RESUMO
BACKGROUND: Postoperative complications, length of index hospital stay, and unplanned hospital readmissions are important metrics reflecting surgical care quality. Postoperative infections represent a substantial proportion of all postoperative complications. We examined the relationships between identification of postoperative infection prehospital and posthospital discharge, length of stay, and unplanned readmissions in the American College of Surgeons National Surgical Quality Improvement Program database across nine surgical specialties. METHODS: The 30-day postoperative infectious complications including sepsis, surgical site infections, pneumonia, and urinary tract infection were analyzed in the American College of Surgeons National Surgical Quality Improvement Program inpatient data during the period from 2012 to 2017. General, gynecologic, vascular, orthopedic, otolaryngology, plastic, thoracic, urologic, and neurosurgical inpatient operations were selected. RESULTS: Postoperative infectious complications were identified in 5.2% (137,014/2,620,450) of cases; 81,929 (59.8%) were postdischarge. The percentage of specific complications identified postdischarge were 73.4% of surgical site infections (range across specialties 63.7-93.1%); 34.9% of sepsis cases (27.4-58.1%); 26.5% of pneumonia cases (18.9%-36.3%); and 53.2% of urinary tract infections (48.3%-88.0%). The relative risk of readmission among patients with postdischarge versus predischarge surgical site infection, sepsis, pneumonia, or urinary tract infection was 5.13 (95% confidence interval: 4.90-5.37), 9.63 (8.93-10.40), 10.79 (10.15-11.45), and 3.32 (3.07-3.60), respectively. Over time, mean length of stay decreased but postdischarge infections and readmission rates significantly increased. CONCLUSION: Most postoperative infectious complications were diagnosed postdischarge. These were associated with an increased risk of readmission. The trend toward shorter length of stay over time was observed along with an increase both in the percentage of infections detected after discharge and the rate of unplanned related postoperative readmissions over time. Postoperative surveillance of infections should extend beyond hospital discharge of surgical patients.
Assuntos
Assistência ao Convalescente/organização & administração , Complicações Pós-Operatórias/epidemiologia , Melhoria de Qualidade/estatística & dados numéricos , Centro Cirúrgico Hospitalar/organização & administração , Procedimentos Cirúrgicos Operatórios/efeitos adversos , Adulto , Assistência ao Convalescente/estatística & dados numéricos , Idoso , Bases de Dados Factuais/estatística & dados numéricos , Feminino , Humanos , Tempo de Internação/estatística & dados numéricos , Masculino , Pessoa de Meia-Idade , Alta do Paciente/estatística & dados numéricos , Readmissão do Paciente/estatística & dados numéricos , Pneumonia/epidemiologia , Pneumonia/etiologia , Complicações Pós-Operatórias/etiologia , Fatores de Risco , Sepse/epidemiologia , Sepse/etiologia , Centro Cirúrgico Hospitalar/estatística & dados numéricos , Infecção da Ferida Cirúrgica/epidemiologia , Infecção da Ferida Cirúrgica/etiologia , Estados Unidos/epidemiologia , Infecções Urinárias/epidemiologia , Infecções Urinárias/etiologiaRESUMO
BACKGROUND: The objective of this study was to determine the effects of using the Surgical Risk Preoperative Assessment System (SURPAS) on patient satisfaction and surgeon efficiency in the surgical informed consent process, as compared to surgeons' "usual" consent process. STUDY DESIGN: Patient perception of the consent process was assessed via survey in 2 cohorts: 10 surgeons in different specialties used their "usual" consent process for 10 patients; these surgeons were then taught to use SURPAS, and they used it during the informed consent process of 10 additional patients. The data were compared using Fisher's exact test and the Cochran-Mantel-Haenszel test. RESULTS: One hundred patients underwent the "usual" consent process (USUAL), and 93 underwent SURPAS-guided consent (SURPAS). Eighty-two percent of SURPAS were "very satisfied" and 18% were "satisfied" with risk discussion vs 16% and 72% of USUAL, respectively. Of those who used SURPAS, 75.3% reported the risk discussion made them "more comfortable" with surgery vs 19% of USUAL, and 90.3% of SURPAS users reported "somewhat" or "greatly decreased" anxiety vs 20% of USUAL. All p values were <0.0001. Among SURPAS patients, 97.9% reported "enough time spent discussing risks" vs 72.0% of USUAL patients. CONCLUSIONS: The SURPAS tool improved the informed consent process for patients compared with the "usual" consent process, in terms of patient satisfaction, ie making patients feel more comfortable and less anxious about their impending operations. Providers should consider integrating the SURPAS tool into their preoperative consent process.
Assuntos
Consentimento Livre e Esclarecido , Satisfação do Paciente , Complicações Pós-Operatórias/epidemiologia , Cuidados Pré-Operatórios , Adulto , Idoso , Estudos de Coortes , Tomada de Decisões , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Medição de Risco , Inquéritos e QuestionáriosRESUMO
In this study, we investigated the associations between genetic variants in the promoter region of the insulin-like growth factor-1 (IGF1) gene and blood serum IGF1 concentration in Hanwoo cattle. Polymerase chain reaction primers were based on GenBank accession No. AF404761 and amplified approximately 533-bp segments. Newly identified sequences were submitted to GenBank (accession No. DQ267493). Sequence analysis revealed that genetic variants were located at a nucleotide position 323 for the nucleotide substitution C/A that was first reported in this study and positions 326-349 for a repeat motif (CA10-11). The allele frequencies of g.323C>A were 0.264 (C) and 0.736 (A) without significant deviation from Hardy-Weinberg equilibrium. Frequencies of the repeat motif CA(10) and CA(11) were 0.604 and 0.396, respectively. Statistical analysis revealed that the genetic variation g.323C>A was significantly associated with blood serum IGF1 concentrations with significant additive genetic effects, whereas no associations were found for the repeat motif. IGF1 concentrations were positively (r = 0.453) and negatively (r = -0.445) correlated with weights in the growing stages (16-21 months) and late fattening stages (22-30 months), respectively. The results of the present study and future genotypic data for Hanwoo beef cattle based on the robust genetic variation of IGF1 will provide critical information for genetic improvement and will have a large impact on commercial markets.
Assuntos
Bovinos/sangue , Bovinos/genética , Fator de Crescimento Insulin-Like I/genética , Fator de Crescimento Insulin-Like I/metabolismo , Animais , Sequência de Bases , Estudos de Associação Genética/veterinária , Variação Genética , Masculino , Dados de Sequência Molecular , Polimorfismo de Nucleotídeo Único , Regiões Promotoras Genéticas , Análise de Sequência de DNARESUMO
Ice cores from low latitudes can provide a wealth of unique information about past climate in the tropics, but they are difficult to recover and few exist. Here, we report annually resolved ice core records from the Quelccaya ice cap (5670 meters above sea level) in Peru that extend back ~1800 years and provide a high-resolution record of climate variability there. Oxygen isotopic ratios (δ(18)O) are linked to sea surface temperatures in the tropical eastern Pacific, whereas concentrations of ammonium and nitrate document the dominant role played by the migration of the Intertropical Convergence Zone in the region of the tropical Andes. Quelccaya continues to retreat and thin. Radiocarbon dates on wetland plants exposed along its retreating margins indicate that it has not been smaller for at least six millennia.
Assuntos
Mudança Climática , Camada de Gelo , Clima Tropical , Nitratos/análise , Isótopos de Oxigênio/análise , Peru , Plantas , Compostos de Amônio Quaternário/análise , Áreas AlagadasRESUMO
OBJECTIVE: There are currently multiple tests available for cervical cancer screening and the existing screening policies vary from country to country. No single approach will satisfy the specific needs and variations in risk aversion of all populations, and screening algorithms should be tailored to specific groups. We performed long term risk stratification based on screening test results and compared the accuracy of different tests and their combinations. METHODS: A longitudinal cohort study of the natural history of HPV infection and cervical neoplasia enrolled 2462 women from a low-income population in Brazil. The interviews and cervical screening with cytology and HPV DNA testing were repeated according to a pre-established protocol and the subjects were referred for colposcopy and biopsy whenever high grade lesions were suspected. We compared the specificity, sensitivity and predictive values of each screening modality. Long term risk stratification was performed through time-to-event analyses using Kaplan-Meier analysis and Cox regression. RESULTS: The best optimization of sensitivity and specificity was achieved when using dual testing with cytology and HPV DNA testing, whereby the screening test is considered positive if either component yields an abnormal result. However, when allowing 12months for the detection of lesions, cytology alone performed nearly as well. Risk stratification revealed that HPV DNA testing was not beneficial for HSIL cases, whereas it was for ASCUS and, in some combinations, for negative and LSIL cytology. CONCLUSION: Our results suggest that some high risk populations may benefit equally from cytology or HPV DNA testing, and may require shorter intervals between repeat testing.
Assuntos
Detecção Precoce de Câncer/métodos , Neoplasias do Colo do Útero/diagnóstico , Adolescente , Adulto , Algoritmos , Brasil/epidemiologia , Estudos de Coortes , DNA Viral/análise , DNA Viral/genética , Feminino , Humanos , Estudos Longitudinais , Pessoa de Meia-Idade , Papillomaviridae/genética , Papillomaviridae/isolamento & purificação , Infecções por Papillomavirus/diagnóstico , Infecções por Papillomavirus/epidemiologia , Infecções por Papillomavirus/patologia , Infecções por Papillomavirus/virologia , Fatores de Risco , Neoplasias do Colo do Útero/epidemiologia , Neoplasias do Colo do Útero/patologia , Neoplasias do Colo do Útero/virologia , Adulto JovemRESUMO
Cell-cell adhesions and the cytoskeletons play important and coordinated roles in cell biology, including cell differentiation, development, and migration. Adhesion and cytoskeletal dynamics are regulated by Rho-GTPases. ARHGAP21 is a negative regulator of Rho-GTPases, particularly Cdc42. Here we assess the function of ARHGAP21 in cell-cell adhesion, cell migration, and scattering. We find that ARHGAP21 is localized in the nucleus, cytoplasm, or perinuclear region but is transiently redistributed to cell-cell junctions 4 h after initiation of cell-cell adhesion. ARHGAP21 interacts with Cdc42, and decreased Cdc42 activity coincides with the appearance of ARHGAP21 at the cell-cell junctions. Cells lacking ARHGAP21 expression show weaker cell-cell adhesions, increased cell migration, and a diminished ability to undergo hepatocyte growth factor-induced epithelial-mesenchymal transition (EMT). In addition, ARHGAP21 interacts with α-tubulin, and it is essential for α-tubulin acetylation in EMT. Our findings indicate that ARHGAP21 is a Rho-GAP involved in cell-cell junction remodeling and that ARHGAP21 affects migration and EMT through α-tubulin interaction and acetylation.
Assuntos
Transição Epitelial-Mesenquimal , Epitélio/metabolismo , Proteínas Ativadoras de GTPase/fisiologia , Tubulina (Proteína)/metabolismo , Acetilação , Animais , Adesão Celular , Comunicação Celular , Linhagem Celular Tumoral , Movimento Celular , Cães , Proteínas Ativadoras de GTPase/metabolismo , Humanos , Células Madin Darby de Rim Canino , Metástase Neoplásica , Interferência de RNA , Fatores de Tempo , Proteína cdc42 de Ligação ao GTP/metabolismoRESUMO
Brain-derived neurotrophic factor (BDNF) effects on the establishment of glycinergic and GABAergic transmissions in mouse spinal neurons were examined using combined electrophysiological and calcium imaging techniques. BDNF (10 ng/ml) caused a significant acceleration in the onset of synaptogenesis without large effects on the survival of these neurons. Amplitude and frequency of spontaneous inhibitory postsynaptic currents (sIPSCs) and miniature inhibitory postsynaptic currents (mIPSCs) associated to activation of glycine and GABA(A) receptors were augmented in neurons cultured with BDNF. The neurotrophin effect was blocked by long term tetrodotoxin (TTX) addition suggesting a dependence on neuronal activity. In addition, BDNF caused a significant increase in glycine- and GABA-evoked current densities that partly explains the increase in synaptic transmission. Presynaptic mechanisms were also involved in BDNF effects since triethylammonium(propyl)-4-(2-(4-dibutylamino-phenyl)vinyl)pyridinium (FM1-43) destaining with high K(+) was augmented in neurons incubated with the neurotrophin. The effects of BDNF were mediated by receptor tyrosine kinase B (TrkB) and mitogen-activated protein kinase kinase (MEK) activation since culturing neurons with either (9S,10R,12R)-2,3,9,10,11,12-hexahydro-10-hydroxy-9-methyl-1-oxo-9,12-epoxy-1H-diindolo[1,2,3-fg:3',2',1'- kl]pyrrolo[3,4-i][1,6]benzodiazocine-10-carboxylic acid methyl ester (K252a) or 2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one (PD98059) blocked the augmentation in synaptic activity induced by the neurotrophin.
Assuntos
Fator Neurotrófico Derivado do Encéfalo/metabolismo , Glicina/metabolismo , Vias Neurais/embriologia , Neurônios/metabolismo , Sinapses/ultraestrutura , Ácido gama-Aminobutírico/metabolismo , Animais , Fator Neurotrófico Derivado do Encéfalo/farmacologia , Diferenciação Celular/efeitos dos fármacos , Diferenciação Celular/fisiologia , Células Cultivadas , Inibidores Enzimáticos/farmacologia , Potenciais Pós-Sinápticos Inibidores/efeitos dos fármacos , Potenciais Pós-Sinápticos Inibidores/fisiologia , MAP Quinase Quinase 1/antagonistas & inibidores , MAP Quinase Quinase 1/metabolismo , Camundongos , Camundongos Endogâmicos C57BL , Inibição Neural/efeitos dos fármacos , Inibição Neural/fisiologia , Vias Neurais/efeitos dos fármacos , Vias Neurais/metabolismo , Plasticidade Neuronal/efeitos dos fármacos , Plasticidade Neuronal/fisiologia , Neurônios/ultraestrutura , Compostos de Piridínio , Compostos de Amônio Quaternário , Receptor trkB/efeitos dos fármacos , Receptor trkB/metabolismo , Receptores de GABA-A/efeitos dos fármacos , Receptores de GABA-A/metabolismo , Receptores de Glicina/efeitos dos fármacos , Receptores de Glicina/metabolismo , Bloqueadores dos Canais de Sódio/farmacologia , Medula Espinal/citologia , Medula Espinal/efeitos dos fármacos , Medula Espinal/embriologia , Sinapses/efeitos dos fármacos , Sinapses/metabolismo , Transmissão Sináptica/efeitos dos fármacos , Transmissão Sináptica/fisiologiaRESUMO
To our knowledge, this is the first report that Leifsonia xyli subsp. xyli, previously named Clavibacter xyli subsp. xyli (2), has been detected and identified in sugarcane in Jamaica. Although ratoon stunting (also known as ratoon stunting disease or RSD) has been reported in Jamaica since 1961, presence of the pathogen had never been confirmed in symptomatic tissues. A major industry-wide survey conducted in 1987 using the fluorescent antibody staining technique failed to detect positives in any of the 61 fields sampled in Jamaica. A new survey was conducted in 2004 on eight estates and the Sugar Industry Research Institute (SIRI) in Jamaica. Six arbitrarily selected stalks were sampled from each of 64 fields representing 25 different sugarcane cultivars. A 1-cm diameter core was extracted from the center of the bottom part of the stalk and used to detect the pathogen by tissue blot immunoassay (TBIA) (3). L. xyli subsp. xyli was detected in 26 of 384 samples (7%). At least one positive sample was found in 10 fields and seven cultivars and in one case (sugarcane cv. D14146 at the St Thomas Sugar Estate), all six stalks sampled in a field were positive. The highest number of infected fields (6 of 10) occurred at Worthy Park where cane yield in 2004 was 86.54 tons per ha compared with an average of 68.04 tons per ha for major estates in Jamaica (1). This latter result would indicate that where good quality agronomic practices are maintained, the effect of ratoon stunting might not be substantial or that sugarcane cultivars grown at this location were resistant to ratoon stunting. Pathogen identification was confirmed using nested polymerase chain reaction (PCR) with three samples from a TBIA-positive field of cv. D14146. Primary primers were RSD 33 (CTGGCACCCTGTGTTGTTTTC) and RSD 297 (TTCGGTTCTCATCTCAGCGTC) and secondary, nested primers were RST60 (TCAACGCAGAGATTGTCCAG) and RST59 (CGTCTTGAAGACACAGCGATGAG). The thermocycler parameters were denaturization at 94°C for 4 min, 31 cycles at 94°C for 30 s, 55°C for 30 s, 65°C for 1 min, and final extension at 65°C for 3 min. The nested-PCR product (approximately 230 bp) of each sample was cloned and sequenced. It showed 99 to 100% identity with the 16S-23S intergenic spacer region of L. xyli subsp. xyli, thus confirming occurrence of ratoon stunting in Jamaica. Since this study, the SIRI has installed a hot-water treatment plant and will heat-treat cuttings before planting the nurseries with new sugarcane clones selected for release to growers. The SIRI will also conduct screening for ratoon stunting resistance to ensure that susceptible clones are not released to the industry. Meanwhile, the SIRI will do a more intense survey so that a more comprehensive picture may be obtained of the presence of ratoon stunting in Jamaica. References: (1) Anonymous. Annual Report of the Sugar Industry Research Institute, Jamaica, 2004. (2) L. I. Evtushenko et al. Int. J. Syst. Evol. Microbiol. 50:371, 2000. (3) N. A. Harrison and M. J. Davis. Phytopathology 78:722, 1988.
RESUMO
The spinal muscular atrophies (SMA) or hereditary motor neuronopathies result from the continuous degeneration and death of spinal cord lower motor neurons, leading to progressive muscular weakness and atrophy. We describe a large Brazilian family exhibiting an extremely rare, late-onset, dominant, proximal, and progressive SMA accompanied by very unusual manifestations, such as an abnormal sweating pattern, and gastrointestinal and sexual dysfunctions, suggesting concomitant involvement of the autonomic nervous system. We propose a new disease category for this disorder, 'hereditary motor and autonomic neuronopathy', and attribute the term, 'survival of motor and autonomic neurons 1' (SMAN1) to the respective locus that was mapped to a 14.5 cM region on chromosome 20q13.2-13.3 by genetic linkage analysis and haplotype studies using microsatellite polymorphic markers. This locus lies between markers D20S120 and D20S173 showing a maximum LOD score of 4.6 at D20S171, defining a region with 33 known genes, including several potential candidates. Identifying the SMAN1 gene should not only improve our understanding of the molecular mechanisms underlying lower motor neuron diseases but also help to clarify the relationship between motor and autonomic neurons.
Assuntos
Mapeamento Cromossômico/métodos , Cromossomos Humanos Par 20/genética , Neuropatia Hereditária Motora e Sensorial/genética , Feminino , Marcadores Genéticos , Genótipo , Humanos , Masculino , Linhagem , Reação em Cadeia da PolimeraseRESUMO
The spinal muscular atrophies (SMA) or hereditary motor neuronopathies result from the continuous degeneration and death of spinal cord lower motor neurons, leading to progressive muscular weakness and atrophy. We describe a large Brazilian family exhibiting an extremely rare, late-onset, dominant, proximal, and progressive SMA accompanied by very unusual manifestations, such as an abnormal sweating pattern, and gastrointestinal and sexual dysfunctions, suggesting concomitant involvement of the autonomic nervous system. We propose a new disease category for this disorder, `hereditary motor and autonomic neuronopathy', and attribute the term, `survival of motor and autonomic neurons 1' (SMAN1) to the respective locus that was mapped to a 14.5 cM region on chromosome 20q13.2-13.3 by genetic linkage analysis and haplotype studies using microsatellite polymorphic markers. This locus lies between markers D20S120 and D20S173 showing a maximum LOD score of 4.6 at D20S171, defining a region with 33 known genes, including several potential candidates. Identifying the SMAN1 gene should not only improve our understanding of the molecular mechanisms underlying lower motor neuron diseases but also help to clarify the relationship between motor and autonomic neurons.
Assuntos
Humanos , Masculino , Feminino , Mapeamento Cromossômico/métodos , /genética , Neuropatia Hereditária Motora e Sensorial/genética , Marcadores Genéticos , Genótipo , Linhagem , Reação em Cadeia da PolimeraseRESUMO
OBJECTIVE: To determine the factors which influence decisions relating to oral health education/promotion activities by dental auxiliaries. METHOD: Fifty per cent of the dental auxiliaries in the Ministry of Health's Schools Dental Health Programme islandwide were systematically selected for completion of a questionnaire on oral health education/promotion. Regional Dental Coordinators also acted as key formants in assessing dental health education/promotion activities. RESULTS: A significant number of auxiliaries (94.7 percent, p<0.03) thought dental health education was an integral part of public health practice. Numerical targets set by the Ministry of Health were more a driving force than were the special needs of children in carrying out oral health education/promotion activities. The use of the lecture method supported by visual aids when conducting sessions was directly related to the availability of resources for carrying out such sessions. The staff was more likely to use the lecture method in pre- and primary schools (p= 0.003). Oral health promotional intervention procedures such as prophylaxis were carried out by a significant number (96.8 percent) of nurses. Atruamatic restorative treatment (ART) 67 percent, sealant 55.6 percent and preventive resin restoration (PRR) 48.4 percent were also done. Lack of material and equipment was the most common reason reported by these persons who were not carrying out ART, sealant, PRR procedures (45 percent, 96.6 percent, 71 percent respectively). CONCLUSIONS: Numerical targets and availability of educational material were the major driving forces for oral health education/promotion in this group. Emphasis on the utilization of other oral health promotion interventions, however, is vital to the maintenance of a reduced decayed, missing and filled teeth (DMFT) index in Jamaica. (AU)
Assuntos
Humanos , Saúde Bucal , Educação em Saúde Bucal/métodos , Auxiliares de Odontologia , Jamaica , Promoção da SaúdeRESUMO
BACKGROUND: Chilean aboriginal populations (Mapuche) predominantly live in the region of Araucanía, in the southern part of the country. Their cardiovascular risk factors have not been systematically assessed. AIM: To study the prevalence of cardiovascular risk factors in the Mapuche population. SUBJECTS AND METHODS: Blood pressure, weight, height, dietary habits, fasting serum total cholesterol, HDL cholesterol and triglycerides were measured in 1.948 adults living in 28 Mapuche communities. RESULTS: Thirteen percent of males and 16% of females had high blood pressure. Body mass index was 25.5 kg/m2 in males and 28.1 kg/m2 in females. Forty five percent of women and 24% of men were classified as obese. Mean serum total cholesterol was 186.7 +/- 9.6 mg/dl, HDL cholesterol was 58.7 +/- 30.7 mg/dl, total cholesterol/HDL cholesterol was 3.4 +/- 2 and triglycerides were 155.2 +/- 91.2 mg/dl. Twenty eight percent of males and 9.6% of females smoked. CONCLUSIONS: Mapuche individuals have higher levels of HDL cholesterol a better total cholesterol/HDL cholesterol ratio and lower frequency of smoking than non aboriginal Chileans subjects.
Assuntos
Pressão Sanguínea , Doenças Cardiovasculares/epidemiologia , Indígenas Sul-Americanos , Lipídeos/sangue , Adulto , Idoso , Idoso de 80 Anos ou mais , Chile/epidemiologia , Colesterol/sangue , Feminino , Humanos , Hipertensão/epidemiologia , Masculino , Pessoa de Meia-Idade , Estado Nutricional , Prevalência , Fatores de RiscoRESUMO
In December 1995, leaf scald symptoms were observed in sugarcane (Saccharum sp.) cultivar B64277 in French Guyana. Symptomatic plants occurred both in a sugarcane germplasm collection near the road between Sinnamary and Saint-Elie and in a nursery near Sinnamary. Sugarcane imported from Martinique had been used to establish the germplasm collection that in turn had been used to establish the nursery. Ten-month-old mature plants in the germplasm collection had abnormal side shoots on the lower part of the stalks and suckers (nonmillable stalks) with white scalded areas on leaves. Leaves on 1-month-old shoots in the nursery exhibited chlorosis and white, pencil-line streaks. Samples prepared from symptomatic stalks from the two locations were plated on a selective medium (1), and two isolates of Xanthomonas albilineans were recovered. Both of these isolates caused leaf scald symptoms on leaves of sugarcane cultivar B69566 inoculated by a decapitation technique, and belong to serovar 3 previously reported in the Caribbean from Guadeloupe, Martinique, and St. Kitts. The RFLP (restriction fragment length polymorphism) pattern of these two isolates was different from the 54 patterns among 218 other strains collected throughout the world (2), but similar to the pattern of a strain of serovar 3 from Martinique. This indicated that the pathogen might have been introduced with cuttings imported from Martinique. Three stalks of mature cane from varieties B5992, B64277, and R570 from the germplasm collection were tested for the presence of Clavibacter xyli subsp. xyli, causal agent of ratoon stunting disease. Immunofluorescence tests on sap (3) revealed the presence of the pathogen in the three stalks of B64277. All sugarcane plants in the nursery and the germplasm collection were destroyed by the use of glyphosate sprays in January 1996 in an attempt to arrest the spread of the two bacterial pathogens. In order to obtain healthy seed cane for future planting, a new germplasm collection of 0.6 ha and consisting of 11 cultivars was planted in January 1996 with disease-free, tissue-cultured plants provided by the CIRAD sugarcane breeding station in Guadeloupe. References: (1) M. J. Davis et al. Plant Dis. 78:78, 1994. (2) M. J. Davis et al. Phytopathology 87:316, 1997. (3) M. J. Davis and J. L. Dean. Plant Dis. 68:896, 1984.
RESUMO
Two ice cores from the col of Huascarán in the north-central Andes of Peru contain a paleoclimatic history extending well into the Wisconsinan (Würm) Glacial Stage and include evidence of the Younger Dryas cool phase. Glacial stage conditions at high elevations in the tropics appear to have been as much as 8 degrees to 12 degrees C cooler than today, the atmosphere contained about 200 times as much dust, and the Amazon Basin forest cover may have been much less extensive. Differences in both the oxygen isotope ratio zeta(18)O (8 per mil) and the deuterium excess (4.5 per mil) from the Late Glacial Stage to the Holocene are comparable with polar ice core records. These data imply that the tropical Atlantic was possibly 5 degrees to 6 degrees C cooler during the Late Glacial Stage, that the climate was warmest from 8400 to 5200 years before present, and that it cooled gradually, culminating with the Little Ice Age (200 to 500 years before present). A strong warming has dominated the last two centuries.
RESUMO
1. The potentiated startle paradigm measures conditioned fear by an increase in the amplitude of a simple reflex (the acoustic startle reflex) in the presence of a cue previously paired with shock. This paradigm offers a number of advantages as an alternative to most animal tests of fear or anxiety because it involves no operant and is reflected by an enhancement rather than a suppression of ongoing behavior. 2. A variety of drugs which block anxiety in people block fear-potentiated startle in rats. Although the 5-HT1A agonist buspirone is especially effective in blocking fear-potentiated startle, more selective 5-HT1A agonists have been less consistently effective. However, when these drugs are combined with only partially effective doses of the D1 antagonist, SCH23390, a full blockade of fear-potentiated startle is achieved. Hence, synergistic actions appear to occur between serotonin and dopamine in modulating the expression of fear-potentiated startle. 3. In addition to pharmacological studies, physiological studies are being used to define the neural pathways necessary for a visual conditioned stimulus to alter the acoustic startle reflex. The current working hypothesis is that the conditioned stimulus activates the central nucleus of the amygdala through a pathway involving the lateral geniculate nucleus, perirhinal cortex, and lateral and basolateral amygdaloid nuclei. The central nucleus of the amygdala then projects directly to the acoustic startle pathway so as to modulate the startle response. Chemical or electrolytic lesions of either the central nucleus or the lateral and basolateral nuclei of the amygdala block the expression of fear-potentiated startle. These latter amygdaloid nuclei may actually be the site of plasticity for fear conditioning, because local infusion of the NMDA antagonist AP5 blocks the acquisition but not the expression of fear-potentiated startle. 4. Finally, we have begun to investigate brain systems that might be involved in the inhibition of fear. Local infusion of AP5 into the amygdala was found to block the acquisition of experimental extinction, a prototypical method for reducing fear. We have also established a reliable procedure for producing conditioned inhibition of fear-potentiated startle and hope to eventually understand the neural systems involved in this phenomenon.
Assuntos
Buspirona/farmacologia , Medo/fisiologia , Reflexo de Sobressalto/efeitos dos fármacos , Estimulação Acústica , Tonsila do Cerebelo/fisiologia , Animais , Buspirona/administração & dosagem , Condicionamento Clássico , Medo/efeitos dos fármacos , Humanos , Vias Neurais/fisiologia , Estimulação Luminosa , Ratos , Reflexo de Sobressalto/fisiologiaRESUMO
In 1987, health authorities in Costa Rica started a training program in family and community medicine and requested assistance from the Department of Family Medicine at McGill University. The authors outline the health care system in Costa Rica and the background of the project. The design, implementation, and progress of the project to date are discussed. The problems associated with this kind of project and its future are also discussed.
RESUMO
El calcio y el magnesio son dos importantes cationes corporales, con funciones especializadas en los líquidos orgánicos. Existen numerosos métodos para la cuantificación de estos cationes. Se evaluaron los métodos colorimétricos de la O-cresolftaleína para calcio total y del calmagite para magnesio en suero sanguíneo de 64 individuos, comparándolos con espectrofotometría de absorción atómica. Las determinaciones colorimétricas mostraron buena estabilidad de color y adecuados valores de precisión diaria e interdiaria. Al analizar los espectros de absorción, se propone modoficar las longitudes de onda establecidas en ambos métodos colorimétricos. Los valores obtenidos para el calcio con la O-cresolftaleína, resultaron similares a los obtenidos con espectrofotometría de absorción atómica; en cambio para el magnesio las determinaciones con Calmagite fueron en promedio 8,7 por ciento más altos
Assuntos
Humanos , Adulto , Cálcio/sangue , Colorimetria , Espectrofotometria Atômica/métodos , Magnésio/sangue , Ácidos Sulfônicos , Kit de Reagentes para Diagnóstico/normasRESUMO
The role of the Western Interstate Commission for Higher Education (WICHE) in facilitating collaboration between higher education and state mental health agencies in the western states is presented in this paper. Unique service and training problems posed by sparsely populated states with limited numbers of professionally trained personnel and few clinical training programs make collaboration an important human resource issue in the West. WICHE's efforts over the past ten years to strengthen collaboration and the recent development of a regional coalition of educators, providers, and consumers to solve chronic treatment and research problems in the western states are described.