Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 56
Filtrar
Mais filtros











Base de dados
Intervalo de ano de publicação
1.
Commun Biol ; 7(1): 111, 2024 01 19.
Artigo em Inglês | MEDLINE | ID: mdl-38243071

RESUMO

Glutamine synthetases (GS) catalyze the ATP-dependent ammonium assimilation, the initial step of nitrogen acquisition that must be under tight control to fit cellular needs. While their catalytic mechanisms and regulations are well-characterized in bacteria and eukaryotes, only limited knowledge exists in archaea. Here, we solved two archaeal GS structures and unveiled unexpected differences in their regulatory mechanisms. GS from Methanothermococcus thermolithotrophicus is inactive in its resting state and switched on by 2-oxoglutarate, a sensor of cellular nitrogen deficiency. The enzyme activation overlays remarkably well with the reported cellular concentration for 2-oxoglutarate. Its binding to an allosteric pocket reconfigures the active site through long-range conformational changes. The homolog from Methermicoccus shengliensis does not harbor the 2-oxoglutarate binding motif and, consequently, is 2-oxoglutarate insensitive. Instead, it is directly feedback-inhibited through glutamine recognition by the catalytic Asp50'-loop, a mechanism common to bacterial homologs, but absent in M. thermolithotrophicus due to residue substitution. Analyses of residue conservation in archaeal GS suggest that both regulations are widespread and not mutually exclusive. While the effectors and their binding sites are surprisingly different, the molecular mechanisms underlying their mode of action on GS activity operate on the same molecular determinants in the active site.


Assuntos
Archaea , Glutamina , Glutamina/metabolismo , Archaea/genética , Archaea/metabolismo , Glutamato-Amônia Ligase/metabolismo , Ácidos Cetoglutáricos , Bactérias/metabolismo , Nitrogênio/metabolismo
2.
J Exp Bot ; 75(7): 2100-2112, 2024 Mar 27.
Artigo em Inglês | MEDLINE | ID: mdl-38069501

RESUMO

Downy mildew of grapevine (Vitis vinifera), caused by the oomycete Plasmopara viticola, is an important disease that is present in cultivation areas worldwide, and using resistant varieties provides an environmentally friendly alternative to fungicides. DOWNY MILDEW RESISTANT 6 (DMR6) from Arabidopsis is a negative regulator of plant immunity and its loss of function confers resistance to downy mildew. In grapevine, DMR6 is present in two copies, named VvDMR6-1 and VvDMR6-2. Here, we describe the editing of VvDMR6-1 in embryogenic calli using CRISPR/Cas9 and the regeneration of the edited plants. All edited plants were found to be biallelic and chimeric, and whilst they all showed reduced growth compared with non-transformed control plants, they also had reduced susceptibility to P. viticola. Comparison between mock-inoculated genotypes showed that all edited lines presented higher levels of salicylic acid than controls, and lines subjected to transformation presented higher levels of cis-resveratrol than controls. Our results identify VvDMR6-1 as a promising target for breeding grapevine cultivars with improved resistance to downy mildew.


Assuntos
Oomicetos , Vitis , Resistência à Doença/genética , Sistemas CRISPR-Cas , Melhoramento Vegetal , Vitis/genética , Doenças das Plantas
3.
Angew Chem Int Ed Engl ; 62(45): e202311981, 2023 11 06.
Artigo em Inglês | MEDLINE | ID: mdl-37712590

RESUMO

Massive efforts are invested in developing innovative CO2 -sequestration strategies to counter climate change and transform CO2 into higher-value products. CO2 -capture by reduction is a chemical challenge, and attention is turned toward biological systems that selectively and efficiently catalyse this reaction under mild conditions and in aqueous solvents. While a few reports have evaluated the effectiveness of isolated bacterial formate dehydrogenases as catalysts for the reversible electrochemical reduction of CO2 , it is imperative to explore other enzymes among the natural reservoir of potential models that might exhibit higher turnover rates or preferential directionality for the reductive reaction. Here, we present electroenzymatic catalysis of formylmethanofuran dehydrogenase, a CO2 -reducing-and-fixing biomachinery isolated from a thermophilic methanogen, which was deposited on a graphite rod electrode to enable direct electron transfer for electroenzymatic CO2 reduction. The gas is reduced with a high Faradaic efficiency (109±1 %), where a low affinity for formate prevents its electrochemical reoxidation and favours formate accumulation. These properties make the enzyme an excellent tool for electroenzymatic CO2 -fixation and inspiration for protein engineering that would be beneficial for biotechnological purposes to convert the greenhouse gas into stable formate that can subsequently be safely stored, transported, and used for power generation without energy loss.


Assuntos
Dióxido de Carbono , Formiato Desidrogenases , Dióxido de Carbono/química , Oxirredução , Catálise , Formiato Desidrogenases/metabolismo , Formiatos/metabolismo
4.
Front Microbiol ; 14: 1179204, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-37250035

RESUMO

Whilst widespread in the microbial world, the hybrid cluster protein (HCP) has been paradoxically a long-time riddle for microbiologists. During three decades, numerous studies on a few model organisms unravelled its structure and dissected its metal-containing catalyst, but the physiological function of the enzyme remained elusive. Recent studies on bacteria point towards a nitric oxide reductase activity involved in resistance during nitrate and nitrite reduction as well as host infection. In this study, we isolated and characterised a naturally highly produced HCP class I from a marine methanogenic archaeon grown on ammonia. The crystal structures of the enzyme in a reduced and partially oxidised state, obtained at a resolution of 1.45 and 1.36-Å, respectively, offered a precise picture of the archaeal enzyme intimacy. There are striking similarities with the well-studied enzymes from Desulfovibrio species regarding sequence, kinetic parameters, structure, catalyst conformations, and internal channelling systems. The close phylogenetic relationship between the enzymes from Methanococcales and many Bacteria corroborates this similarity. Indeed, Methanococcales HCPs are closer to these bacterial homologues than to any other archaeal enzymes. The relatively high constitutive production of HCP in M. thermolithotrophicus, in the absence of a notable nitric oxide source, questions the physiological function of the enzyme in these ancient anaerobes.

5.
Plant Physiol ; 193(1): 271-290, 2023 08 31.
Artigo em Inglês | MEDLINE | ID: mdl-37177985

RESUMO

Viral RNAs can be uridylated in eukaryotic hosts. However, our knowledge of uridylation patterns and roles remains rudimentary for phytoviruses. Here, we report global 3' terminal RNA uridylation profiles for representatives of the main families of positive single-stranded RNA phytoviruses. We detected uridylation in all 47 viral RNAs investigated here, revealing its prevalence. Yet, uridylation levels of viral RNAs varied from 0.2% to 90%. Unexpectedly, most poly(A) tails of grapevine fanleaf virus (GFLV) RNAs, including encapsidated tails, were strictly monouridylated, which corresponds to an unidentified type of viral genomic RNA extremity. This monouridylation appears beneficial for GFLV because it became dominant when plants were infected with nonuridylated GFLV transcripts. We found that GFLV RNA monouridylation is independent of the known terminal uridylyltransferases (TUTases) HEN1 SUPPRESSOR 1 (HESO1) and UTP:RNA URIDYLYLTRANSFERASE 1 (URT1) in Arabidopsis (Arabidopsis thaliana). By contrast, both TUTases can uridylate other viral RNAs like turnip crinkle virus (TCV) and turnip mosaic virus (TuMV) RNAs. Interestingly, TCV and TuMV degradation intermediates were differentially uridylated by HESO1 and URT1. Although the lack of both TUTases did not prevent viral infection, we detected degradation intermediates of TCV RNA at higher levels in an Arabidopsis heso1 urt1 mutant, suggesting that uridylation participates in clearing viral RNA. Collectively, our work unveils an extreme diversity of uridylation patterns across phytoviruses and constitutes a valuable resource to further decipher pro- and antiviral roles of uridylation.


Assuntos
Proteínas de Arabidopsis , Arabidopsis , Arabidopsis/genética , Arabidopsis/metabolismo , Proteínas de Arabidopsis/metabolismo , Uridina/metabolismo , RNA Mensageiro/metabolismo , RNA Viral/genética , RNA Viral/metabolismo , RNA Nucleotidiltransferases/metabolismo
6.
Viruses ; 14(10)2022 10 20.
Artigo em Inglês | MEDLINE | ID: mdl-36298857

RESUMO

Fanleaf degeneration is a complex viral disease of Vitis spp. that detrimentally impacts fruit yield and reduces the productive lifespan of most vineyards worldwide. In France, its main causal agent is grapevine fanleaf virus (GFLV). In the past, field experiments were conducted to explore cross-protection as a management strategy of fanleaf degeneration, but results were unsatisfactory because the mild virus strain negatively impacted fruit yield. In order to select new mild GFLV isolates, we examined two old 'Chardonnay' parcels harbouring vines with distinct phenotypes. Symptoms and agronomic performances were monitored over the four-year study on 21 individual vines that were classified into three categories: asymptomatic GFLV-free vines, GFLV-infected vines severely diseased and GFLV-infected vines displaying mild symptoms. The complete coding genomic sequences of GFLV isolates in infected vines was determined by high-throughput sequencing. Most grapevines were infected with multiple genetically divergent variants. While no specific molecular features were apparent for GFLV isolates from vines displaying mild symptoms, a genetic differentiation of GFLV populations depending on the vineyard parcel was observed. The mild symptomatic grapevines identified during this study were established in a greenhouse to recover GFLV variants of potential interest for cross-protection studies.


Assuntos
Nepovirus , Doenças das Plantas , Fazendas , Filogenia , Nepovirus/genética
7.
Molecules ; 27(10)2022 May 10.
Artigo em Inglês | MEDLINE | ID: mdl-35630529

RESUMO

The grapevine fanleaf virus (GFLV), responsible for fanleaf degeneration, is spread in vineyards by the soil nematode Xiphinema index. Nematicide molecules were used to limit the spread of the disease until they were banned due to negative environmental impacts. Therefore, there is a growing interest in alternative methods, including plant-derived products with antagonistic effects to X. index. In this work, we evaluated the nematicidal potential of the aerial parts and roots of four Fabaceae: sainfoin (Onobrychis viciifolia), birdsfoot trefoil (Lotus corniculatus), sweet clover (Melilotus albus), and red clover (Trifolium pratense), as well as that of sainfoin-based commercial pellets. For all tested plants, either aerial or root parts, or both of them, exhibited a nematicidal effect on X. index in vitro, pellets being as effective as freshly harvested plants. Comparative metabolomic analyses did not reveal molecules or molecule families specifically associated with antagonistic properties toward X. index, suggesting that the nematicidal effect is the result of a combination of different molecules rather than associated with a single compound. Finally, scanning electron microscope observations did not reveal the visible impact of O. viciifolia extract on X. index cuticle, suggesting that alteration of the cuticle may not be the primary cause of their nematicidal effect.


Assuntos
Lotus , Nematoides , Animais , Antinematódeos/farmacologia , Humanos , Doenças das Plantas , Solo
8.
Biochemistry ; 61(10): 805-821, 2022 05 17.
Artigo em Inglês | MEDLINE | ID: mdl-35500274

RESUMO

Microbial anaerobic oxidation of alkanes intrigues the scientific community by way of its impact on the global carbon cycle, and its biotechnological applications. Archaea are proposed to degrade short- and long-chain alkanes to CO2 by reversing methanogenesis, a theoretically reversible process. The pathway would start with alkane activation, an endergonic step catalyzed by methyl-coenzyme M reductase (MCR) homologues that would generate alkyl-thiols carried by coenzyme M. While the methane-generating MCR found in methanogens has been well characterized, the enzymatic activity of the putative alkane-fixing counterparts has not been validated so far. Such an absence of biochemical investigations contrasts with the current explosion of metagenomics data, which draws new potential alkane-oxidizing pathways in various archaeal phyla. Therefore, validating the physiological function of these putative alkane-fixing machines and investigating how their structures, catalytic mechanisms, and cofactors vary depending on the targeted alkane have become urgent needs. The first structural insights into the methane- and ethane-capturing MCRs highlighted unsuspected differences and proposed some explanations for their substrate specificity. This Perspective reviews the current physiological, biochemical, and structural knowledge of alkyl-CoM reductases and offers fresh ideas about the expected mechanistic and chemical differences among members of this broad family. We conclude with the challenges of the investigation of these particular enzymes, which might one day generate biofuels for our modern society.


Assuntos
Alcanos , Archaea , Alcanos/metabolismo , Anaerobiose , Archaea/química , Catálise , Mesna/metabolismo , Metano/metabolismo , Oxirredução , Oxirredutases/metabolismo , Filogenia
9.
Biomolecules ; 11(11)2021 11 11.
Artigo em Inglês | MEDLINE | ID: mdl-34827677

RESUMO

Ketol-acid reductoisomerase (KARI) orchestrates the biosynthesis of branched-chain amino acids, an elementary reaction in prototrophic organisms as well as a valuable process in biotechnology. Bacterial KARIs belonging to class I organise as dimers or dodecamers and were intensively studied to understand their remarkable specificity towards NADH or NADPH, but also to develop antibiotics. Here, we present the first structural study on a KARI natively isolated from a methanogenic archaea. The dodecameric structure of 0.44-MDa was obtained in two different conformations, an open and close state refined to a resolution of 2.2-Å and 2.1-Å, respectively. These structures illustrate the conformational movement required for substrate and coenzyme binding. While the close state presents the complete NADP bound in front of a partially occupied Mg2+-site, the Mg2+-free open state contains a tartrate at the nicotinamide location and a bound NADP with the adenine-nicotinamide protruding out of the active site. Structural comparisons show a very high conservation of the active site environment and detailed analyses point towards few specific residues required for the dodecamerisation. These residues are not conserved in other dodecameric KARIs that stabilise their trimeric interface differently, suggesting that dodecamerisation, the cellular role of which is still unknown, might have occurred several times in the evolution of KARIs.


Assuntos
Cetol-Ácido Redutoisomerase , Domínio Catalítico , Coenzimas , NADP
10.
Viruses ; 13(11)2021 10 22.
Artigo em Inglês | MEDLINE | ID: mdl-34834945

RESUMO

Virus infection of plants can result in various degrees of detrimental impacts and disparate symptom types and severities. Although great strides have been made in our understanding of the virus-host interactions in herbaceous model plants, the mechanisms underlying symptom development are poorly understood in perennial fruit crops. Grapevine fanleaf virus (GFLV) causes variable symptoms in most vineyards worldwide. To better understand GFLV-grapevine interactions in relation to symptom development, field and greenhouse trials were conducted with a grapevine genotype that exhibits distinct symptoms in response to a severe and a mild strain of GFLV. After validation of the infection status of the experimental vines by high-throughput sequencing, the transcriptomic and metabolomic profiles in plants infected with the two viral strains were tested and compared by RNA-Seq and LC-MS, respectively, in the differentiating grapevine genotype. In vines infected with the severe GFLV strain, 1023 genes, among which some are implicated in the regulation of the hypersensitive-type response, were specifically deregulated, and a higher accumulation of resveratrol and phytohormones was observed. Interestingly, some experimental vines restricted the virus to the rootstock and remained symptomless. Our results suggest that GFLV induces a strain- and cultivar-specific defense reaction similar to a hypersensitive reaction. This type of defense leads to a severe stunting phenotype in some grapevines, whereas others are resistant. This work is the first evidence of a hypersensitive-like reaction in grapevine during virus infection.


Assuntos
Frutas/virologia , Nepovirus , Doenças das Plantas/virologia , Genótipo , Transtornos do Crescimento , Sequenciamento de Nucleotídeos em Larga Escala , Nepovirus/genética , Filogenia , Secoviridae , Nicotiana/virologia , Transcriptoma , Vitis/virologia
11.
Eur J Plant Pathol ; 161(3): 735-742, 2021.
Artigo em Inglês | MEDLINE | ID: mdl-34465944

RESUMO

Since its identification in 2003, grapevine Pinot gris virus (GPGV, Trichovirus) has now been detected in most grape-growing countries. So far, little is known about the epidemiology of this newly emerging virus. In this work, we used datamining as a tool to monitor in-silico the sanitary status of three vineyards in Italy. All data used in the study were recovered from a work that was already published and for which data were publicly available as SRA (Sequence Read Archive, NCBI) files. While incomplete, knowledge gathered from this work was still important, with evidence of differential accumulation of the virus in grapevine according to year, location, and variety-rootstock association. Additional data regarding GPGV genetic diversity were collected. Some advantages and pitfalls of datamining are discussed.

12.
Plant Dis ; 2021 Aug 22.
Artigo em Inglês | MEDLINE | ID: mdl-34420360

RESUMO

Grapevine enamovirus 1 (GEV-1) is a member of the genus Enamovirus in the family Solemoviridae. GEV-1 was first described in 2017 in a few grapevine cultivars in Brazil (Silva et al. 2017) and subsequently in China (Ren et al. 2021). We first identified GEV-1 using high throughput sequencing (Illumina, NOVASeq SP, TruSeq mRNA stranded 2*150 bp) of ribosomal RNA depleted total RNAs extracts using RNeasy Plant mini kit) (Qiagen) from a Vitis vinifera 'Meunier' leaf sample collected in a more than 20 year old commercial vineyard in the Champagne region of France in 2019. Analyses of the 47,573,330 total reads were performed using CLC Genomics Workbench 12.0 software (Qiagen) as previously described (Hily et al. 2018). The GEV-1 genome, determined only from the HTS data (isolate GEV-1-Fr; GenBank accession No. MW760844), is 6 262 nucleotides (nt) long and fully covered with 5,706 reads (mapping parameters of 0,5 in length and 0,7 in similarity fractions using CLC). Compared with the previously determined sequences (NC_034836 and KX645875) from Brazil, the GEV-1-Fr sequence contain a few indels, including a deletion of 9 nt in the 5' untranslated region (UTR), an insertion of 3 nt located in the overlapping region of the open reading frame (ORF)1 and ORF2, and a single nt insertion in the non-coding region between ORF2 and ORF3. These indels also exist within the sequence of isolate SD-CG from China (MT536978). However, GEV-1-Fr contains a unique 45 nt insertion in the 3'-UTR, although this needs to be verified using standard assays. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity at the nt level with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. The GEV-1-infected 'Meunier' grapevine showed symptoms of light chlorotic patterns on the leaves that were probably due to the presence of other co-infecting viruses, including Grapevine fanleaf virus, Grapevine Pinot gris virus, Grapevine rupestris stem pitting-associated virus and Grapevine fleck virus. The detection of GEV-1 was further confirmed in the 'Meunier' grapevine via RT-PCR using newly designed primer pairs Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT and Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG that amplified a 474 bp fragment of ORF5. We also designed a TaqManTM assay in OFR5 with the following primers and probe; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG, Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC, Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original 'Meunier' plant from Champagne was positive for GEV-1. To our knowledge, this is the first report of GEV-1 in France and in European vineyards in general. Although many aspects of the virus biology are yet to be elucidated, our results expand its geographical range. New GEV-1 detection primers can be developed, considering its genetic diversity, to facilitate its detection and further define its evolutionary history. Compared to the original sequences (NC_034836 and KX645875) in Brazil a few indels have been identified, including a deletion of 9nt located in the 5' untranslated region (UTR), an insertion of 3nt located in the overlapping region of the open reading frame (ORF)1 and ORF2 and a single nucleotide insertion in the non-coding region between ORF2 and ORF3. All indels were already described in the Chinese sequence (MT536978). However, this new GEV-1-Fr isolate is the only one that displays a 45nt insertion in the 3'-UTR. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. No specific symptoms were observed in the GEV-1-infected 'Meunier' grapevine other than light chlorotic patterns on the leaves that were probably due to the presence of other virus, as this plant was co-infected with grapevine fanleaf virus (GFLV), grapevine Pinot gris virus (GPGV), grapevine rupestris stem pitting-associated virus (GRSPaV) and grapevine fleck virus (GFkV). The detection of GEV-1 was further confirmed via RT-PCR using newly designed primer pairs located in the 'aphid transmission protein' producing a 474 nt amplicon; Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT; Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG. GEV-1 was detected in all cuttings (N=15) obtained from the original plant. We also designed a tool for a TaqManTM-based detection in the same genome region as mentioned above; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG; Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC; Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original 'Meunier' plant from Champagne was found positive for GEV-1 in gapevine in France.

13.
Science ; 373(6550): 118-121, 2021 07 02.
Artigo em Inglês | MEDLINE | ID: mdl-34210888

RESUMO

Ethane, the second most abundant hydrocarbon gas in the seafloor, is efficiently oxidized by anaerobic archaea in syntrophy with sulfate-reducing bacteria. Here, we report the 0.99-angstrom-resolution structure of the proposed ethane-activating enzyme and describe the specific traits that distinguish it from methane-generating and -consuming methyl-coenzyme M reductases. The widened catalytic chamber, harboring a dimethylated nickel-containing F430 cofactor, would adapt the chemistry of methyl-coenzyme M reductases for a two-carbon substrate. A sulfur from methionine replaces the oxygen from a canonical glutamine as the nickel lower-axial ligand, a feature conserved in thermophilic ethanotrophs. Specific loop extensions, a four-helix bundle dilatation, and posttranslational methylations result in the formation of a 33-angstrom-long hydrophobic tunnel, which guides the ethane to the buried active site as confirmed with xenon pressurization experiments.


Assuntos
Proteínas Arqueais/química , Etano/química , Methanosarcinales/enzimologia , Oxirredutases/química , Cristalografia por Raios X , Ativação Enzimática , Sequências Hélice-Alça-Hélice , Metilação , Processamento de Proteína Pós-Traducional
14.
Commun Biol ; 4(1): 637, 2021 05 28.
Artigo em Inglês | MEDLINE | ID: mdl-34050254

RESUMO

Grapevine fanleaf disease, caused by grapevine fanleaf virus (GFLV), transmitted by the soil-borne nematode Xiphinema index, provokes severe symptoms and economic losses, threatening vineyards worldwide. As no effective solution exists so far to control grapevine fanleaf disease in an environmentally friendly way, we investigated the presence of resistance to GFLV in grapevine genetic resources. We discovered that the Riesling variety displays resistance to GFLV, although it is susceptible to X. index. This resistance is determined by a single recessive factor located on grapevine chromosome 1, which we have named rgflv1. The discovery of rgflv1 paves the way for the first effective and environmentally friendly solution to control grapevine fanleaf disease through the development of new GFLV-resistant grapevine rootstocks, which was hitherto an unthinkable prospect. Moreover, rgflv1 is putatively distinct from the virus susceptibility factors already described in plants.


Assuntos
Resistência à Doença/genética , Nepovirus/patogenicidade , Vitis/genética , Agricultura/métodos , Animais , Genótipo , Nematoides/virologia , Nepovirus/genética , Melhoramento Vegetal/métodos , Doenças das Plantas/genética , Doenças das Plantas/virologia , Vitis/metabolismo , Vitis/microbiologia
15.
Biochim Biophys Acta Bioenerg ; 1862(1): 148330, 2021 01 01.
Artigo em Inglês | MEDLINE | ID: mdl-33080205

RESUMO

Clostridium autoethanogenum, the bacterial model for biological conversion of waste gases into biofuels, grows under extreme carbon-monoxide (CO) concentrations. The strictly anaerobic bacterium derives its entire cellular energy and carbon from this poisonous gas, therefore requiring efficient molecular machineries for CO-conversion. Here, we structurally and biochemically characterized the key enzyme of the CO-converting metabolism: the CO-dehydrogenase/Acetyl-CoA synthase (CODH/ACS). We obtained crystal structures of natively isolated complexes from fructose-grown and CO-grown C. autoethanogenum cultures. Both contain the same isoforms and if the overall structure adopts the classic α2ß2 architecture, comparable to the model enzyme from Moorella thermoacetica, the ACS binds a different position on the CODH core. The structural characterization of a proteolyzed complex and the conservation of the binding interface in close homologs rejected the possibility of a crystallization artefact. Therefore, the internal CO-channeling system, critical to transfer CO generated at the C-cluster to the ACS active site, drastically differs in the complex from C. autoethanogenum. The 1.9-Å structure of the CODH alone provides an accurate picture of the new CO-routes, leading to the ACS core and reaching the surface. Increased gas accessibility would allow the simultaneous CO-oxidation and acetyl-CoA production. Biochemical experiments showed higher flexibility of the ACS subunit from C. autoethanogenum compared to M. thermoacetica, albeit monitoring similar CO-oxidation and formation rates. These results show a reshuffling of internal CO-tunnels during evolution of these Firmicutes, putatively leading to a bidirectional complex that ensure a high flux of CO-conversion toward energy conservation, acting as the main cellular powerplant.


Assuntos
Acetilcoenzima A/química , Aldeído Oxirredutases/química , Proteínas de Bactérias/química , Monóxido de Carbono/química , Clostridium/enzimologia , Complexos Multienzimáticos/química , Acetilcoenzima A/metabolismo , Aldeído Oxirredutases/metabolismo , Proteínas de Bactérias/metabolismo , Monóxido de Carbono/metabolismo , Cristalografia por Raios X , Moorella/enzimologia , Complexos Multienzimáticos/metabolismo , Oxirredução , Estrutura Quaternária de Proteína
16.
Proc Natl Acad Sci U S A ; 117(20): 10848-10855, 2020 05 19.
Artigo em Inglês | MEDLINE | ID: mdl-32371486

RESUMO

Grapevine fanleaf virus (GFLV) is a picorna-like plant virus transmitted by nematodes that affects vineyards worldwide. Nanobody (Nb)-mediated resistance against GFLV has been created recently, and shown to be highly effective in plants, including grapevine, but the underlying mechanism is unknown. Here we present the high-resolution cryo electron microscopy structure of the GFLV-Nb23 complex, which provides the basis for molecular recognition by the Nb. The structure reveals a composite binding site bridging over three domains of one capsid protein (CP) monomer. The structure provides a precise mapping of the Nb23 epitope on the GFLV capsid in which the antigen loop is accommodated through an induced-fit mechanism. Moreover, we uncover and characterize several resistance-breaking GFLV isolates with amino acids mapping within this epitope, including C-terminal extensions of the CP, which would sterically interfere with Nb binding. Escape variants with such extended CP fail to be transmitted by nematodes linking Nb-mediated resistance to vector transmission. Together, these data provide insights into the molecular mechanism of Nb23-mediated recognition of GFLV and of virus resistance loss.


Assuntos
Nepovirus/efeitos dos fármacos , Doenças das Plantas/imunologia , Anticorpos de Cadeia Única/química , Anticorpos de Cadeia Única/farmacologia , Animais , Anticorpos Antivirais/imunologia , Capsídeo/química , Proteínas do Capsídeo/química , Proteínas do Capsídeo/efeitos dos fármacos , Microscopia Crioeletrônica , Epitopos/química , Modelos Moleculares , Nematoides/virologia , Nepovirus/ultraestrutura , Doenças das Plantas/virologia , Folhas de Planta/virologia , Vírus de Plantas/imunologia , Vírus de Plantas/fisiologia , Conformação Proteica , Vitis
17.
Front Microbiol ; 11: 486, 2020.
Artigo em Inglês | MEDLINE | ID: mdl-32318032

RESUMO

Domestication of CO2-fixation became a worldwide priority enhanced by the will to convert this greenhouse gas into fuels and valuable chemicals. Because of its high stability, CO2-activation/fixation represents a true challenge for chemists. Autotrophic microbial communities, however, perform these reactions under standard temperature and pressure. Recent discoveries shine light on autotrophic acetogenic bacteria and hydrogenotrophic methanogens, as these anaerobes use a particularly efficient CO2-capture system to fulfill their carbon and energy needs. While other autotrophs assimilate CO2 via carboxylation followed by a reduction, acetogens and methanogens do the opposite. They first generate formate and CO by CO2-reduction, which are subsequently fixed to funnel the carbon toward their central metabolism. Yet their CO2-reduction pathways, with acetate or methane as end-products, constrain them to thrive at the "thermodynamic limits of Life". Despite this energy restriction acetogens and methanogens are growing at unexpected fast rates. To overcome the thermodynamic barrier of CO2-reduction they apply different ingenious chemical tricks such as the use of flavin-based electron-bifurcation or coupled reactions. This mini-review summarizes the current knowledge gathered on the CO2-fixation strategies among acetogens. While extensive biochemical characterization of the acetogenic formate-generating machineries has been done, there is no structural data available. Based on their shared mechanistic similarities, we apply the structural information obtained from hydrogenotrophic methanogens to highlight common features, as well as the specific differences of their CO2-fixation systems. We discuss the consequences of their CO2-reduction strategies on the evolution of Life, their wide distribution and their impact in biotechnological applications.

18.
FEMS Microbiol Rev ; 44(2): 155-170, 2020 03 01.
Artigo em Inglês | MEDLINE | ID: mdl-31922549

RESUMO

The Gram-negative Shewanella bacterial genus currently includes about 70 species of mostly aquatic γ--proteobacteria, which were isolated around the globe in a multitude of environments such as surface freshwater and the deepest marine trenches. Their survival in such a wide range of ecological niches is due to their impressive physiological and respiratory versatility. Some strains are among the organisms with the highest number of respiratory systems, depending on a complex and rich metabolic network. Implicated in the recycling of organic and inorganic matter, they are important components of organism-rich oxic/anoxic interfaces, but they also belong to the microflora of a broad group of eukaryotes from metazoans to green algae. Examples of long-term biological interactions like mutualism or pathogeny have been described, although molecular determinants of such symbioses are still poorly understood. Some of these bacteria are key organisms for various biotechnological applications, especially the bioremediation of hydrocarbons and metallic pollutants. The natural ability of these prokaryotes to thrive and detoxify deleterious compounds explains their use in wastewater treatment, their use in energy generation by microbial fuel cells and their importance for resilience of aquatic ecosystems.


Assuntos
Ecossistema , Shewanella/classificação , Shewanella/fisiologia , Organismos Aquáticos/fisiologia , Microbiologia Ambiental , Microbiologia Industrial , Simbiose
19.
Viruses ; 11(12)2019 12 10.
Artigo em Inglês | MEDLINE | ID: mdl-31835488

RESUMO

Grapevine fanleaf virus (GFLV) is responsible for a widespread disease in vineyards worldwide. Its genome is composed of two single-stranded positive-sense RNAs, which both show a high genetic diversity. The virus is transmitted from grapevine to grapevine by the ectoparasitic nematode Xiphinema index. Grapevines in diseased vineyards are often infected by multiple genetic variants of GFLV but no information is available on the molecular composition of virus variants retained in X. index following nematodes feeding on roots. In this work, aviruliferous X. index were fed on three naturally GFLV-infected grapevines for which the virome was characterized by RNAseq. Six RNA-1 and four RNA-2 molecules were assembled segregating into four and three distinct phylogenetic clades of RNA-1 and RNA-2, respectively. After 19 months of rearing, single and pools of 30 X. index tested positive for GFLV. Additionally, either pooled or single X. index carried multiple variants of the two GFLV genomic RNAs. However, the full viral genetic diversity found in the leaves of infected grapevines was not detected in viruliferous nematodes, indicating a genetic bottleneck. Our results provide new insights into the complexity of GFLV populations and the putative role of X. index as reservoirs of virus diversity.


Assuntos
Vetores de Doenças , Variação Genética , Nematoides/virologia , Nepovirus/genética , Vitis/parasitologia , Vitis/virologia , Animais , Biologia Computacional/métodos , Sequenciamento de Nucleotídeos em Larga Escala , Filogenia , Doenças das Plantas/virologia , RNA Viral
20.
Viruses ; 11(12)2019 12 11.
Artigo em Inglês | MEDLINE | ID: mdl-31835698

RESUMO

Grapevine fanleaf virus (GFLV) and arabis mosaic virus (ArMV) are nepoviruses responsible for grapevine degeneration. They are specifically transmitted from grapevine to grapevine by two distinct ectoparasitic dagger nematodes of the genus Xiphinema. GFLV and ArMV move from cell to cell as virions through tubules formed into plasmodesmata by the self-assembly of the viral movement protein. Five surface-exposed regions in the coat protein called R1 to R5, which differ between the two viruses, were previously defined and exchanged to test their involvement in virus transmission, leading to the identification of region R2 as a transmission determinant. Region R4 (amino acids 258 to 264) could not be tested in transmission due to its requirement for plant systemic infection. Here, we present a fine-tuning mutagenesis of the GFLV coat protein in and around region R4 that restored the virus movement and allowed its evaluation in transmission. We show that residues T258, M260, D261, and R301 play a crucial role in virus transmission, thus representing a new viral determinant of nematode transmission.


Assuntos
Vetores de Doenças , Nematoides/virologia , Nepovirus/classificação , Nepovirus/fisiologia , Doenças das Plantas/parasitologia , Doenças das Plantas/virologia , Sequência de Aminoácidos , Animais , Genes Reporter , Modelos Moleculares , Nepovirus/ultraestrutura , Conformação Proteica , RNA Viral , Recombinação Genética , Relação Estrutura-Atividade , Proteínas Virais/química , Proteínas Virais/genética
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA