RESUMO

Among phytosanitary problems of the grapevine, viruses stand out for their capacity of reducing the quality and yield of grapes. However, detecting and identifying viral infections in grapevines can be challenging. This study performed a high throughput sequencing (HTS) of the viral pathogens present in a vine showing virus-like symptoms to elucidate the etiology. HTS analysis reported in a hybrid grapevine with mild curling down of leaf edges, the presence of four viruses and viroids, which were probably implicated in the observed symptoms. The determined complete genomes showed high genetic identities with previously characterized isolates of homologous pathogens.

Dentre os problemas fitossanitários da videira, os vírus se destacam pela capacidade de reduzir a qualidade e o rendimento da uva. No entanto, detectar e identificar infecções virais em videiras pode ser um desafio. O objetivo do estudo foi realizar um sequenciamento de alto rendimento (HTS) para determinar os patógenos virais presentes em uma videira com sintomas de virose e elucidar a etiologia. Com o HTS foi detectada, em uma videira híbrida com leve enrolamento dos bordos foliares, a presença de quatro vírus e viroides, os quais provavelmente estavam implicados com os sintomas observados. Os genomas completos determinados mostraram altas identidades genéticas com isolados previamente caracterizados de patógenos homólogos.

Assuntos

RESUMO

Since 1948, pale yellow wheat spike have been reported in southern Brazil. This symptom was associated with tenuiviruses due to the observation of cytoplasmic inclusions constituted by a mass of filamentous particles (7-10 nm in diameter) with indeterminate length, identical to those found in "leaf dip" preparations. Such symptoms are still seen in wheat crops; however, there is a lack of information regarding this pathosystem. Decades after the first report, the first sequences of wheat white spike virus were characterized. Wheat plants with symptoms such as pale yellowing, chlorotic streaks, and leaf mosaic were collected in Paraná State, Southern Brazil. High-throughput sequencing was used to determine the nearly complete nucleotide sequence of the viral genome. The genome is composed of five RNAs with a total size of 18,129 nucleotides, with eight open reading frames (ORFs). The virus identified in this study can be included in a new species in the family Phenuiviridae, genus Tenuivirus, and we have tentatively named this virus "wheat white spike virus".

Assuntos

RESUMO

Rice (Oryza sativa L.) is an important food crop for humanity, being cultivated in tropical and temperate regions of the world. This study reports the nearly complete genome sequences of four Brazilian rice stripe necrosis virus (RSNV) isolates. The nucleotide sequences of the RNA1 and RNA2 genome segments of these Brazilian isolates were 96.5 to 99.9% identical, indicating their close phylogenetic relationship to each other. Phylogeny and recombination analysis indicated that the genome of one of the isolates consisted of RNA segments of different origins, suggesting that a reassortment event had occurred.

Assuntos

RESUMO

ABSTRACT: Physalis rugose mosaic virus (PhyRMV) causes severe damage to Physalis peruviana L., affecting vegetative parameters, fruit quantity and quality. The aim of this study was to perform a molecular characterization of PhyRMV associated with P. peruviana from commercial fields in the municipality of Lages, Santa Catarina State, Southern Brazil, and to evaluate its transmission by seeds. Plants displaying mosaic, dwarfism, and leaf malformation symptoms were collected from P. peruviana. Double-stranded RNA was extracted and submitted to cDNA library synthesis and high-throughput sequencing (HTS). For the virus transmission assay, seeds from PhyRMV-infected plants were used, and viral infection in seedlings was verified using symptomatic and molecular diagnosis. PhyRMV RNA has 4162 nucleotides (nts) and a genomic organization similar to that of other sobemoviruses and shares 97% nt identity with the previously characterized PhyRMV Piracicaba isolate. Results indicated the unlikely transmission of PhyRMV by physalis seeds.

RESUMO: Physalis rugose mosaic virus (PhyRMV) causa danos severos em Physalis peruviana L., afetando características vegetativas, a quantidade e qualidade de frutos. Os objetivos desse estudo consistem na caracterização molecular do PhyRMV associado a P. peruviana coletada em campos de produção em Lages, Santa Catarina, Brasil; e avaliar a transmissão do vírus por sementes. Plantas apresentando sintomas de mosaico, deformação e nanismo foram coletadas de P. peruviana. Amostras foliares dessas plantas foram utilizadas para extração de RNA de fita dupla, síntese de biblioteca de cDNA e sequenciamento de alto rendimento. No experimento de transmissão, sementes obtidas de plantas infectadas por PhyRMV foram utilizadas, e a infecção viral nas plântulas foi avaliada por inspeção visual de sintomas e diagnóstico molecular. O RNA viral apresentou 4162 nucleotideos (nts), a organização genômica foi similar à de outros sobemovírus e apresentou 97% de identidade de nucleotídeos com o isolado de Piracicaba de PhyRMV previamente caracterizado. Os resultados obtidos sugerem que é improvável a transmissão de PhyRMV por sementes de physalis.

RESUMO

Grapevines can host up to 86 virus species, some of which affect plant vigor, production and fruit quality (Fuchs, 2020). In 2014, a Vitis vinifera cv. Semillon vine showing yellow speckles and mild leafroll symptoms in Bento Gonçalves, RS, Brazil, was investigated for viruses (Silva et al., 2017), resulting in the detection of grapevine enamovirus 1, grapevine yellow speckle viroid 1 and hop stunt viroid. Total nucleic acids (TNA) extracts from this sample were enriched for dsRNA (Valverde et al., 1990), prepped with TruSeq Stranded mRNA kit (Illumina, USA), then subjected to high throughput sequencing (HTS) on the Illumina HiSeq 2000 platform. The HTS yielded 13,214 Mbp raw reads, which were trimmed and the host derived sequences subtracted with Trimmomatic and Burrows-Wheeler Aligner softwares, respectively. The remaining reads were subjected to taxonomic assignment with the Kaiju webserver, preliminarily indicating 26 reads related to citrus virga-like virus (Matsumura et al., 2017). De novo assembled contigs built by SPAdes generated five contigs that were subjected to tBLASTx searches against the NCBI viral RefSeq. Four sets of primers were designed to sequence the gaps between these contigs and the PCR amplicons were sequenced by Sanger method resulting in two long contigs. A third long contig related to citrus jingmen-like virus (Matsumura et al., 2017) was also retained for further analysis. BLASTn analyses of the assembled virus contigs showed that they are closely related to grapevine associated jivivirus 1 (GaJV-1) (Chiapello et al, 2020). The derived partial tripartite genomic sequences of GaJV-1 isolate SEM-BR from Brazil (GenBank acc. nos. MT657278-MT657280) covered 84.4% (3424 nt), 40.3% (1289 nt) and 73% (1555 nt) of RNAs 1, 2 and 3 of isolate DMG 109 from Italy (MN520745-MN520747), respectively. The pairwise nt sequence identities between both isolates were 99.3% (RNA1), 97.1% (RNA2) and 100% (RNA3), indicating that they are highly identical to each other. To confirm the HTS results, fresh TNA extracts from SEM-BR and four newly sampled vines were screened by RT-PCR using specific primers F (5'GGACGAAGTCACAACCAACACAGTTT3') and R (5'CGCGAGTAGGTCTGACAACTTTCATTAT3'), designed based on GaJV-1 RNA1. The resulting 478 bp amplicons were sequenced (MT657281-MT657285) and found to share 99.4%-99.8% nt identities with the corresponding sequences of GaJV-1 SEM-BR (MT657278). To assess graft-transmissibility of GaJV-1, Semillon scions of SEM-BR source vine were grafted onto 14 GaJV-1-free 1103P rootstocks. Six of 14 recipient plants (all asymptomatic) tested positive for GaJV-1 by RT-PCR 106 days after grafting. Additionally, RT-PCR screening of a Brazilian grapevine collection block resulted in the detection of GaJV-1 in nine of 33 tested vines of different accessions (27.3%). The GaJV-1 positive vines included eight commercial cultivars (Ancelotta, Aragonez, Merlot, Semillon, Michele Palieri, Malvasia, Viognier, and Pinot Nero). This is the first report of GaJV-1 in Brazil, a virus that was recently described in Italy and Spain (Chiapello et al, 2020). Our results also demonstrated the graft-transmissible nature of the virus but it is unclear if GaJV-1 is associated to grapevine plant cells or strictly to a possible grapevine fungal endophyte. Additional studies on the GaJV-1 prevalence in commercial vineyards in Brazil and possible effects of the virus on grapevines are necessary. References: Chiapello, M., et al. 2020. Annals of Applied Biology 176:180. https://doi.org/10.1111/aab.12563 Fuchs, M. 2020. J. Plant Pathol. https://doi.org/10.1007/s42161-020-00579-2 Matsumura, E.E., et al. 2017. Viruses 9:92. https://doi.org/10.3390/v9040092 Silva, J.M.F., et al. 2017. Virus Genes 53:667. https://doi.org/10.1007/s11262-017-1470-y Valverde, R.A., et al. 1990. Plant Dis. 74:255. https://www.apsnet.org/publications/plantdisease/backissues/Documents/1990Articles/PlantDisease74n03_255.PDF.

RESUMO

The aims of this study were to determine the prevalence of viruses in 119 samples from 32 grapevine cultivars, collected from nine vineyards in a specific grape-growing area in southeastern Brazil, perform a partial molecular characterization of 14 isolates of Grapevine Syrah virus 1 (GSyV-1) and Grapevine leafroll-associated virus 3 (GLRaV-3) and assess the coat protein genetic variability of these viruses. The detection of viruses was implemented by real-time RT-PCR (reverse transcription polymerase chain reaction) aiming to detect seven viruses and one viroid. With the exception of the Grapevine Cabernet Sauvignon reovirus (GCSV), the viruses and viroid that were evaluated were widespread in the sampled areas, often in high prevalence and multiple infections, ranging from 15 % up to 76 %. Eight isolates of GSyV-1 and six of GLRaV-3, partially characterized by complete coat protein gene nucleotide sequencing and a variability study showed nucleotide identities ranging from 91 % to 99 % (GSyV-1) and from 98 % to 100 % (GLRaV-3) among themselves, respectively. Comparisons between conventional and real-time RT-PCR detections were implemented for GSyV-1 and GLRaV-3 infections. Analysis of genetic variability indicated molecular differences between GSyV-1 and GLRaV-3 isolates and negative selection acting on the coat protein gene of both viruses. This is the first report of GSyV-1 in commercial vineyards in Brazil. The survey revealed widespread infections of seven important pathogens in one prominent Brazilian grape-producing region implying contaminated grapevine cuttings in the spread of disease.(AU)

Assuntos

RESUMO

The aims of this study were to determine the prevalence of viruses in 119 samples from 32 grapevine cultivars, collected from nine vineyards in a specific grape-growing area in southeastern Brazil, perform a partial molecular characterization of 14 isolates of Grapevine Syrah virus 1 (GSyV-1) and Grapevine leafroll-associated virus 3 (GLRaV-3) and assess the coat protein genetic variability of these viruses. The detection of viruses was implemented by real-time RT-PCR (reverse transcription polymerase chain reaction) aiming to detect seven viruses and one viroid. With the exception of the Grapevine Cabernet Sauvignon reovirus (GCSV), the viruses and viroid that were evaluated were widespread in the sampled areas, often in high prevalence and multiple infections, ranging from 15 % up to 76 %. Eight isolates of GSyV-1 and six of GLRaV-3, partially characterized by complete coat protein gene nucleotide sequencing and a variability study showed nucleotide identities ranging from 91 % to 99 % (GSyV-1) and from 98 % to 100 % (GLRaV-3) among themselves, respectively. Comparisons between conventional and real-time RT-PCR detections were implemented for GSyV-1 and GLRaV-3 infections. Analysis of genetic variability indicated molecular differences between GSyV-1 and GLRaV-3 isolates and negative selection acting on the coat protein gene of both viruses. This is the first report of GSyV-1 in commercial vineyards in Brazil. The survey revealed widespread infections of seven important pathogens in one prominent Brazilian grape-producing region implying contaminated grapevine cuttings in the spread of disease.

Assuntos

RESUMO

Grapevine rupestris stem pitting-associated virus (GRSPaV) is one of the most common viruses of grapevine. It is involved in the graft-transmissible disease rupestris stem pitting of the rugose wood complex. The objective of the research was to perform the molecular characterization of the coat protein (CP) gene of sixteen Brazilian GRSPaV isolates aiming to determine the occurrence of molecular variants (strains) of this virus. Nine grapevine samples were evaluated, from which dsRNA was extracted. Nucleotide sequences were generated by Next generation sequencing (NGS). Fifteen complete sequences of the GRSPaV CP gene were obtained and phylogenetically analyzed. Multiple alignments of the sequences showed identities of nucleotides ranging from 82% to 99%, suggesting high variability among the CPs of Brazilian isolates. The study revealed that genetic variability of GRSPaV comprising three molecular variants is also present in Brazilian grapevine genotypes.(AU)

O GRSPaV é um dos vírus mais comuns da videira. Está associado à doença transmissível por enxertia denominada caneluras de rupestris que compõe o complexo do lenho rugoso. O objetivo do trabalho foi realizar a caracterização molecular do gene da proteína capsidial (CP) de 16 isolados brasileiros de GRSPaV visando determinar a ocorrência de variantes moleculares desse vírus. Nove amostras de videira foram avaliadas das quais foi extraído dsRNA. As sequências de nucleotídeos foram geradas pelo sequenciamento de nova geração (NGS). Quinze sequências completas do gene CP de GRSPaV foram obtidas e filogeneticamente analisadas. Os alinhamentos múltiplos entre as sequências mostraram identidades de nucleotídeos variando de 82% a 99%, sugerindo alta variabilidade entre as CPs de isolados brasileiros. O estudo revelou que a variabilidade genética de GRSPaV compreendendo três variantes moleculares também está presente nos genótipos de videira no Brasil.(AU)

Assuntos

RESUMO

ABSTRACT: Grapevine rupestris stem pitting-associated virus (GRSPaV) is one of the most common viruses of grapevine. It is involved in the graft-transmissible disease rupestris stem pitting of the rugose wood complex. The objective of the research was to perform the molecular characterization of the coat protein (CP) gene of sixteen Brazilian GRSPaV isolates aiming to determine the occurrence of molecular variants (strains) of this virus. Nine grapevine samples were evaluated, from which dsRNA was extracted. Nucleotide sequences were generated by Next generation sequencing (NGS). Fifteen complete sequences of the GRSPaV CP gene were obtained and phylogenetically analyzed. Multiple alignments of the sequences showed identities of nucleotides ranging from 82% to 99%, suggesting high variability among the CPs of Brazilian isolates. The study revealed that genetic variability of GRSPaV comprising three molecular variants is also present in Brazilian grapevine genotypes.

RESUMO: O GRSPaV é um dos vírus mais comuns da videira. Está associado à doença transmissível por enxertia denominada caneluras de rupestris que compõe o complexo do lenho rugoso. O objetivo do trabalho foi realizar a caracterização molecular do gene da proteína capsidial (CP) de 16 isolados brasileiros de GRSPaV visando determinar a ocorrência de variantes moleculares desse vírus. Nove amostras de videira foram avaliadas das quais foi extraído dsRNA. As sequências de nucleotídeos foram geradas pelo sequenciamento de nova geração (NGS). Quinze sequências completas do gene CP de GRSPaV foram obtidas e filogeneticamente analisadas. Os alinhamentos múltiplos entre as sequências mostraram identidades de nucleotídeos variando de 82% a 99%, sugerindo alta variabilidade entre as CPs de isolados brasileiros. O estudo revelou que a variabilidade genética de GRSPaV compreendendo três variantes moleculares também está presente nos genótipos de videira no Brasil.

RESUMO

In this study, we describe a novel putative Enamovirus member, Grapevine enamovirus-1 (GEV-1), discovered by high-throughput sequencing (HTS). A limited survey using HTS of 17 grapevines (Vitis spp.) from the south, southeast, and northeast regions of Brazil led to the detection of GEV-1 exclusively on southern plants, infecting four grapevine cultivars (Cabernet Sauvignon, Semillon, CG 90450, and Cabernet franc) with a remarkable identity of around 99% at the nucleotide level. This novel virus was only detected in multiple-virus infected plants exhibiting viral-like symptoms. GEV-1 was also detected on a cv. Malvasia Longa by RT-PCR. We performed graft-transmissibility assays on GEV-1. The organization, products, and cis-acting regulatory elements of GEV-1 genome are also discussed here. The near complete genome sequence of GEV-1 was obtained during the course of this study, lacking only part of the 3' untranslated terminal region. This is the first report of a virus in the family Luteoviridae infecting grapevines. Based on its genomic properties and phylogenetic analyses, GEV-1 should be classified as a new member of the genus Enamovirus.

Assuntos

RESUMO

The absolute quantification determines the absolute amount of a targeted nucleic acid expressed as a copy number or concentration. The knowledge of virus concentrations in commercial crops possesses high relevance to ensure a reliable diagnosis. The objective of this study was to perform an absolute quantification of five viruses in infected grapevines (Vitis spp.). Different known amounts of the standard sample (cloned viral cDNA or in vitro transcribed viral RNA) were quantified by TaqMan RT-qPCR. Based on these data, standard curves were generated plotting Ct values (threshold cycle) against the log of the standard sample amount. Infected grapevine samples were evaluated to determine virus titers, which were highly variable. This result may contribute to improve virus diagnosis by accurately quantifying virus titre variations in grapevines. (AU)

A quantificação absoluta determina a quantidade absoluta de um ácido nucleico alvo expressa como número de cópias ou concentração. O conhecimento das concentrações virais em culturas comerciais tem grande relevância para assegurar um diagnóstico confiável. O objetivo deste trabalho foi realizar uma quantificação absoluta de cinco vírus em videiras infectadas (Vitis spp.). Diferentes quantidades conhecidas da amostra padrão (cDNA viral clonado ou RNA viral transcrito in vitro) foram quantificadas por RT-qPCR TaqMan. A partir destes dados, curvas padrão foram geradas plotando-se os valores de Ct (ciclo limiar) contra o log da quantidade da amostra padrão. Amostras de videiras infectadas foram avaliadas visando-se determinar os títulos virais que foram bastante variáveis. Este resultado contribui para melhorar o diagnóstico viral ao quantificar com precisão variações no título viral em videiras. (AU)

Assuntos

RESUMO

The absolute quantification determines the absolute amount of a targeted nucleic acid expressed as a copy number or concentration. The knowledge of virus concentrations in commercial crops possesses high relevance to ensure a reliable diagnosis. The objective of this study was to perform an absolute quantification of five viruses in infected grapevines (Vitis spp.). Different known amounts of the standard sample (cloned viral cDNA or in vitro transcribed viral RNA) were quantified by TaqMan RT-qPCR. Based on these data, standard curves were generated plotting Ct values (threshold cycle) against the log of the standard sample amount. Infected grapevine samples were evaluated to determine virus titers, which were highly variable. This result may contribute to improve virus diagnosis by accurately quantifying virus titre variations in grapevines.

A quantificação absoluta determina a quantidade absoluta de um ácido nucleico alvo expressa como número de cópias ou concentração. O conhecimento das concentrações virais em culturas comerciais tem grande relevância para assegurar um diagnóstico confiável. O objetivo deste trabalho foi realizar uma quantificação absoluta de cinco vírus em videiras infectadas (Vitis spp.). Diferentes quantidades conhecidas da amostra padrão (cDNA viral clonado ou RNA viral transcrito in vitro) foram quantificadas por RT-qPCR TaqMan. A partir destes dados, curvas padrão foram geradas plotando-se os valores de Ct (ciclo limiar) contra o log da quantidade da amostra padrão. Amostras de videiras infectadas foram avaliadas visando-se determinar os títulos virais que foram bastante variáveis. Este resultado contribui para melhorar o diagnóstico viral ao quantificar com precisão variações no título viral em videiras.

Assuntos

RESUMO

ABSTRACT: The absolute quantification determines the absolute amount of a targeted nucleic acid expressed as a copy number or concentration. The knowledge of virus concentrations in commercial crops possesses high relevance to ensure a reliable diagnosis. The objective of this study was to perform an absolute quantification of five viruses in infected grapevines (Vitis spp.). Different known amounts of the standard sample (cloned viral cDNA or in vitro transcribed viral RNA) were quantified by TaqMan RT-qPCR. Based on these data, standard curves were generated plotting Ct values (threshold cycle) against the log of the standard sample amount. Infected grapevine samples were evaluated to determine virus titers, which were highly variable. This result may contribute to improve virus diagnosis by accurately quantifying virus titre variations in grapevines.

RESUMO: A quantificação absoluta determina a quantidade absoluta de um ácido nucleico alvo expressa como número de cópias ou concentração. O conhecimento das concentrações virais em culturas comerciais tem grande relevância para assegurar um diagnóstico confiável. O objetivo deste trabalho foi realizar uma quantificação absoluta de cinco vírus em videiras infectadas (Vitis spp.). Diferentes quantidades conhecidas da amostra padrão (cDNA viral clonado ou RNA viral transcrito in vitro) foram quantificadas por RT-qPCR TaqMan. A partir destes dados, curvas padrão foram geradas plotando-se os valores de Ct (ciclo limiar) contra o log da quantidade da amostra padrão. Amostras de videiras infectadas foram avaliadas visando-se determinar os títulos virais que foram bastante variáveis. Este resultado contribui para melhorar o diagnóstico viral ao quantificar com precisão variações no título viral em videiras.

RESUMO

There is no molecular characterization of Brazilian isolates of Prunus necrotic ringspot virus (PNRSV), except for those infecting peach. In this research, the causal agent of rose mosaic was determined and the movement (MP) and coat (CP) protein genes of a PNRSV isolate from rose were molecularly characterized for the first time in Brazil. The nucleotide and deduced amino acid sequences of MP and CP complete genes were aligned and compared with other isolates. Molecular analysis of the MP and CP nucleotide sequences of a Brazilian PNRSV isolate from rose and others from this same host showed highest identities of 96.7% and 98.6%, respectively, and Rose-Br isolate was classified in PV32 group.

Inexiste caracterização molecular de isolados brasileiros de Prunus necrotic ringspot virus (PNRSV), exceto aqueles de pessegueiros. Neste trabalho, o agente causal do mosaico da roseira foi determinado e os genes das proteínas de movimento (MP) e capsidial (CP) de um isolado de PNRSV de roseira foram molecularmente caracterizados pela primeira vez no Brasil. As sequências completas de nucleotídeos e de aminoácidos deduzidos da MP e da CP foram alinhadas e comparadas com outros isolados. Análises das sequências de nucleotídeos da MP e da CP do isolado brasileiro de PNRSV de roseira e outros isolados da mesma hospedeira revelaram altas identidades de 96,7% e 98,6%, respectivamente, sendo o isolado Rose-Br classificado no grupo PV32.

Assuntos

RESUMO

There is no molecular characterization of Brazilian isolates of Prunus necrotic ringspot virus (PNRSV), except for those infecting peach. In this research, the causal agent of rose mosaic was determined and the movement (MP) and coat (CP) protein genes of a PNRSV isolate from rose were molecularly characterized for the first time in Brazil. The nucleotide and deduced amino acid sequences of MP and CP complete genes were aligned and compared with other isolates. Molecular analysis of the MP and CP nucleotide sequences of a Brazilian PNRSV isolate from rose and others from this same host showed highest identities of 96.7% and 98.6%, respectively, and Rose-Br isolate was classified in PV32 group.(AU)

Inexiste caracterização molecular de isolados brasileiros de Prunus necrotic ringspot virus (PNRSV), exceto aqueles de pessegueiros. Neste trabalho, o agente causal do mosaico da roseira foi determinado e os genes das proteínas de movimento (MP) e capsidial (CP) de um isolado de PNRSV de roseira foram molecularmente caracterizados pela primeira vez no Brasil. As sequências completas de nucleotídeos e de aminoácidos deduzidos da MP e da CP foram alinhadas e comparadas com outros isolados. Análises das sequências de nucleotídeos da MP e da CP do isolado brasileiro de PNRSV de roseira e outros isolados da mesma hospedeira revelaram altas identidades de 96,7% e 98,6%, respectivamente, sendo o isolado Rose-Br classificado no grupo PV32.(AU)

Assuntos

RESUMO

Fruit trees of temperate and tropical climates are of great economical importance worldwide and several viruses have been reported affecting their productivity and longevity. Fruit trees of different Brazilian regions displaying virus-like symptoms were evaluated for infection by circular DNA viruses. Seventy-four fruit trees were sampled and a novel, highly divergent, monopartite circular ssDNA virus was cloned from apple, pear and grapevine trees. Forty-five complete viral genomes were sequenced, with a size of approx. 3.4 kb and organized into five ORFs. Deduced amino acid sequences showed identities in the range of 38% with unclassified circular ssDNA viruses, nanoviruses and alphasatellites (putative Replication-associated protein, Rep), and begomo-, curto- and mastreviruses (putative coat protein, CP, and movement protein, MP). A large intergenic region contains a short palindromic sequence capable of forming a hairpin-like structure with the loop sequence TAGTATTAC, identical to the conserved nonanucleotide of circoviruses, nanoviruses and alphasatellites. Recombination events were not detected and phylogenetic analysis showed a relationship with circo-, nano- and geminiviruses. PCR confirmed the presence of this novel ssDNA virus in field plants. Infectivity tests using the cloned viral genome confirmed its ability to infect apple and pear tree seedlings, but not Nicotiana benthamiana. The name "Temperate fruit decay-associated virus" (TFDaV) is proposed for this novel virus.

Assuntos

RESUMO

Os objetivos deste trabalho foram identificar as espécies virais presentes em vinhedos comerciais de duas regiões do Nordeste do Brasil e realizar a caracterização molecular parcial de isolados de três espécies virais. A diagnose foi realizada por meio de RT-PCR em tempo real para a detecção de Grapevine rupestris stem pitting-associated virus (GRSPaV), Grapevine virus A (GVA), Grapevine virus B (GVB), Grapevine leafroll-associated virus 2, 3 e 4 (GLRaV-2, -3 e -4), Grapevine fleck virus (GFkV), Grapevine rupestris vein feathering virus (GRVFV) e Grapevine fanleaf virus (GFLV). Exceto para GFLV, os vírus avaliados estão amplamente disseminados nas áreas amostradas, frequentemente em altas incidências e em infecções múltiplas, de até 98% e 76,4%, na Zona da Mata e no Vale do São Francisco, respectivamente. Isolados locais de GVA, GVB e GLRaV-3 foram parcialmente caracterizados com base na sequência completa de nucleotídeos do gene da proteína capsidial e apresentaram alta porcentagem de identidade de nucleotídeos com outros isolados brasileiros: 91,2% (GVA), 99,8% (GVB) e 99,7% (GLRaV-3).

The objectives of this study were to identify viral species infecting commercial vineyards in two regions of Northeastern Brazil and perform partial molecular characterization of isolates of three virus species. The diagnosis was performed by real time RT-PCR for detection of GRSPaV, GVA, GVB, GLRaV-2, GLRaV-3, GLRaV-4, GFkV, GRVFV and GFLV. Except for GFLV, the evaluated viruses are widespread in the sampled areas, often in high incidences and in multiple infections, up to 98% and 76.4%, in the Zona da Mata and in the Vale do São Francisco regions, respectively. Local isolates of GVA, GVB and GLRaV-3, partially characterized by complete coat protein gene nucleotide sequencing, showed high percentage of nucleotide identities with other Brazilian isolates of these viruses: 91.2% (GVA), 99.8% (GVB) and 99.7% (GLRaV-3).

RESUMO

Os objetivos deste trabalho foram identificar as espécies virais presentes em vinhedos comerciais de duas regiões do Nordeste do Brasil e realizar a caracterização molecular parcial de isolados de três espécies virais. A diagnose foi realizada por meio de RT-PCR em tempo real para a detecção de Grapevine rupestris stem pitting-associated virus (GRSPaV), Grapevine virus A (GVA), Grapevine virus B (GVB), Grapevine leafroll-associated virus 2, 3 e 4 (GLRaV-2, -3 e -4), Grapevine fleck virus (GFkV), Grapevine rupestris vein feathering virus (GRVFV) e Grapevine fanleaf virus (GFLV). Exceto para GFLV, os vírus avaliados estão amplamente disseminados nas áreas amostradas, frequentemente em altas incidências e em infecções múltiplas, de até 98% e 76,4%, na Zona da Mata e no Vale do São Francisco, respectivamente. Isolados locais de GVA, GVB e GLRaV-3 foram parcialmente caracterizados com base na sequência completa de nucleotídeos do gene da proteína capsidial e apresentaram alta porcentagem de identidade de nucleotídeos com outros isolados brasileiros: 91,2% (GVA), 99,8% (GVB) e 99,7% (GLRaV-3).(AU)

The objectives of this study were to identify viral species infecting commercial vineyards in two regions of Northeastern Brazil and perform partial molecular characterization of isolates of three virus species. The diagnosis was performed by real time RT-PCR for detection of GRSPaV, GVA, GVB, GLRaV-2, GLRaV-3, GLRaV-4, GFkV, GRVFV and GFLV. Except for GFLV, the evaluated viruses are widespread in the sampled areas, often in high incidences and in multiple infections, up to 98% and 76.4%, in the Zona da Mata and in the Vale do São Francisco regions, respectively. Local isolates of GVA, GVB and GLRaV-3, partially characterized by complete coat protein gene nucleotide sequencing, showed high percentage of nucleotide identities with other Brazilian isolates of these viruses: 91.2% (GVA), 99.8% (GVB) and 99.7% (GLRaV-3).(AU)

Assuntos

RESUMO

The viruses Apple stem grooving virus (ASGV), Apple chlorotic leaf spot virus (ACLSV), Apple stem pitting virus (ASPV) and Apple mosaic virus (ApMV) are common in apples and pears and main targets of detection in propagation materials. This study aimed at demonstrating the usefulness of the hybridization method with a non-radioactive probe for simultaneous detection of these four viruses. The sensitivity of this method was sufficiently high enabling the detection of ASGV, ACLSV, ASPV and ApMV in total RNA extracted from infected samples. The probe specificity was confirmed by reaction with homologous viral cDNA, individually cloned for each virus.(AU)

Os vírus Apple stem grooving virus (ASGV), Apple chlorotic leaf spot virus (ACLSV), Apple stem pitting virus (ASPV) e Apple mosaic virus (ApMV) são comuns em macieiras e pereiras e alvos prioritários da detecção em materiais propagativos. Este trabalho objetivou demonstrar a viabilidade do método de hibridização com uma sonda não-radioativa para a detecção simultânea desses quatro vírus. A sensibilidade deste teste foi suficientemente alta para permitir a detecção do ASGV, ACLSV, ASPV e ApMV em RNA total extraído de amostras infectadas. A especificidade da sonda foi confirmada pela reação com cDNA viral homólogo, individualmente clonado, para cada vírus.(AU)

Assuntos

RESUMO

The viruses Apple stem grooving virus (ASGV), Apple chlorotic leaf spot virus (ACLSV), Apple stem pitting virus (ASPV) and Apple mosaic virus (ApMV) are common in apples and pears and main targets of detection in propagation materials. This study aimed at demonstrating the usefulness of the hybridization method with a non-radioactive probe for simultaneous detection of these four viruses. The sensitivity of this method was sufficiently high enabling the detection of ASGV, ACLSV, ASPV and ApMV in total RNA extracted from infected samples. The probe specificity was confirmed by reaction with homologous viral cDNA, individually cloned for each virus.

Os vírus Apple stem grooving virus (ASGV), Apple chlorotic leaf spot virus (ACLSV), Apple stem pitting virus (ASPV) e Apple mosaic virus (ApMV) são comuns em macieiras e pereiras e alvos prioritários da detecção em materiais propagativos. Este trabalho objetivou demonstrar a viabilidade do método de hibridização com uma sonda não-radioativa para a detecção simultânea desses quatro vírus. A sensibilidade deste teste foi suficientemente alta para permitir a detecção do ASGV, ACLSV, ASPV e ApMV em RNA total extraído de amostras infectadas. A especificidade da sonda foi confirmada pela reação com cDNA viral homólogo, individualmente clonado, para cada vírus.

Assuntos