RESUMO
OBJECTIVE: Tumor hypoxia is associated with a poorer prognosis in cancer patients and can diminish the efficacy of radiation therapy (RT). This study investigates the potential of metformin to enhance radiosensitivity in hypoxic cancer cells. METHODS: Preliminary experiments were conducted to validate the impact of hypoxia on radiation response. Reactive oxygen species (ROS) levels, cell migration, and cell death were assessed in hypoxic, radiated cells treated with metformin. Proteomic and ontological analyses were employed to identify molecular targets associated with the radiosensitizing effect of metformin. Proteomic and ontological findings were validated through patient samples and in vitro studies. RESULTS: Metformin amplified cell death, induced DNA fragmentation, decreased cell migration, and elevated ROS levels in hypoxic, radiated cells. Proteomic analyses revealed that GAPDH and TAGLN2 were identified as pivotal targets linked to the radiosensitizing effect of metformin. Oral cancer patients exhibited elevated levels of TAGLN2 and reduced levels of GAPDH. Metformin downregulated TAGLN2 and upregulated GAPDH in hypoxic, radiated cells. Additionally, metformin reduced levels of mutated p53. CONCLUSIONS: This study suggests that metformin can enhance radiosensitivity in hypoxic cells, operating through modulation of GAPDH and TAGLN2. Furthermore, metformin effectively reduces mutated p53 levels in radiated cells under hypoxic conditions.
Assuntos
Carcinoma de Células Escamosas , Metformina , Neoplasias Bucais , Radiossensibilizantes , Humanos , Metformina/farmacologia , Metformina/uso terapêutico , Neoplasias Bucais/radioterapia , Radiossensibilizantes/farmacologia , Linhagem Celular Tumoral , Movimento Celular/efeitos dos fármacos , Tolerância a Radiação/efeitos dos fármacos , Espécies Reativas de Oxigênio/metabolismo , Proteômica , Gliceraldeído-3-Fosfato Desidrogenases , Gliceraldeído-3-Fosfato Desidrogenase (Fosforiladora) , Hipóxia Celular/efeitos dos fármacos , Hipóxia Tumoral/efeitos dos fármacosRESUMO
One of the factors that limit ruminant production in the semiarid region is the lack of roughage in the dry season. The management of forage plants adapted to edaphoclimatic conditions is a strategy to improve animal production. This study was conducted to examine the effects of biomass sorghum silage (BSS; Sorghum bicolor (L.) Moench) and BRS capiaçu grass silage (CGS; Pennisetum purpureum Schum) with or without spineless cactus (Opuntia spp.) in crossbred Holstein × Zebu heifers' diets on the intake, apparent digestibility of the nutrients and animal performance (e.g., final weight, daily weight gain) (experiment 1). Also, to evaluate the ruminal kinetics of dry matter (DM) and neutral detergent fiber (NDF) of roughages used in diets using two animals cannulated in the rumen (experiment 2). In experiment 1, ten heifers with an initial body weight of 200 ± 2.74 kg (mean ± standard deviation) and a mean age of 10 months were used. The animals were distributed in an experimental design in two simultaneous 5 × 5 Latin squares. Five experimental diets were used: diet 1, Volumax sorghum silage (VSS); diet 2, biomass sorghum silage (BSS); diet 3, BRS capiaçu silage (CGS); diet 4, biomass sorghum silage (60%) with spineless cactus (40%) (BSS + SC); and diet 5, BRS capiaçu grass silage (60%) with spineless cactus (40%) (CGS + SC). The diets were formulated with sorghum silage or BRS capiaçu grass silage with or without spineless cactus (roughage) and a maize- and soybean-based concentrate (75:25 roughage-to-concentrate ratio) on DM basis. The experiment lasted 105 days, divided into five periods of 21 days (17 days for the adaptation of the animals to the diets and management and 4 for data collection and samples). The diets containing CGS and CGS + SC resulted in lower dry matter intake (DMI; 5.61 kg day-1; P < 0.01), which was 19.4% lower than the diets with VSS, BSS, and BSS + SC (7.00 kg day-1). The BSS + SC and CGS + SC diets showed higher crude protein digestibility (P < 0.01) at 21.9% than the other treatments (Volumax, BSS, CGS). The different diets did not change the final weight or the daily weight gain of the heifers. The BRS 716 biomass sorghum silage and BRS capiaçu grass combined with spineless cactus increased (P < 0.05) the intake of nonfibrous carbohydrates and did not interfere (P > 0.05) with the final weight or average daily gain of the crossbred Holstein × Zebu heifers. The standardized potentially degradable fraction (Bp) of the NDF was 13.91% higher (P < 0.01) for BSS and BSS + SC (61.6%) compared to the others (53.0%). A diet based on BSS + SC is recommended for feeding crossbred heifers in the growing phase.
Assuntos
Opuntia , Sorghum , Bovinos , Animais , Feminino , Poaceae , Brasil , Silagem , Dieta/veterinária , Fibras na Dieta , Grão ComestívelRESUMO
OBJECTIVE: Oral squamous cell carcinoma (OSCC) is one of the most common neoplasms worldwide. The current study aimed to identify potential biomarkers associated with OSCC survival. MATERIALS AND METHODS: Differentially expressed genes (DEGs) in atypical OSCC cases were identified using two public datasets: The Cancer Genome Atlas and the Gene Expression Omnibus database. Receiver operating characteristic (ROC) analysis was performed to identify the cutoff, and the candidate DEGs related to survival. Kaplan-Meier and Cox regression analysis using the categorized genes were employed to identify genes that impact the overall survival in OSCC. RESULTS: A total of 263 OSCC samples and 105 healthy tissues were used to identify 295 upregulated and 131 downregulated genes expressed only in non-smokers. ROC analyses identified 25 candidate genes associated with death. Survival analyses demonstrated that the following DEGs, namely CSTA, FGFR2, MMP19, OLR1, PCSK1, RAMP2, and CGB5, are potential OSCC prognostic factors. CONCLUSION: We found that CSTA, FGFR2, MMP19, OLR1, PCSK1, RAMP2, and CGB5 are associated with a low survival rate in OSCC. However, further studies are needed to validate our findings and facilitate the development of these factors as potential biomarkers for OSCC survival.
Assuntos
Carcinoma de Células Escamosas , Neoplasias de Cabeça e Pescoço , Neoplasias Bucais , Humanos , Carcinoma de Células Escamosas de Cabeça e Pescoço/genética , Carcinoma de Células Escamosas/patologia , Transcriptoma , Neoplasias Bucais/metabolismo , Regulação Neoplásica da Expressão Gênica , Análise de Sobrevida , Biomarcadores Tumorais/genética , Neoplasias de Cabeça e Pescoço/genética , PrognósticoRESUMO
Chagas disease (CD) is recognized by the World Health Organization as one of the thirteen most neglected tropical diseases. More than 80% of people affected by CD will not have access to diagnosis and continued treatment, which partly supports the high morbidity and mortality rate. Machine Learning (ML) can identify patterns in data that can be used to increase our understanding of a specific problem or make predictions about the future. Thus, the aim of this study was to evaluate different models of ML to predict death in two years of patients with CD. ML models were developed using different techniques and configurations. The techniques used were: Random Forests, Adaptive Boosting, Decision Tree, Support Vector Machine, and Artificial Neural Networks. The adopted settings considered only interview variables, only complementary exam variables, and finally, both mixed. Data from a cohort study with CD patients called SaMi-Trop were analyzed. The predictor variables came from the baseline; and the outcome, which was death, came from the first follow-up. All models were evaluated in terms of Sensitivity, Specificity and G-mean. Among the 1694 individuals with CD considered, 134 (7.9%) died within two years of follow-up. Using only the predictor variables from the interview, the different techniques achieved a maximum G-mean of 0.64 in predicting death. Using only the variables from complementary exams, the G-mean was up to 0.77. In this configuration, the protagonism of NT-proBNP was evident, where it was possible to observe that an ML model using only this single variable reached G-mean of 0.76. The configuration that mixed interview variables and complementary exams achieved G-mean of 0.75. ML can be used as a useful tool with the potential to contribute to the management of patients with CD, by identifying patients with the highest probability of death. Trial Registration: This trial is registered with ClinicalTrials.gov, Trial ID: NCT02646943.
Assuntos
Doença de Chagas , Aprendizado de Máquina , Doença de Chagas/diagnóstico , Estudos de Coortes , HumanosRESUMO
COVID-19 was first reported in Wuhan, China, in December 2019. It is widely accepted that the world will not return to its prepandemic normality until safe and effective vaccines are available and a global vaccination program has been successfully implemented. Antisense RNAs are single-stranded RNAs that occur naturally or are synthetic and enable hybridizing and protein-blocking translation. Therefore, the main objective of this study was to identify target markers in the RNA of the severe acute respiratory syndrome coronavirus, or SARS-CoV-2, with a length between 21 and 28 bases that could enable the development of vaccines and therapies based on antisense RNA. We used a search algorithm in C language to compare 3159 complete nucleotide sequences from SARS-CoV-2 downloaded from the repository of the National Center for Biotechnology Information. The objective was to verify whether any common sequences were present in all 3159 strains of SARS-CoV-2. In the first of three datasets (SARS-CoV-2), the algorithm found two sequences each of 21 nucleotides (Sequence 1: CTACTGAAGCCTTTGAAAAAA; Sequence 2: TGTGGTTATACCTACTAAAAA). In the second dataset (SARS-CoV) and third dataset (MERS-CoV), no sequences of size N between 21 and 28 were found. Sequence 1 and Sequence 2 were input into BLAST® â« blastn and recognized by the platform. The gene identified by the sequences found by the algorithm was the ORF1ab region of SARS-CoV-2. Considerable progress in antisense RNA research has been made in recent years, and great achievements in the application of antisense RNA have been observed. However, many mechanisms of antisense RNA are not yet understood. Thus, more time and money must be invested into the development of therapies for gene regulation mediated by antisense RNA to treat COVID-19 as no effective therapy for this disease has yet been found.
Assuntos
COVID-19/genética , RNA Antissenso/genética , SARS-CoV-2/genética , Algoritmos , COVID-19/virologia , Simulação por Computador , Regulação Viral da Expressão Gênica , HumanosRESUMO
This study aimed to evaluate the validity and precision of the International Physical Activity Questionnaire (IPAQ) for climacteric women using computational intelligence techniques. The instrument was applied to 873 women aged between 40 and 65 years. Considering the proposal to regroup the set of data related to the level of physical activity of climacteric women using the IPAQ, we used 2 algorithms: Kohonen and k-means, and, to evaluate the validity of these clusters, 3 indexes were used: Silhouette, PBM and Dunn. The questionnaire was tested for validity (factor analysis) and precision (Cronbach's alpha). The Random Forests technique was used to assess the importance of the variables that make up the IPAQ. To classify these variables, we used 3 algorithms: Suport Vector Machine, Artificial Neural Network and Decision Tree. The results of the tests to evaluate the clusters suggested that what is recommended for IPAQ, when applied to climacteric women, is to categorize the results into two groups. The factor analysis resulted in three factors, with factor 1 being composed of variables 3 to 6; factor 2 for variables 7 and 8; and factor 3 for variables 1 and 2. Regarding the reliability estimate, the results of the standardized Cronbach's alpha test showed values between 0.63 to 0.85, being considered acceptable for the construction of the construct. In the test of importance of the variables that make up the instrument, the results showed that variables 1 and 8 presented a lesser degree of importance and by the analysis of Accuracy, Recall, Precision and area under the ROC curve, there was no variation when the results were analyzed with all IPAQ variables but variables 1 and 8. Through this analysis, we concluded that the IPAQ, short version, has adequate measurement properties for the investigated population.
Assuntos
Inteligência Artificial , Climatério/fisiologia , Exercício Físico/fisiologia , Internacionalidade , Inquéritos e Questionários , Feminino , Humanos , Reprodutibilidade dos TestesRESUMO
OBJECTIVE: To determine new body mass index (BMI) reference values to classify the nutritional status of children aged six to ten years old from the city of Montes Claros (state of Minas Gerais), Southeast Brazil. METHODS: The sample consisted of 3,863 individuals from both genders. Body mass and height were measured to determine the BMI. We adopted the Lambda, Mu, and Sigma (LMS) method to obtain the cut-off points. After that, each stratum curve was smoothed using quartic polynomials by gender. Average interpolation was used to determine the biannual distribution values. We calculated the 3rd, 85th, and 95th centiles to classify underweight, overweight, and obesity, respectively, according to gender and age. RESULTS: After tabulating the LMS parameters at biannual intervals by gender, we plotted a graphic with seven centiles of BMI distribution and calculated the new BMI parameters for children aged 6-10 years old from the city of Montes Claros. The cut-off values for underweight, overweight, and obesity classification were, respectively, 17.5, 25 and 30 kg/m2. CONCLUSIONS: For the studied children, the use of traditional BMI references may result in the overestimation of underweight and underestimation of overweight and obesity. Studies should be carried out with periodic updates, respecting the characteristics of each location in order to use BMI reference values to classify the nutritional status of children and adolescents.
Assuntos
Índice de Massa Corporal , Estado Nutricional , Fatores Etários , Brasil , Criança , Estudos Transversais , Feminino , Humanos , Masculino , Obesidade Infantil/diagnóstico , Gravidez , Valores de Referência , Magreza/diagnósticoRESUMO
Oral Mucositis (OM) is a common adverse effect of head and neck squamous cell carcinoma (HNSCC) treatment. The purpose of this study was to investigate the significance of early changes in tissue electrical parameters (TEPs) in predicting the development of OM in HNSCC patients receiving radiation therapy (RT). The current study combined two study designs. The first was a case-control study. The control group comprised of RT patients who did not receive head and neck RT, and patients with HNSCC who received RT comprised the case group. In the second part of the study, the case group was included in a parallel cohort. A total of 320 patients were assessed for eligibility, and 135 patients were enrolled. Double blinding was performed, and neither the patients nor the care providers knew the measured parameters. The primary outcome was the detection of between-group changes in local TEPs over the follow-up period. The secondary outcome was the appearance of OM grades II, III, or IV and the predictive value of local TEPs in determining the incidence of OM after RT. The variables, impedance module, resistance, reactance, phase angle, and capacitance, were analyzed by the receiver operator curves (ROC). The case and control groups did not differ in demographic and clinical characteristics. Radiation therapy increased the local impedance module, resistance, reactance, and phase angle and reduced the local tissue capacitance in both groups. Evaluation of TEPs in the first week of RT correlated with the development of OM lesions during cancer therapy. ROC analysis showed that local impedance module and resistance presented higher specificity than did other parameters in predicting OM. In conclusion, local tissue electrical parameters measured at the first RT week can be useful tools to predict oral mucositis.
Assuntos
Fenômenos Eletrofisiológicos/efeitos da radiação , Carcinoma de Células Escamosas de Cabeça e Pescoço/radioterapia , Estomatite/diagnóstico , Estomatite/etiologia , Adulto , Idoso , Idoso de 80 Anos ou mais , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Sensibilidade e Especificidade , Carcinoma de Células Escamosas de Cabeça e Pescoço/patologia , Carcinoma de Células Escamosas de Cabeça e Pescoço/fisiopatologiaRESUMO
INTRODUCTION: Gallic acid (GA) is a natural endogenous polyphenol found in a variety of fruits, vegetables and wines, with beneficial effects on the energetic homeostasis. AIM: The present study aimed to investigate oral gallic acid effects on liver steatosis and hepatic lipogenesis markers in obese mice evaluating new possible molecular related mechanisms. METHODS: Twenty-four Swiss male mice were divided into four groups and fed for 60 days with standard diet (ST), standard diet plus gallic acid (ST + GA), high-fat diet (HFD), and high-fat diet plus gallic acid (HFD + GA). We evaluated the relationship between body weight, food intake and serum levels of total cholesterol, triglycerides, insulin, aspartate and alanine transaminases. Liver histology was analyzed by hematoxylin and eosin staining. These results were accompanied by bioinformatics analyses. The acetyl-CoA carboxylase (ACC), sterol regulatory element binding protein-1 (SREBP-1) and fatty acid synthase (FAS) expression was assessed by quantitative real-time reverse transcriptase PCR (qRT-PCR). RESULTS: The main findings of the present study showed that GA reduced liver steatosis, body weight and plasma insulin levels. Analyzes of hepatic steatosis related genes expression showed that ACC and FAS mRNA were significantly suppressed in liver of HFD + GA mice. These data was corroborated by bioinformatics analysis. CONCLUSION: These data suggest an important clinical application of GA in the prevention and treatment of liver diseases.
RESUMO
It is estimated that 7.6 million people will die as a consequence of head and neck squamous cell carcinoma (HNSCC). Genetic predisposition has emerged as an important risk factor in the development and prognosis of HNSCC. Considering this, the aim of the current study is to assess whether codon 72 SNP of the TP53 gene (rs1042522) is associated with an increased odds ratio of developing HNSCC or with a worse prognosis in patients with HNSCC. Analysis of the rs1042522 in HNSCC patients and in control individuals. Differences between the case and control groups were determined using chi-squared tests. Multivariate analysis was performed to evaluate the odds ratio of HNSCC. Fussy C Means Clustering was to cluster HNSCC patients for survival analyses. Time of survival was calculated using the Kaplan-Meier estimator and comparing this to the log rank test. Statistical significance was set at p < 0.05. A total of 71.4 % of the Arg/Arg genotype were from HNSCC patients, while only 28.6 % of Arg/Arg genotype were found in the control group. Logistic regression demonstrated that the Arg/Arg genotype, smoking, and alcohol consumption increase the odds ratio of HNSCC. No association between TP53 codon 72 polymorphism and P53 expression. No association between rs1042522 and survival or prognoses was observed. This study identified that individuals carrying the arginine allele at rs1042522 have an increased odds ratio of HNSCC. However, no association between codon 72 SNP of the TP53 gene and HNSCC prognosis or P53 expression was observed.
Assuntos
Carcinoma de Células Escamosas/genética , Predisposição Genética para Doença , Neoplasias de Cabeça e Pescoço/genética , Prognóstico , Proteína Supressora de Tumor p53/genética , Adulto , Idoso , Idoso de 80 Anos ou mais , Carcinoma de Células Escamosas/patologia , Carcinoma de Células Escamosas/radioterapia , Códon , Feminino , Regulação Neoplásica da Expressão Gênica , Frequência do Gene , Estudos de Associação Genética , Genótipo , Neoplasias de Cabeça e Pescoço/patologia , Neoplasias de Cabeça e Pescoço/radioterapia , Humanos , Estimativa de Kaplan-Meier , Masculino , Pessoa de Meia-Idade , Polimorfismo de Nucleotídeo Único/genética , Fatores de Risco , Carcinoma de Células Escamosas de Cabeça e Pescoço , Proteína Supressora de Tumor p53/biossínteseRESUMO
INTRODUCTION: Bioinformatics has emerged as an important tool to analyze the large amount of data generated by research in different diseases. In this study, gene expression for radicular cysts (RCs) and periapical granulomas (PGs) was characterized based on a leader gene approach. METHODS: A validated bioinformatics algorithm was applied to identify leader genes for RCs and PGs. Genes related to RCs and PGs were first identified in PubMed, GenBank, GeneAtlas, and GeneCards databases. The Web-available STRING software (The European Molecular Biology Laboratory [EMBL], Heidelberg, Baden-Württemberg, Germany) was used in order to build the interaction map among the identified genes by a significance score named weighted number of links. Based on the weighted number of links, genes were clustered using k-means. The genes in the highest cluster were considered leader genes. Multilayer perceptron neural network analysis was used as a complementary supplement for gene classification. RESULTS: For RCs, the suggested leader genes were TP53 and EP300, whereas PGs were associated with IL2RG, CCL2, CCL4, CCL5, CCR1, CCR3, and CCR5 genes. CONCLUSIONS: Our data revealed different gene expression for RCs and PGs, suggesting that not only the inflammatory nature but also other biological processes might differentiate RCs and PGs.
Assuntos
Biologia Computacional/métodos , Expressão Gênica , Redes Neurais de Computação , Granuloma Periapical/genética , Cisto Radicular/genética , Algoritmos , Redes Reguladoras de Genes , HumanosRESUMO
Antecedentes: La manera de evaluar los resultados de la cirugía colorrectal efectuada en condiciones de urgencia es un aspecto controvertido. La mayoría de los grupos utilizan para este análisis la medición de los índices de morbilidad y mortalidad postoperatoria. Varios sistemas de puntuación o scores son utilizados para tal fin. Los resultados obtenidos son dispares por lo cual ninguno de ellos tiene consenso para su utilización. Objetivos: Identificar los factores de riesgo que influyen en la mortalidad post operatoria en pacientes con patología colorrectal resecados en condiciones de urgencia. Evaluar estadísticamente su capacidad predictiva de mortalidad. Lugar de realización: Institución Privada Polivalente de alta complejidad. Diseño: Estudio observacional, retrospectivo, en lote de atención consecutiva. Población: Pacientes con patología colorrectal resecados en condición de urgencia. Método: Análisis uni y multivariado de trece variables. Confección de una formula para predecir óbito y validación de la misma. Resultados: El ingreso del paciente por patologia isquémica, los valores del score ASA = o > a IV y de urea = o > a 80 mg %, son factores predictores de óbito en pacientes sometidos a cirugía de urgencia por patología colorrectal. A partir de los datos del modelo predictivo final se construyó la siguiente fórmula de predicción de óbito: (1/1 + exp (-2.2+2.9 X1+1.8 X2+1.7 X3)). Los valores de cribaje de la fórmula de predictibilidad de óbito fueron los siguientes: Sensibilidad 37% (lC 95% 19.3-57.7%). Especificidad 94.2% (lC 95% 84-98.8%). Valor predictivo positivo 76.9% (IC 95% 46.1-95.1%). Valor predictivo negativo 74.2% (lC 95% 62-84.3%). Razón de verosimilitud positiva 6.4 (lC 95% 1.92 -21.3). Razón de verosimilitud negativa 0.66 (IC 95% 0.49-0.89). Área bajo la curva (AUC) = 0.656 (lC 95% 0.54-0.76).
Background: The way to evaluate the results of rectocolonic surgery in emergency conditions is a controversial aspect at present. The majority of the groups use for this analysis the measurement of the indices of morbidity and postoperative mortality. Several systems of score of scores are used for such aim. The obtained results are different, insufficient and uncertain, thus no of has a unanimous consensus for its use. Objectives: Identify which are the risk factors that influence in mortality in patients underwent to emergency colorectal surgery. Evaluate the capacity to predict mortality of those significative statistics factor. Place: High complexity private institution. Design: Consecutive, observational and retrospective. Patients: Patients underwent to emergency dry out colorectal surgery. Method: Analysis uni and multivariable of thirteen variables, preparation of a formula to predict death and its validation. Results: Ischemic disease, ASA score = or > IV and plasmatic urea = or > 80 mg% are predictors factor of death in patients undergo to emergency colorectal surgery. A prediction of death formula was done using the information of final predict model: (1/1 + exp - (-2.2+2.9 X 1+ 1.8 X2+1.7 X3)). The results of this formula were: Sensibility: 37% (lC 95% 19.3-57.7%). Specificity: 94.2% (lC 95% 84-98.8%). Positive Predictive Value: 76.9% (IC 95% 46.1-95.1%). Negative Predictive Value: 74.2% (lC 95% 62-84.3%). Positive Probability Reason: 6.4 (lC 95% 1.92 -21.3). Negative Probability Reason: 0.66 (IC 95% 0.49-0.89). Area under a Curve (AUC) = 0.656 (lC 95% 0.54-0.76).