Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 20
Filtrar
Mais filtros











Intervalo de ano de publicação
1.
Clin Transl Oncol ; 23(1): 82-91, 2021 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-32462395

RESUMO

BACKGROUND: The prognostic role of intratumoral programmed cell death ligand 1 (PD-L1) expression in hepatocellular carcinoma (HCC) has been investigated by several meta-analyses. However, the prognostic value of pretreatment peripheral PD-L1 (PPPD-L1) level in HCC remains undetermined. Thus, this systemic review aimed to establish PPPD-L1 as a new prognostic marker in HCC according to available evidence. METHODS: Case-control studies investigating the prognostic role of PPPD-L1 in HCC were systemically sought in the database of PubMed and Web of Science until March 25th, 2020. Our main concern is survival results, including overall survival (OS), disease-free survival (DFS), and progression-free survival (PFS). The combined results were summarized in narrative form according to data extracted from each included study. RESULTS: Finally, nine studies published from 2011 to 2019, were incorporated into this systemic review. Among these, six studies evaluated the PD-L1 expression by enzyme-linked immunosorbent assay (ELISA) from blood serum, and three studies evaluated the PD-L1 expression by flow cytometric analysis from peripheral blood mononuclear cells (PBMC). According to the extracted evidence, high PPPD-L1 expression, measured in either blood serum or PBMC, is associated with poor OS, poor DFS, and poor PFS. Meanwhile, PPPD-L1 was also correlated with enlarged tumor size and more likely with advanced tumor stage as well as vascular invasion. CONCLUSION: High PPPD-L1 level is associated with increased mortality rate and increased recurrence rate in HCC. As a convenient serum marker, PPPD-L1 could be a promising marker of prognosis in HCC patients.


Assuntos
Antígeno B7-H1/sangue , Biomarcadores Tumorais/sangue , Carcinoma Hepatocelular/sangue , Neoplasias Hepáticas/sangue , Carcinoma Hepatocelular/mortalidade , Estudos de Casos e Controles , Intervalo Livre de Doença , Humanos , Leucócitos Mononucleares/metabolismo , Neoplasias Hepáticas/mortalidade , Prognóstico , Intervalo Livre de Progressão
2.
R. bras. Ci. avíc. ; 21(2): eRBCA-2018-0868, nov. 2019. ilus, tab
Artigo em Inglês | VETINDEX | ID: vti-26246

RESUMO

Heat stress induces oxidative stress, and reduces body antioxidant metabolite levels, which can affect poultry production performance. Dietary antioxidants protect birds against the adverse effects of heat stress. The effects of increasing concentrations of dietary curcumin on the antioxidant parameters of layers maintained under high-temperature conditions for nine weeks were evaluated. Roman laying hens (n = 336, 22 weeks old, 1420 g BW) were divided into three treatment groups. The first group served as a thermoneutral control (kept at 25 ± 1 °C). The second group was exposed to high temperatures (32 ± 1 °C, 6 h/d), given a basal diet. The third group was further divided into five treatment groups (100, 150, 200, 250, 300 mg/kg Curcumin) fed a basal diet (treatments H1, H2, H3, H4, H5) under high temperatures conditions (32 ± 1 °C, 6 hours/day). As a result of this study, total superoxide dismutase activity was significantly higher in H2 and H3 groups, and total antioxidant capacity was higher in H2, H3, and H5 groups. Catalase and glutathione peroxidase activity was significantly higher in the H3 group. Malondialdehyde concentration was lowered in curcumin supplemented hens compared with control groups hens. Laying hens in all curcumin treatment groups had slightly higher activities of CAT, SOD, GSH-Px, and T-AOC in the liver, heart, and lungs, compared with heat stressed control group. It was concluded that dietary curcumin given to laying hens under heat stress may enhance their antioxidant status, and alleviate the detrimental effects of stressful environmental conditions.(AU)


Assuntos
Animais , Galinhas/fisiologia , Antioxidantes/análise , Curcumina/efeitos adversos , Curcumina/química , Temperatura Alta , Estresse Oxidativo
3.
Rev. bras. ciênc. avic ; 21(2): eRBCA, 2019. ilus, tab
Artigo em Inglês | VETINDEX | ID: biblio-1490641

RESUMO

Heat stress induces oxidative stress, and reduces body antioxidant metabolite levels, which can affect poultry production performance. Dietary antioxidants protect birds against the adverse effects of heat stress. The effects of increasing concentrations of dietary curcumin on the antioxidant parameters of layers maintained under high-temperature conditions for nine weeks were evaluated. Roman laying hens (n = 336, 22 weeks old, 1420 g BW) were divided into three treatment groups. The first group served as a thermoneutral control (kept at 25 ± 1 °C). The second group was exposed to high temperatures (32 ± 1 °C, 6 h/d), given a basal diet. The third group was further divided into five treatment groups (100, 150, 200, 250, 300 mg/kg Curcumin) fed a basal diet (treatments H1, H2, H3, H4, H5) under high temperatures conditions (32 ± 1 °C, 6 hours/day). As a result of this study, total superoxide dismutase activity was significantly higher in H2 and H3 groups, and total antioxidant capacity was higher in H2, H3, and H5 groups. Catalase and glutathione peroxidase activity was significantly higher in the H3 group. Malondialdehyde concentration was lowered in curcumin supplemented hens compared with control groups hens. Laying hens in all curcumin treatment groups had slightly higher activities of CAT, SOD, GSH-Px, and T-AOC in the liver, heart, and lungs, compared with heat stressed control group. It was concluded that dietary curcumin given to laying hens under heat stress may enhance their antioxidant status, and alleviate the detrimental effects of stressful environmental conditions.


Assuntos
Animais , Antioxidantes/análise , Curcumina/efeitos adversos , Curcumina/química , Galinhas/fisiologia , Temperatura Alta , Estresse Oxidativo
4.
R. bras. Ci. avíc. ; 20(3): 463-470, July-Sept. 2018. tab, ilus
Artigo em Inglês | VETINDEX | ID: vti-738619

RESUMO

The effects of oxidative stress induced by high temperature on the cell viability, proliferation, apoptosis and oxidative status of chicken embryonic fibroblasts (CEF) were analyzed. The viability, proliferation, apoptotic and anti-oxidative status were measured after incubating CEF at the temperatures of 37ºC (control) and 40-44ºC (experimental groups) for 6,12 and 24 hours. The results showed that at high temperature (42-43ºC), the viability of CEF cells decreased after 6, 12 and 24 h of incubation, but the difference was significant only at 43ºC. Cell proliferation was significantly reduced at 44oC/6h. The apoptotic rate of CEF cells was increased following heat treatments in a time-dependent manner. ROS formation increased with increasing temperature, but the difference was only significant at 44ºC/6,12h. Heat stress did not significantly affect the superoxide dismutase (SOD) activity. CAT activity was significantly decreased at 43ºC/24h and 44ºC/12 and 24h. Malondialdehyde (MDA) formation was significantly increased at 43ºC/12h and 44ºC/12 and 24h. In conclusion, heat stress induced the oxidative stress, decreasing the viability, proliferation and anti-oxidative response of CEF cells.(AU)


Assuntos
Animais , Embrião de Galinha , Estresse Oxidativo , Temperatura Alta/efeitos adversos , Fibroblastos , Transtornos de Estresse por Calor/complicações , Transtornos de Estresse por Calor/veterinária , Proliferação de Células , Apoptose
5.
Rev. bras. ciênc. avic ; 20(3): 463-470, July-Sept. 2018. tab, ilus
Artigo em Inglês | VETINDEX | ID: biblio-1490541

RESUMO

The effects of oxidative stress induced by high temperature on the cell viability, proliferation, apoptosis and oxidative status of chicken embryonic fibroblasts (CEF) were analyzed. The viability, proliferation, apoptotic and anti-oxidative status were measured after incubating CEF at the temperatures of 37ºC (control) and 40-44ºC (experimental groups) for 6,12 and 24 hours. The results showed that at high temperature (42-43ºC), the viability of CEF cells decreased after 6, 12 and 24 h of incubation, but the difference was significant only at 43ºC. Cell proliferation was significantly reduced at 44oC/6h. The apoptotic rate of CEF cells was increased following heat treatments in a time-dependent manner. ROS formation increased with increasing temperature, but the difference was only significant at 44ºC/6,12h. Heat stress did not significantly affect the superoxide dismutase (SOD) activity. CAT activity was significantly decreased at 43ºC/24h and 44ºC/12 and 24h. Malondialdehyde (MDA) formation was significantly increased at 43ºC/12h and 44ºC/12 and 24h. In conclusion, heat stress induced the oxidative stress, decreasing the viability, proliferation and anti-oxidative response of CEF cells.


Assuntos
Animais , Embrião de Galinha , Estresse Oxidativo , Fibroblastos , Temperatura Alta/efeitos adversos , Transtornos de Estresse por Calor/complicações , Transtornos de Estresse por Calor/veterinária , Apoptose , Proliferação de Células
6.
Clin Transl Oncol ; 20(7): 853-861, 2018 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-29134563

RESUMO

PURPOSE: The aim of this meta-analysis was to investigate preoperative plasma fibrinogen (PPF) as a prognostic marker in esophageal carcinoma (EC) by meta-analysis. METHODS: Relevant studies were sought in the databases including Pubmed, Web of Science, Cochrane library, and Wanfang databases up to Oct 10th, 2017. Hazard ratios (HRs) with corresponding 95% confidence intervals (CIs) were used as effective value, and pooled HRs were synthesized by STATA 14.0 to assess the prognostic impact of PPF on EC patients. RESULTS: A total of 8 studies with 2827 patients were collected in this meta-analysis. Our results revealed that high PPF was significantly associated with poor OS (HR = 1.90, 95% CI 1.56-2.33, P = 0.000; HR = 1.76, 95% CI 1.28-2.42, P = 0.000) and poor DFS (HR = 1.91, 95% CI 1.50-2.43, P = 0.000; HR = 1.51, 95% CI 1.16-1.97, P = 0.000) in EC patients from univariate and multivariate analysis results, respectively, which suggested that EC patients with high PPF will suffer from high postoperative mortality and recurrence rate. CONCLUSION: High PPF was significantly associated with poor OS and DFS in EC patients. Fibrinogen can serve as a prognostic marker and even a future targeting molecule during the treatment of EC patients.


Assuntos
Biomarcadores Tumorais/sangue , Neoplasias Esofágicas/sangue , Fibrinogênio/análise , Recidiva Local de Neoplasia/sangue , Neoplasias Esofágicas/patologia , Neoplasias Esofágicas/cirurgia , Humanos , Recidiva Local de Neoplasia/patologia , Recidiva Local de Neoplasia/cirurgia , Cuidados Pré-Operatórios , Prognóstico
7.
Artigo em Inglês | VETINDEX | ID: vti-739138

RESUMO

ABSTRACT The effects of oxidative stress induced by high temperature on the cell viability, proliferation, apoptosis and oxidative status of chicken embryonic fibroblasts (CEF) were analyzed. The viability, proliferation, apoptotic and anti-oxidative status were measured after incubating CEF at the temperatures of 37ºC (control) and 40-44ºC (experimental groups) for 6,12 and 24 hours. The results showed that at high temperature (42-43ºC), the viability of CEF cells decreased after 6, 12 and 24 h of incubation, but the difference was significant only at 43ºC. Cell proliferation was significantly reduced at 44oC/6h. The apoptotic rate of CEF cells was increased following heat treatments in a time-dependent manner. ROS formation increased with increasing temperature, but the difference was only significant at 44ºC/6,12h. Heat stress did not significantly affect the superoxide dismutase (SOD) activity. CAT activity was significantly decreased at 43ºC/24h and 44ºC/12 and 24h. Malondialdehyde (MDA) formation was significantly increased at 43ºC/12h and 44ºC/12 and 24h. In conclusion, heat stress induced the oxidative stress, decreasing the viability, proliferation and anti-oxidative response of CEF cells.

8.
R. bras. Ci. avíc. ; 19(2): 203-210, abr.-jun. 2017. tab, graf
Artigo em Inglês | VETINDEX | ID: vti-16977

RESUMO

To study the development rules of Chinese native geese, two breeds, Shitou and Sichuan White geese were analyzed from 0 to 12 weeks of age. The growth curves were fitted with commonly used four kinds of nonlinear models (Logistic, Gompertz, Von Bertalanffy and Richards). The results showed that the growth curves were appropriately fitted with all four models but the Logistic and Richards both had the best fitting with growth curve (R2>0.99). Analyzing the fitting parameters of the Logistic and Richards, we found that male Shitou had the highest adult body weight while Sichuan White female had the lowest weight. In Shitou breed, Shape parameter Predicted with Richards model was corresponded with Gompertz curve, while in Sichuan breed it was in between Gompertz and Bertalanffy. Growth parameters predicted with Logistic model was much more closed to observed value as compared others. So overall logistic was the best model to analyze the growth curve in Chinese native goose and Shitou goose had excellent growth performance when compared to Sichuan White.(AU)


Assuntos
Animais , Recém-Nascido , Gansos/crescimento & desenvolvimento , Gansos/fisiologia , Crescimento/fisiologia , Peso Fetal
9.
Rev. bras. ciênc. avic ; 19(2): 203-210, abr.-jun. 2017. tab, graf
Artigo em Inglês | VETINDEX | ID: biblio-1490413

RESUMO

To study the development rules of Chinese native geese, two breeds, Shitou and Sichuan White geese were analyzed from 0 to 12 weeks of age. The growth curves were fitted with commonly used four kinds of nonlinear models (Logistic, Gompertz, Von Bertalanffy and Richards). The results showed that the growth curves were appropriately fitted with all four models but the Logistic and Richards both had the best fitting with growth curve (R2>0.99). Analyzing the fitting parameters of the Logistic and Richards, we found that male Shitou had the highest adult body weight while Sichuan White female had the lowest weight. In Shitou breed, Shape parameter Predicted with Richards model was corresponded with Gompertz curve, while in Sichuan breed it was in between Gompertz and Bertalanffy. Growth parameters predicted with Logistic model was much more closed to observed value as compared others. So overall logistic was the best model to analyze the growth curve in Chinese native goose and Shitou goose had excellent growth performance when compared to Sichuan White.


Assuntos
Animais , Recém-Nascido , Crescimento/fisiologia , Gansos/crescimento & desenvolvimento , Gansos/fisiologia , Peso Fetal
10.
Genet Mol Res ; 15(3)2016 Jul 25.
Artigo em Inglês | MEDLINE | ID: mdl-27525868

RESUMO

Cerebroprotein hydrolysate is an extract from porcine brain tissue that acts on the central nervous system in various ways to protect neurons and improve memory, attention, and vigilance. This study examined the effect and mechanism of cerebroprotein hydrolysate on learning and memory in mice with scopolamine-induced impairment. Mice were given an intraperitoneal injection of scopolamine hydrobromide to establish a murine model of learning and memory impairment. After 35 successive days of cerebroprotein hydrolysate treatment, their behaviors were observed in the Morris water maze and step-down test. Superoxide dismutase (SOD), Na(+)-K(+)-ATPase, and acetylcholinesterase (AChE) activity, and malondialdehyde (MDA), γ-aminobutyric acid (GABA), and glutamic acid (Glu) levels in the brain tissue of the mice were determined, and pathological changes in the hippocampus were examined. The results of the water-maze test showed that cerebroprotein hydrolysate shortened the escape latency and increased the number of platform crossings. In the step-down test, cerebroprotein hydrolysate treatment prolonged the step-down latency and reduced the number of errors; cerebroprotein hydrolysate increased the activity of SOD, Na(+)-K(+)-ATPase, and AChE, reduced the levels of MDA, decreased the Glu/GABA ratio in brain tissue, and reduced pathological changes in the hippocampus. The results indicate that cerebroprotein hydrolysate can improve learning and memory in mice with scopolamine-induced impairment. This effect may be associated with its ability to reduce injury caused by free radicals, improve acetylcholine function, and modulate the Glu/GABA learning and memory regulation system, reducing excitotoxicity caused by Glu.


Assuntos
Aminoácidos/farmacologia , Aprendizagem em Labirinto/efeitos dos fármacos , Memória/efeitos dos fármacos , Acetilcolinesterase/metabolismo , Animais , Encéfalo/efeitos dos fármacos , Encéfalo/metabolismo , Hipocampo/metabolismo , Masculino , Malondialdeído/metabolismo , Transtornos da Memória/tratamento farmacológico , Camundongos , Camundongos Endogâmicos ICR , Neurônios/efeitos dos fármacos , Neurônios/metabolismo , Fármacos Neuroprotetores/farmacologia , Superóxido Dismutase/metabolismo , Suínos
11.
Genet Mol Res ; 15(2)2016 Jun 03.
Artigo em Inglês | MEDLINE | ID: mdl-27323143

RESUMO

The aim of this study was to investigate the association between four single nucleotide polymorphisms in NR3C1 (Tth111I, BclI, ER22/23EK, and N363S), which encode the glucocorticoid receptor, and asthma susceptibility in patients from the Henan Province of China. Three hundred and twenty-eight patients with asthma and 60 healthy volunteers were recruited to this study. The target SNPs were genotyped by polymerase chain reaction (PCR)-high resolution melting and PCR-restriction fragment length polymorphism. The frequencies of the AA (8.84%) and GG (30.79%) genotypes of Tth111I were higher, and that of the AG genotype was lower (60.37%), in the asthma patients compared to that seen in healthy controls (5.00, 26.67, and 68.33%, respectively). On the other hand, asthma patients showed higher frequencies of the AA genotype (78.05%) of N363S, and lower frequencies of the AG and GG genotypes (15.55 and 6.40%), compared to healthy volunteers (71.67, 18.33, and 10.00%, respectively). Neither of these differences were found to be statistically significant. Moreover, we observed no significant differences in the genotype or allele frequencies of the BclI and ER22/23EK SNPs between the patient and control groups. In conclusion, SNPs in NR3C1 were not significantly associated with asthma in patients from the Henan Province. Patients showed higher frequencies of the AA and GG genotypes of Tth111I and the AA genotype of the N363S SNP compared to healthy volunteers, although these differences were not significant.


Assuntos
Asma/genética , Estudos de Associação Genética , Predisposição Genética para Doença , Receptores de Glucocorticoides/genética , Adolescente , Adulto , Idoso , Povo Asiático , Asma/patologia , China , Feminino , Frequência do Gene , Genótipo , Humanos , Masculino , Pessoa de Meia-Idade , Polimorfismo de Nucleotídeo Único/genética
12.
Genet Mol Res ; 15(2)2016 Apr 27.
Artigo em Inglês | MEDLINE | ID: mdl-27173271

RESUMO

Chronic obstructive pulmonary disease (COPD) is an important respiratory disease with high mortality. Although smoking is the major environmental risk factor for the development of COPD, only 10% of heavy smokers develop symptomatic disease, suggesting association between genetic susceptibilities and environmental influences. In recent years, as one of the most widely studied genes including tests for associations between a genetic variant and COPD, epoxide hydrolase 1 (EPHX1) was found to be involved in the metabolism of tobacco smoke, an important risk factor of COPD. However, genetic associations with COPD identified in studies on EPHX1 are controversial. To address this issue, except for performing the meta-analysis, which specially added our current study on two polymorphisms (T337C and A416G) of EPHX1, we performed combined data mining based on functional prediction algorithms of nonsynonymous single-nucleotide polymorphisms and gene-based variable threshold testing. Genetic variations in EPHX1 did not affect COPD in Caucasian and Eastern Asian population, which is supported by recent evidence. We found no association between EPHX1 and COPD; however, a minor effect of EPHX1 on COPD risk was not completely excluded; further replication studies with large samples are needed to confirm our findings.


Assuntos
Epóxido Hidrolases/genética , Polimorfismo de Nucleotídeo Único , Doença Pulmonar Obstrutiva Crônica/genética , Adulto , Idoso , Estudos de Casos e Controles , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Mutação de Sentido Incorreto
13.
Genet Mol Res ; 14(4): 17244-51, 2015 Dec 17.
Artigo em Inglês | MEDLINE | ID: mdl-26681218

RESUMO

LIM domain kinase 1 (LIMK1), an actin-binding kinase, can phosphorylate and inactivate its substrates, and can regulate long-term memory and synaptic plasticity. Both ß-amyloid precursor protein (App) and presenilin (PS) are functional degeneration factors during early neuronal development, and are considered as potential factors that contribute to the development of Alzheimer's disease (AD). However, hardly any information is available about the distribution and expression of LIMK1. Thus, using the App and PS deficient mice, the role of LIMK1 was demonstrated in the absence of App and PS. Our results showed that LIMK1 was present in the nerve fiber layer and external plexiform layer of the olfactory bulb, as well as in the mitral cells and Purkinje cells of the cerebellum in App and PS deficient mice. Additionally, LIMK1 was concentrated in the granule cell layer of the olfactory bulb and cerebellum and LIMK1 positive cells were located in the CA1 region of the hippocampus. Our study indicates that there is a connection between LIMK1 and AD in the mouse model of AD. This might explain neurological problems such as cerebellar ataxia, impaired long-term memory, and impaired synaptic plasticity observed in AD.


Assuntos
Cerebelo/metabolismo , Córtex Cerebral/metabolismo , Hipocampo/metabolismo , Quinases Lim/metabolismo , Bulbo Olfatório/metabolismo , Doença de Alzheimer/genética , Doença de Alzheimer/metabolismo , Precursor de Proteína beta-Amiloide/genética , Precursor de Proteína beta-Amiloide/metabolismo , Animais , Modelos Animais de Doenças , Expressão Gênica , Heterozigoto , Imuno-Histoquímica , Quinases Lim/genética , Camundongos , Camundongos Transgênicos , Presenilinas/genética , Presenilinas/metabolismo
14.
Genet Mol Res ; 14(3): 8725-32, 2015 Jul 31.
Artigo em Inglês | MEDLINE | ID: mdl-26345804

RESUMO

We aimed to evaluate the levels of growth factors in the cerebrospinal fluid (CSF) of patients with autism after transplantation of umbilical cord blood mononuclear cells (CBMNCs). Fourteen subjects diagnosed with autism received transplantation of CBMNCs first through intravenous infusion, and three times subsequently through intrathecal injections. A 2-mL sample of CSF was taken before each intrathecal injection. CSF levels of nerve growth factor (NGF), vascular endothelial growth factor (VEGF), and basic fibroblast growth factor (bFGF) were determined by enzyme-linked immunosorbent assay. All data are reported as means ± SD and were analyzed using the SPSS 10.0 software. One-way analysis of variance with post-hoc F-and Q-tests were performed for comparisons. NGF levels in the CSF were significantly increased after transplantation (213.54 ± 56.38 after the third versus 28.32 ± 12.22 ng/L after the first transplantation; P < 0.05), while VEGF and bFGF levels did not change significantly. Therefore, transplantation of CBMNCs could increase NGF levels in the CSF of patients with autism.


Assuntos
Transtorno Autístico/líquido cefalorraquidiano , Sangue Fetal/citologia , Leucócitos Mononucleares/transplante , Fator de Crescimento Neural/líquido cefalorraquidiano , Transtorno Autístico/terapia , Criança , Pré-Escolar , Feminino , Fator 2 de Crescimento de Fibroblastos/líquido cefalorraquidiano , Humanos , Masculino , Resultado do Tratamento , Fator A de Crescimento do Endotélio Vascular/líquido cefalorraquidiano
15.
Genet Mol Res ; 14(2): 7184-95, 2015 Jun 29.
Artigo em Inglês | MEDLINE | ID: mdl-26125929

RESUMO

This study investigated the effects of pregnant mare se-rum gonadotropin (PMSG) and cloprostenol (CLO) on estrus induc-tion and synchronization, uterine development, and follicle-stimulating hormone receptor (FSHR) expression in mice. A total of 105 Kunming pre-puberty mice were divided into seven subgroups. Three PMSG sub-groups were injected intraperitoneally with 10, 20, and 40 IU PMSG twice (on days 0 and 4), and three CLO subgroups were injected intra-peritoneally with 10, 15, and 20 µg cloprostenol acetate twice (on days 0 and 4). The results showed that 93.33 and 66.67% of synchronized mice displayed estrus within 18.68-37.59 h following CLO and PMSG exposure, respectively. Estrus numbers, estrus onset time, and estrus rates in CLO and PMSG groups were greater than in control groups (CG) (P < 0.05). Uterine weights of the PMSG group were higher than that of CLO and CG groups, and the uterine horn longitudinal diameters in experimental mice were greater than CG. Expression levels of FSHR proteins in CLO and PMSG groups increased slightly when compared to CG. In conclusion, CLO and PMSG administration did not clearly af-fect the expression of uterine FSHR proteins in mice. Moreover, PMSG and CLO treatments synchronized estrus and enhanced the uterine de-velopment of mice. The efficacy of CLO on estrus synchronization was greater than PMSG, and the effects of PMSG on uterine development were stronger than CLO. These results have important significance re-garding the modulation of animal reproductive functions.


Assuntos
Cloprostenol/farmacologia , Estro/efeitos dos fármacos , Gonadotropinas Equinas/farmacologia , Luteolíticos/farmacologia , Receptores do FSH/genética , Útero/efeitos dos fármacos , Animais , Estro/fisiologia , Feminino , Expressão Gênica/efeitos dos fármacos , Cavalos , Injeções Intraperitoneais , Camundongos , Tamanho do Órgão/efeitos dos fármacos , Gravidez , Receptores do FSH/metabolismo , Maturidade Sexual/efeitos dos fármacos , Maturidade Sexual/fisiologia , Útero/crescimento & desenvolvimento , Útero/metabolismo
16.
Genet Mol Res ; 14(2): 5304-9, 2015 May 18.
Artigo em Inglês | MEDLINE | ID: mdl-26125726

RESUMO

Swainsonine (SW), an extract from Astragalus membranaceus, represents a new class of compounds that inhibit growth and induce apoptosis in a cancer model. In this study, we demonstrated the effect of Fyn on SW-induced apoptosis in 293T cells. Western blotting was used to measure the expression of the apoptosis-related factors caspase-3, Bcl-2, Bax, and the key factor Akt (also known as protein kinase B). Apoptosis increased dramatically after treatment with SW. Unlike the control group, after transfection with Fyn, the expression of Bcl-2, in contrast to Bax, was markedly upregulated. The results also showed that the protein expression levels of Akt and phosphorylated Akt were markedly increased. Our results establish that Fyn can arrest SW-induced apoptosis via the activity of Akt and its effective phosphorylation in 293T cells.


Assuntos
Apoptose/efeitos dos fármacos , Neoplasias/tratamento farmacológico , Proteína Oncogênica v-akt/genética , Proteínas Proto-Oncogênicas c-fyn/genética , Swainsonina/administração & dosagem , Astragalus propinquus/química , Células HEK293 , Humanos , Neoplasias/genética , Neoplasias/patologia , Fosforilação/efeitos dos fármacos , Extratos Vegetais/administração & dosagem , Extratos Vegetais/química , Proteínas Proto-Oncogênicas c-bcl-2/biossíntese , Transdução de Sinais/efeitos dos fármacos , Proteína X Associada a bcl-2/biossíntese
17.
Rev. bras. pesqui. méd. biol ; Braz. j. med. biol. res;48(1): 39-45, 01/2015. graf
Artigo em Inglês | LILACS | ID: lil-730436

RESUMO

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

18.
Braz J Med Biol Res ; 48(1): 39-45, 2015 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-25493381

RESUMO

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

19.
J Parasitol Res ; 2014: 514794, 2014.
Artigo em Inglês | MEDLINE | ID: mdl-24719753

RESUMO

Background. The prevalence of Chagas disease in endemic countries varies with the kind of vector involved and the socioeconomic conditions of the population of origin. Due to recent immigration it is an emerging public health problem in Europe, especially in those countries which receive immigrant populations with a high prevalence of carriers. The study reviews the impact of the disease on Bolivian immigrants living in Europe, the preventive measures and regulations applied in European countries, and their repercussion on possible stigmatization of certain population groups. Methods. The Bolivian immigrant population resident in 2012 was estimated and the affected population in different European countries was calculated with data on carrier prevalence that were recently published. The preventive measures and regulations available in Europe were also reviewed. MEDLINE-PubMed, GoPubMed, and Embase were consulted for the literature review. Results. The Bolivian immigrant population has the highest prevalence of Chagas carriers (6.7%-25%) compared to the overall Latin American population (1.3%-2.4%). Only in Spain, France, Belgium, UK, Portugal, Italy, Switzerland, The Netherlands, and Germany, preventive measures are applied to this population. The established regulations are insufficient and completely different criteria are applied in the different countries and this could reflect a certain degree of stigmatization.

20.
Genet Mol Res ; 12(3): 2725-39, 2013 Jul 30.
Artigo em Inglês | MEDLINE | ID: mdl-23979897

RESUMO

Mastitis is an economically devastating disease affecting the dairy industry. Dairy cows with mastitis give reduced milk yield and produce milk that is unfit for consumption. The chemokine receptor CXCR1 is an excellent prospective genetic marker for mastitis resistance in cattle because it regulates neutrophil migration, killing, and survival during infection. We detected 4 single nucleotide polymorphisms (SNPs) of the CXCR1 gene in Chinese native cattle and analyzed their associations with milk traits. Screening for genetic variations in CXCR1 among 648 Chinese Holstein, Luxi Yellow, and Bohai Black cattle by created restriction site polymerase chain reaction (PCR), nested PCR, and DNA sequencing revealed 4 new SNPs with allelic frequencies ranging from 0.676 to 0.821, 0.706 to 0.803, 0.647 to 0.824, and 0.558 to 0.581. All four CXCR1 gene SNPs were located in exon II. Two SNPs, c.337A>G and c.365C>T, were nonsynonymous mutations [ATC (Ile) > GTC (Val) and GCC (Ala) > GTC (Val)], whereas two, c.291C>T and c.333C>T, were synonymous mutations [TTC (Gly) > TTT (Gly) and GGC (Phe) > GGT (Phe)]. Statistical analyses revealed the significant association of c.337A>G and c.365C>T with the somatic cell score, which suggests the possible role of these SNPs in the host response against mastitis. Our data suggest that combined genotypes CCAC/CCGC, CCAC/CTAT, and CCAT/CTAT (lowest somatic cell scores); CTAC/CTAT (highest protein rate); CCAC/CTGC (highest fat rate); and CCAT/CTAT (highest 305-day milk yield) can be used as possible candidates for marker-assisted selection in dairy cattle breeding programs.


Assuntos
Bovinos/genética , Lactação/genética , Polimorfismo de Nucleotídeo Único , Receptores de Interleucina-8A/genética , Animais , Animais Endogâmicos , Éxons , Feminino , Estudos de Associação Genética , Mastite Bovina/genética , Leite/metabolismo , Mutação , Característica Quantitativa Herdável
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA