RESUMO
This study assessed the clinical efficacy of lamivudine and adefovir dipivoxil combined with autologous bone marrow stem cell transplantation as treatment for patients with hepatitis B and decompensated liver cirrhosis. In total, 77 patients with hepatitis B and decompensated liver cirrhosis were randomly divided into two groups. Under general symptomatic and supportive treatment, the patients in group A (37 cases) were treated with lamivudine and adefovir dipivoxil, whereas those in group B (40 cases) were treated with autologous bone marrow stem cell transplantation in combination with lamivudine and adefovir dipivoxil. After 4 weeks of treatment, the liver function indicators and clinical signs and symptoms of the patients in group B improved more significantly than those of patients in group A. Lamivudine and adefovir dipivoxil in combination with autologous bone marrow stem cell transplantation effectively prevented hepatitis B virus infection and bone marrow stem cell damage. This combination treatment facilitates the differentiation of bone marrow stem cells into normal liver cells to restore liver structure and improve liver function, thereby improving the quality of life of patients.
Assuntos
Adenina/análogos & derivados , Vírus da Hepatite B/efeitos dos fármacos , Lamivudina/uso terapêutico , Cirrose Hepática/tratamento farmacológico , Cirrose Hepática/virologia , Organofosfonatos/uso terapêutico , Transplante de Células-Tronco , Adenina/efeitos adversos , Adenina/farmacologia , Adenina/uso terapêutico , Colinesterases/metabolismo , Terapia Combinada , Feminino , Humanos , Lamivudina/efeitos adversos , Lamivudina/farmacologia , Cirrose Hepática/fisiopatologia , Testes de Função Hepática , Masculino , Pessoa de Meia-Idade , Organofosfonatos/efeitos adversos , Organofosfonatos/farmacologia , Tempo de Protrombina , Transplante de Células-Tronco/efeitos adversos , alfa-Fetoproteínas/metabolismoRESUMO
In recent years, viroid disease outbreaks have resulted in serious economic losses to a number of tomato growers in North America (1,2,3). At least three pospiviroids have been identified as the causal agents of tomato disease, including Potato spindle tuber viroid (PSTVd), Tomato chlorotic dwarf viroid (TCDVd), and Mexican papita viroid (MPVd). In the spring of 2013, a severe disease outbreak with virus-like symptoms (chlorosis and plant stunting) was observed in a tomato field located in the Dominican Republic, whose tomato production is generally exported to the United States in the winter months. The transplants were produced in house. The disease has reached an epidemic level with many diseased plants pulled and disposed of accordingly. Three samples collected in May of 2013 were screened by ELISA against 16 common tomato viruses (Alfalfa mosaic virus, Cucumber mosaic virus, Impatiens necrotic spot virus, Pepino mosaic virus, Potato virus X, Potato virus Y, Tobacco etch virus, Tobacco mosaic virus, Tobacco ringspot virus, Tomato aspermy virus, Tomato bushy stunt virus, Tomato mosaic virus, Tomato ringspot virus, Tomato spotted wilt virus, Groundnut ringspot virus, and Tomato chlorotic spot virus), a virus group (Potyvirus group), three bacteria (Clavibacter michiganensis subsp. michiganensis, Pectobacterium atrosepticum, and Xanthomonas spp.), and Phytophthora spp. No positive result was observed, despite the presence of symptoms typical of a viral-like disease. Further analysis by RT-PCR using Agdia's proprietary pospiviroid group-specific primer resulted in positive reactions in all three samples. To determine which species of pospiviroid was present in these tomato samples, full-genomic products of the expected size (~360 bp) were amplified by RT-PCR using specific primers for PSTVd (4) and cloned using TOPO-TA cloning kit (Invitrogen, CA). A total of 8 to 10 clones from each isolate were selected for sequencing. Sequences from each clone were nearly identical and the predominant sequence DR13-01 was deposited in GenBank (Accession No. KF683200). BLASTn searches into the NCBI database demonstrated that isolate DR13-01 shared 97% sequence identity to PSTVd isolates identified in wild Solanum (U51895), cape gooseberry (EU862231), or pepper (AY532803), and 96% identity to the tomato-infecting PSTVd isolate from the United States (JX280944). The relatively lower genome sequence identity (96%) to the tomato-infecting PSTVd isolate in the United States (JX280944) suggests that PSTVd from the Dominican Republic was likely introduced from a different source, although the exact source that resulted in the current disease outbreak remains unknown. It may be the result of an inadvertent introduction of contaminated tomato seed lots or simply from local wild plants. Further investigation is necessary to determine the likely source and route of introduction of PSTVd identified in the current epidemic. Thus, proper control measures could be recommended for disease management. The detection of this viroid disease outbreak in the Dominican Republic represents further geographic expansion of the viroid disease in tomatoes beyond North America. References: (1). K.-S. Ling and M. Bledsoe. Plant Dis. 93:839, 2009. (2) K.-S. Ling and W. Zhang. Plant Dis. 93:1216, 2009. (3) K.-S. Ling et al. Plant Dis. 93:1075, 2009. (4) A. M. Shamloul et al. Can. J. Plant Pathol. 19:89, 1997.
RESUMO
In January 2011, tomato (Solanum lycopersicum) plants exhibiting stunting, yellow mosaic, short, chlorotic leaves, aborted flowers, and reduced-size fruits, symptoms similar to those exhibited by plants infected by 'Candidatus Liberibacter solanacearum' (2), were observed in approximately 5% of tomato plants in greenhouses in Jocotitlan in the State of Mexico, Mexico. Occasional plant recovery was also observed. Tomato plants in this facility were previously shown to be infected by Mexican papita viroid (MPVd), Pepino mosaic virus (PepMV), and aster yellows phytoplasma. Eight symptomatic leaf samples (designated MX11-01 to MX11-08) were collected and screened against selected tomato viruses and pospiviroids by reverse transcription (RT)-PCR using purified plant RNA or for 'Ca. L. solanacearum' by PCR using purified plant DNA. As expected, both PepMV and MPVd were detected in these samples. However, two 'Ca. L. solanacearum'-specific PCR products (1,168 and 669 bp) were also amplified in two samples (MX11-02 and MX11-05) using primers OA2 (2) and OI2c (1) or CL514F/CL514R (3), respectively. Each 'Ca. L. solanacearum'-specific PCR product was gel purified with Geneclean (Q-Biogene, Carlsbad, CA) and cloned into pCR2.1 using TOPO TA cloning kit (Invitrogen, Carlsbad, CA) and sequenced (Functional Biosciences, Madison, WI). Sequences of 16S rRNA (1,168 bp) in both isolates (GenBank Accession Nos. JF811596 and JF811597) were identical. However, the 669-bp 50S rRNA sequences in these two isolates (GenBank Accession Nos. JF811598 and JF811599) contained two single nucleotide polymorphism (SNP) mutations. BLASTn searches showed that both 16S rRNA and 50S gene sequences in MX11-05 were identical to the 'Ca. L. solanacearum' previously identified on potato in Chihuahua (GenBank Accession Nos. FJ829811 and FJ829812) and Saltillo (GenBank Accession Nos. FJ498806 or FJ498807) in eastern Mexico. These 'Ca. L. solanacearum' isolates were recently classified as the "b" haplotype (4). Alignment analysis of the 'Ca. L. solanacearum' 16S rRNA sequences also revealed the conserved SNP mutations (g.212T > G and g.581T > C) in MX11-02 and MX11-05 as previously identified for other "b" haplotype isolates (4). 'Ca. L. solanacearum' was first identified in greenhouse tomatoes in 2008 in New Zealand (2). It has also been identified in greenhouse and field tomatoes in the United States. 'Ca. L. solanacearum' was previously reported to infect field tomatoes in Sinaloa, Mexico (3), which was recently considered as the "a" haplotype (4). To our knowledge, this is the first report of 'Ca. L. solanacearum' naturally infecting tomatoes in Jocotitlan in the State of Mexico, Mexico. The greenhouse tomato 'Ca. L. solanacearum' may be transmitted from infected solanaceous plants by potato psyllids (Bactericera cockerelli), which were observed in this facility. References: (1) S. Jagoueix et al. Int. J. Syst. Bacteriol. 44:379, 1994. (2) L. W. Liefting et al. Plant Dis. 93:208, 2009. (3) J. E. Munyaneza et al. Plant Dis. 93:1076, 2009 (4) W. R. Nelson et al. Eur. J. Plant Pathol. 130:5, 2011.
RESUMO
Pepino mosaic virus (PepMV) (genus Potexvirus) was first reported in Europe to be infecting greenhouse tomatoes (Solanum lycopersicum) in 2000 (3). Subsequently, it has also been identified in Canada and the United States (1) and has become widespread on greenhouse tomatoes in many countries. In early spring of 2010, symptoms including chlorotic mosaic or chlorotic patches on leaves, necrotic stems, and fruit deformation or marbling were noted. Approximately 50% of plants in a greenhouse in Jocotitlan, Mexico exhibited symptoms. Twenty-three symptomatic samples in four separate collections between April 2010 and January 2011 all tested positive for the presence of PepMV by ELISA and/or Agristrips (BioReba, Switzerland). Two symptomless samples were negative for PepMV. Biological inoculation with the isolate MX10-05 to three Nicotiana benthamiana and three tomato cv. Horizon plants all resulted in chlorotic mosaic symptoms on the systemic leaves and PepMV on the inoculated plants was confirmed by ELISA. To determine the genotype of PepMV in MX10-05, two primer sets targeting different part of the virus genome (separated by 2,744 nt) were selected for reverse transcription (RT)-PCR using total plant RNA extracted with the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). A RT-PCR product (840 bp) was obtained using the first primer set (PepMV-Ch2.F541: 5'CATGGAACCAGCTGATGTGA and PepMV-Ch2.R1380: 5'TCTTTGTATATGGTCGCAGC) targeting the 5' portion of the RNA-dependent RNA polymerase (RdRp) gene. The PCR product was cloned in pCR2.1 using the TOPO TA cloning system (Invitrogen, Carlsbad, CA) and a single clone was sequenced in both directions (Functional Biosciences, Madison, WI). After primer trimming, the 800-bp sequence (GenBank Accession No. JF811600) was shown in BLASTn to have its highest nucleotide sequence identity (99.4%) to the type PepMV-CH2 (DQ000985), 98% to other CH2/US2 isolates, 85% to US1, and 84% to EU. Another RT-PCR product (also 840 bp) was generated using the second primer set (PepMV-Ch2.F4081: 5'AAAAACGCTGTACCCAAAAC and PepMV-Ch2.R4920: 5'CAGAAATGTGTTCAGAGGGG) targeting the 3' portion of RdRp and TGB1 genes. This second genome segment enables the differentiation of the CH2 and US2 genotypes. The resulting 800 bp (JF811600) had the highest nucleotide sequence identity (99.5%) to the type PepMV CH2, 97% to other CH2 isolates, 83% to US2, and only 81% to the EU genotype. Taken together, these sequence analyses support the identification of MX10-05 as a PepMV-CH2 isolate (2). However, the presence of other PepMV genotypes cannot be excluded once sequences from other isolates are obtained and analyzed. To our knowledge, this is the first report of PepMV on greenhouse tomatoes in Mexico. References: (1). C. J. French et al. Plant Dis. 85:1121, 2001. (2). K.-S. Ling. Virus Genes 34:1, 2007. (3). R. A. A. van der Vlugt et al. Plant Dis. 84:103, 2000.
RESUMO
In early 2008, tomato plants (Solanum lycopersicum) grown in a large greenhouse facility located near Mexico City exhibited general stunting, leaf chlorosis at the top of the diseased plant that later turned bronze or purple, and reduced-sized fruits. Initially, diseased plants were confined to a 5-ha greenhouse, but the disease quickly spread to two additional 5-ha greenhouses in the summer of 2008. By the end of 2008, approximately 5% of tomato plants in 35-ha of greenhouse were infected. Sixteen diseased samples were collected, twelve in 2008 and four in 2009. Bioassays through mechanical inoculation with leaf extracts of diseased samples demonstrated the transmissibility of the causal agent to plants of tomato cvs. Horizon or Rutgers, which expressed symptoms that were similar to those on the source plants. Serological or PCR assays were negative for several commonly occurring greenhouse tomato viruses. However, an expected size product (~196 bp) was consistently detected by reverse transcription (RT)-PCR using pospiviroid-specific primers Pospil-RE and Pospil-FW (4) in all symptomatic samples or from the mechanically inoculated tomato plants. Preliminary analysis with sequences obtained from direct sequencing of amplicons revealed one dominant sequence with 94% identity to Mexican papita viroid (MPVd) (GenBank Accessions Nos. L78454 and L78456-L78463). However, further analysis of the cloned cDNAs indicated a mixed infection of two pospiviroids in two samples. Of 10 cDNA clones analyzed, 9 were MPVd-like sequences and one was sequence of Tomato chlorotic dwarf viroid (TCDVd). Further analysis using full genomic sequences obtained by RT-PCR with previously designed primers (2) or a new set of primers (MTTVd-F: 5' GGG GAA ACC TGG AGC GAA CTG G, and MTTVd-R: 5' GGG GAT CCC TGA AGC GCT CCT) revealed genetic diversity in this population. Eight of thirteen cloned cDNAs represented by the 359-nt sequence of isolate Mex8 (GenBank Accession No. GQ131572) had 93 to 94% nucleotide sequence identity to other MPVd isolates (L78454 and L78456-L78463). Five other cDNA clones represented by the 361-nt sequence of isolate HM2 (GenBank Accession No. GQ131573) were 99% identical to a TCDVd isolate recently identified in Arizona (GenBank Accession No. FJ822878) and 96 to 97% identical to TCDVd isolates from other areas (GenBank Accession Nos. AF162131 and AB329668). These results are the first evidence of a mixed infection of two viroids infecting tomatoes in Mexico. MPVd was first identified in Mexico on papita (S. cardiophyllum) in 1996 (1). The origin of TCDVd in this greenhouse was not determined, but TCDVd potentially can be seed transmitted in tomato (3). The close relationship between the Mexican and the U.S. isolates suggests that TCDVd in these two countries may share a common origin, likely from seed. To our knowledge, this is the first report of a natural infection of MPVd and TCDVd on tomatoes in Mexico. References: (1) J. P. Martinez-Soriano et al. Proc. Natl. Acad. Sci. U.S.A. 93:9397, 1996. (2) A. M. Shamloul et al. Can. J. Plant Pathol. 19:89, 1997. (3) R. P. Singh and A. D. Dilworth. Eur. J. Plant Pathol. 123:111, 2009. (4) J. Th. J. Verhoeven et al. Eur. J. Plant Pathol. 110:823, 2004.
RESUMO
In the summer of 2008, tomato (Solanum lycopersicum) plants in a large greenhouse tomato facility located in Delta, British Columbia, Canada exhibited general stunting, chlorosis, and purple-leaf symptoms that were distinct from those of Pepino mosaic virus (PepMV) (1). Diseased plants were localized mainly in two rows in a section of the greenhouse and produced no fruits or only fruits with reduced size. Leaf samples were collected from four individuals among numerous diseased plants in this greenhouse. Screening samples by ELISA, PCR, or reverse transcription (RT)-PCR for PepMV, Tomato spotted wilt virus, Tomato yellow leaf curl virus, Tomato torrado virus, Tomato apex necrosis virus, and Begomovirus, Tobamovirus, and Pospiviroid species showed that all four plants had a mixed infection of both PepMV and a pospiviroid. RT-PCR with the pospiviroid-specific primers Pospil-RE and Pospil-FW (3) amplified the expected 196-bp products from these four samples. Each amplicon was cloned into the pCR4-TOPO vector (Invitrogen, Carlsbad, CA) and one individual cDNA clone from each isolate was sequenced. BLASTN analyses of nucleotide sequences of these clones showed 97 to 99% identity to Mexican papita viroid (MPVd) isolates currently in the NCBI Genbank. These four newly identified MPVd isolates were not identical; seven nucleotide substitutions or indels were identified in this region. The full viroid genome was obtained by RT-PCR in isolate VF2 with a new reverse primer MPVd-RE (5' GATCCCTGAAGCGCTCCT 3') in combination with the forward primer Pospil-FW (3). Using the same approach as stated above, this amplicon was cloned and sequenced. The nucleotide sequence of the 196-nt amplicon previously amplified and cloned from the isolate VF2 genome was identical to this region in the genomic clone. BLASTN analysis showed that the VF2 genome (GenBank Accession No. FJ824844) had >98% sequence identity to each of nine MPVd isolates (GenBank Accession Nos. L78454 and L78456-L78463), 94% identity to Tomato planta macho viroid (TPMVd) (GenBank Accession No. K00817) and ~80% identity to Tomato chlorotic dwarf viroid (GenBank Accession Nos. EF582392-EF582393). Prior to this find, MPVd had been identified only in papita (Solanum cardiophyllum) in Mexico and is considered a possible ancestor of TPMVd, Potato spindle tuber viroid (PSTVd), and possibly of other PSTVd-group viroids now infecting crop plants (2). The origin of MPVd in this greenhouse facility in Delta, British Columbia is unknown. The infected plants were destroyed by the grower. The pathogenicity of MPVd isolates characterized in this study was not evaluated on tomato because of quarantine regulations governing this viroid in the United States. The identification of MPVd infecting an important agricultural crop (tomato) outside its center of origin in Mexico indicates a potentially important major shift in the epidemiology of MPVd. To our knowledge this is the first report of MPVd from tomato in Canada. References: (1). K.-S. Ling et al. Plant Dis. 92:1683, 2008. (2) J. P. Martinez-Soriano et al. Proc. Natl. Acad. Sci. U.S.A. 93:9397, 1996. (3) J. Th. J. Verhoeven et al. Eur. J. Plant Pathol. 110:823, 2004.