SOCS-3 SNP rs12953258 (P = 0.258). We conclude that SOCS-3 polymorphism is not a genetic risk factor for RA in Chinese patients.
Assuntos
Artrite Reumatoide/genética , Polimorfismo Genético/genética , Polimorfismo de Nucleotídeo Único/genética , Proteínas Supressoras da Sinalização de Citocina/genética , Alelos , Povo Asiático/genética , Feminino , Predisposição Genética para Doença/genética , Genótipo , Haplótipos/genética , Humanos , Desequilíbrio de Ligação/genética , Masculino , Proteína 3 Supressora da Sinalização de CitocinasRESUMO
The anti-shock effects of an organic nitric oxide donor, S-nitroso-N-acetylpenicillamine (SNAP), were tested in a rat model of hemorrhagic shock. Administration of SNAP at a dose of 10 mcg/kg injection followed by 10 mcg/kg/h infusion neither significantly decreased mean arterial blood pressure (MABP) nor significantly altered bleedout volumes in hemorrhagic rats, indicating that SNAP did not modify the severity of the shock protocol. However, hemorrhaged rats treated with SNAP maintained post-reinfusion MABP at significantly higher values than hemorrhaged rats receiving 0.9% NaCl (final MABP 81 +/- 3.0 mmHg vs. 54 +/- 1.1 mmHg, respectively; p < 0.001). SNAP also significantly increased survival times following hemorrhagic shock (113 +/- 4 min in SNAP treated rats compared with 70 +/- 4.5 min in vehicle treated rats, p < 0.001). The overall survival rates were 87.5% when treated with SNAP and 0% with 0.9% NaCl (p < 0.01). In hemorrhagic shock rats receiving only vehicle, a significant accumulation of neutrophils in intestinal tissue occurred as indicated by a higher MPO activity in intestinal tissue (MPO activity, 1.26 +/- 0.31 vs. 0.14 +/- 0.05U/100 mg in sham hemorrhagic shock rats, p < 0.02). Administration of SNAP significantly attenuated the neutrophil accumulation in the intestinal tissue (MPO activity, 0.42 +/- 0.09U/100 mg, p < 0.05 compared with hemorrhagic rats receiving only the vehicle). Moreover, endothelial dysfunction of superior mesenteric artery rings occurred in hemorrhagic shock rats given only 0.9% NaCl.(ABSTRACT TRUNCATED AT 250 WORDS)
Assuntos
Penicilamina/análogos & derivados , Choque Hemorrágico/prevenção & controle , Vasodilatadores/uso terapêutico , Animais , Pressão Sanguínea/efeitos dos fármacos , Íleo/efeitos dos fármacos , Técnicas In Vitro , Masculino , Artérias Mesentéricas/efeitos dos fármacos , Músculo Liso Vascular/efeitos dos fármacos , Neutrófilos/efeitos dos fármacos , Penicilamina/uso terapêutico , Peroxidase/metabolismo , Ratos , Ratos Sprague-Dawley , S-Nitroso-N-Acetilpenicilamina , Choque Hemorrágico/patologiaRESUMO
To further clarify the protective mechanism(s) of defibrotide in splanchnic artery occlusion (SAO) shock, we observed the effect of defibrotide on polymorphonuclear leukocyte (PMN) accumulation in the intestinal tissue, gastric lysosomal hydrolases and endothelial function of the ischemia-reperfused superior mesenteric artery (SMA). Pentobarbital anesthetized rats were subjected to occlusion of both the celiac and superior mesenteric arteries for 90 min followed by 2 h reperfusion. The rats receiving only the vehicle for defibrotide exhibited a marked increase in intestinal myeloperoxidase (MPO) activity and a significant endothelial dysfunction manifested by the loss of endothelium-dependent vasorelaxation. Only 2 of 6 rats (33%) survived 2 h of reperfusion. In contrast, those rats treated with defibrotide exhibited significantly attenuated PMN accumulation in intestinal tissue, enhanced endothelium-dependent vasorelaxation in SMA rings, prolonged survival time and increased survival rate to 6 of 7 (i.e., 86%). However, addition of defibrotide in vitro had no direct effect on LTB4 activated PMN adherence to vascular endothelium. Moreover, defibrotide preserved gastric lysosomal membranes in vitro. These results indicate that the protective effect of intravenous administration of defibrotide on SAO shock may be related to its endothelial preserving effect reducing PMN adherence and protection of endothelial and lysosomal membrane integrity.
Assuntos
Fibrinolíticos/uso terapêutico , Oclusão Vascular Mesentérica/tratamento farmacológico , Polidesoxirribonucleotídeos/uso terapêutico , Animais , Íleo/enzimologia , Masculino , Oclusão Vascular Mesentérica/metabolismo , Neutrófilos/efeitos dos fármacos , Neutrófilos/metabolismo , Peroxidase/metabolismo , Ratos , Ratos Endogâmicos , Reperfusão , Choque/enzimologia , Choque/metabolismoRESUMO
Injection of sodium arachidonate (NaAr) intravenously at a dose of 2 mg/kg is uniformly lethal in rabbits within 3 min. This sudden death is characterized by a precipitous drop in mean blood pressure within 2 min after injection of NaAr, a marked decrease in the circulating platelet count, a significant increase in intratracheal pressure and in plasma thromboxane A2 (TxA2) concentration as measured by radioimmunoassay of its stable breakdown product, TxB2. Pretreatment with Bay-u-3405, a new specific thromboxane receptor antagonist, at a dose of 1 or 10 mg/kg dramatically protected rabbits against sudden death induced by injection of NaAr. All of the rabbits treated with either of these two doses of Bay-u-3405 survived, and their thrombocytopenia, elevated plasma TxB2 concentration and bronchoconstriction were significantly attenuated. However, administration of 0.1 mg/kg Bay-u-3405 exerted no protective effect in this lethal model. Bay-u-3405 was shown to be a potent and specific inhibitor of thromboxane-mimetic induced platelet aggregation in vitro. Our data clearly show that Bay-u-3405 is a very effective protective agent against NaAr-induced sudden death in rabbits, blocking all of the known deleterious effects of TxA2.