RESUMEN

Tissues release microRNAs (miRNAs) in small extracellular vesicles (sEVs) including exosomes, which can regulate gene expression in distal cells, thus acting as modulators of local and systemic metabolism. Here, we show that insulin regulates miRNA secretion into sEVs from 3T3-L1 adipocytes and that this process is differentially regulated from cellular expression. Thus, of the 53 miRNAs upregulated and 66 miRNAs downregulated by insulin in 3T3-L1 sEVs, only 12 were regulated in parallel in cells. Insulin regulated this process in part by phosphorylating hnRNPA1, causing it to bind to AU-rich motifs in miRNAs, mediating their secretion into sEVs. Importantly, 43% of insulin-regulated sEV-miRNAs are implicated in obesity and insulin resistance. These include let-7 and miR-103, which we show regulate insulin signaling in AML12 hepatocytes. Together, these findings demonstrate an important layer to insulin's regulation of adipose biology and provide a mechanism of tissue crosstalk in obesity and other hyperinsulinemic states.

Asunto(s)

Vesículas Extracelulares , Insulina , MicroARNs , Animales , Humanos , Ratones , Células 3T3-L1 , Adipocitos/metabolismo , Adipocitos/efectos de los fármacos , Vesículas Extracelulares/metabolismo , Regulación de la Expresión Génica , Hepatocitos/metabolismo , Ribonucleoproteína Nuclear Heterogénea A1/metabolismo , Ribonucleoproteína Nuclear Heterogénea A1/genética , Insulina/metabolismo , Resistencia a la Insulina , MicroARNs/metabolismo , MicroARNs/genética , Obesidad/metabolismo , Obesidad/genética , Fosforilación , Transducción de Señal

RESUMEN

Podocytes maintain renal filtration integrity when the glomerular filtration barrier (GFB) is integrated. Impairment or attrition of podocytes, leading to compromised GFB permeability, constitutes the primary etiology of proteinuria and is a hallmark pathological feature of diabetic nephropathy (DN). This study centers on Heterogeneous Nuclear Ribonucleoprotein I (HNRNP I), an RNA-binding protein, delineating its role in facilitating DN-induced renal damage by modulating podocyte health. Comparative analyses in renal biopsy specimens from DN patients and high-glucose-challenged podocyte models in vitro revealed a marked downregulation of HNRNP I expression relative to normal renal tissues and podocytes. In vitro assays demonstrated that high-glucose conditions precipitated a significant reduction in podocyte viability and an escalation in markers indicative of apoptosis. Conversely, HNRNP I overexpression was found to restore podocyte viability and attenuate apoptotic indices. IRAK1, a gene encoding a protein integral to inflammatory signaling, was shown to interact with HNRNP I, which promotes IRAK1 degradation. This interaction culminates in suppressing the PI3K/AKT/mTOR signaling pathway, thereby diminishing podocyte apoptosis and mitigating renal damage in DN. This investigation unveils the mechanistic role of HNRNP I in DN for the first time, potentially informing novel therapeutic strategies for DN renal impairment.

Asunto(s)

Apoptosis , Nefropatías Diabéticas , Quinasas Asociadas a Receptores de Interleucina-1 , Podocitos , Transducción de Señal , Podocitos/metabolismo , Podocitos/patología , Nefropatías Diabéticas/metabolismo , Nefropatías Diabéticas/etiología , Nefropatías Diabéticas/patología , Humanos , Quinasas Asociadas a Receptores de Interleucina-1/metabolismo , Quinasas Asociadas a Receptores de Interleucina-1/genética , Proteolisis , Inflamación , Serina-Treonina Quinasas TOR/metabolismo , Glucosa/metabolismo , Ribonucleoproteína Nuclear Heterogénea A1/metabolismo , Ribonucleoproteína Nuclear Heterogénea A1/genética

RESUMEN

Biomolecular condensates (BMCs) exhibit physiological and pathological relevance in biological systems. Both liquid and solid condensates play significant roles in the spatiotemporal regulation and organization of macromolecules and their biological activities. Some pathological solid condensates, such as Lewy Bodies and other fibrillar aggregates, have been hypothesized to originate from liquid condensates. With the prevalence of BMCs having functional and dysfunctional roles, it is imperative to understand the mechanism of biomolecular condensate formation and initiation. Using the low-complexity domain (LCD) of heterogenous ribonuclear protein A1 (hnRNPA1) as our model, we monitored initial assembly events using dynamic light scattering (DLS) while modulating pH and salt conditions to perturb macromolecule and condensate properties. We observed the formation of nanometer-sized BMCs (nano-condensates) distinct from protein monomers and micron-sized condensates. We also observed that conditions that solubilize micron-sized protein condensates do not solubilize nano-condensates, indicating that the balance of forces that stabilize nano-condensates and micron-sized condensates are distinct. These findings provide insight into the forces that drive protein phase separation and potential nucleation structures of macromolecular condensation.

Asunto(s)

Dispersión Dinámica de Luz , Ribonucleoproteína Nuclear Heterogénea A1 , Humanos , Ribonucleoproteína Nuclear Heterogénea A1/metabolismo , Ribonucleoproteína Nuclear Heterogénea A1/química , Dominios Proteicos , Condensados Biomoleculares/química , Condensados Biomoleculares/metabolismo , Concentración de Iones de Hidrógeno

RESUMEN

The functional properties of RNA binding proteins (RBPs) require allosteric regulation through interdomain communication. Despite the importance of allostery to biological regulation, only a few studies have been conducted to describe the biophysical nature by which interdomain communication manifests in RBPs. Here, we show for hnRNP A1 that interdomain communication is vital for the unique stability of its amino-terminal domain, which consists of two RNA recognition motifs (RRMs). These RRMs exhibit drastically different stability under pressure. RRM2 unfolds as an individual domain but remains stable when appended to RRM1. Variants that disrupt interdomain communication between the tandem RRMs show a significant decrease in stability. Carrying these mutations over to the full-length protein for in vivo experiments revealed that the mutations affected the ability of the disordered carboxyl-terminal domain to engage in protein-protein interactions and influenced the protein's RNA binding capacity. Collectively, this work reveals that thermodynamic coupling between the tandem RRMs of hnRNP A1 accounts for its allosteric regulatory functions.

Asunto(s)

Ribonucleoproteína Nuclear Heterogénea A1 , Unión Proteica , Motivo de Reconocimiento de ARN , ARN , Termodinámica , Ribonucleoproteína Nuclear Heterogénea A1/metabolismo , Ribonucleoproteína Nuclear Heterogénea A1/genética , Ribonucleoproteína Nuclear Heterogénea A1/química , ARN/metabolismo , ARN/química , ARN/genética , Humanos , Mutación , Regulación Alostérica , Dominios Proteicos , Modelos Moleculares , Estabilidad Proteica

RESUMEN

Hepatocellular carcinoma (HCC), the leading cause of cancer-related deaths worldwide, is characterised by rapid growth and marked invasiveness. Accumulating evidence suggests that deubiquitinases play a pivotal role in HCC growth and metastasis. However, the expression of the deubiquitinase FAM188B and its biological functions in HCC remain unknown. The aim of our study was to investigate the potential role of FAM188B in HCC. The expression of FAM188B was significantly upregulated in liver cancer cells compared to normal liver cells, both at the transcriptional and translational levels. Similarly, FAM188B expression was higher in liver cancer tissues than in normal liver tissues. Bioinformatic analysis revealed that high FAM188B expression was associated with poor prognosis in patients with HCC. We further demonstrated that FAM188B knockdown inhibited cell proliferation, epithelial-mesenchymal transition, migration and invasion both in vitro and in vivo. Mechanistically, FAM188B knockdown significantly inhibited the hnRNPA1/PKM2 pathway in HCC cells. FAM188B may inhibit ubiquitin-mediated degradation of hnRNPA1 through deubiquitination. Notably, we observed that the inhibitory effects of FAM188B knockdown on HCC cell proliferation, migration and invasion were reversed when hnRNPA1 expression was restored. In conclusion, FAM188B promotes HCC progression by enhancing the deubiquitination of hnRNPA1 and subsequently activating the hnRNPA1/PKM2 pathway. Therefore, targeting FAM188B is a potential strategy for HCC therapy.

Asunto(s)

Carcinoma Hepatocelular , Proteínas Portadoras , Proliferación Celular , Regulación Neoplásica de la Expresión Génica , Ribonucleoproteína Nuclear Heterogénea A1 , Neoplasias Hepáticas , Proteínas de la Membrana , Invasividad Neoplásica , Humanos , Carcinoma Hepatocelular/patología , Carcinoma Hepatocelular/genética , Carcinoma Hepatocelular/metabolismo , Neoplasias Hepáticas/patología , Neoplasias Hepáticas/genética , Neoplasias Hepáticas/metabolismo , Ribonucleoproteína Nuclear Heterogénea A1/metabolismo , Ribonucleoproteína Nuclear Heterogénea A1/genética , Proliferación Celular/genética , Proteínas de la Membrana/genética , Proteínas de la Membrana/metabolismo , Proteínas Portadoras/metabolismo , Proteínas Portadoras/genética , Ratones , Animales , Línea Celular Tumoral , Movimiento Celular/genética , Ratones Desnudos , Transición Epitelial-Mesenquimal/genética , Masculino , Ratones Endogámicos BALB C , Metástasis de la Neoplasia , Femenino

RESUMEN

BACKGROUND: Immunotherapies effectively treat human malignancies, but the low response and resistance are major obstacles. Neoantigen is an emerging target for tumor immunotherapy that can enhance anti-tumor immunity and improve immunotherapy. Aberrant alternative splicing is an important source of neoantigens. HNRNPA1, an RNA splicing factor, was found to be upregulated in the majority of tumors and play an important role in the tumor immunosuppressive microenvironment. METHODS: Whole transcriptome sequencing was performed on shHNRNPA1 SKOV3 cells and transcriptomic data of shHNRNPA1 HepG2, MCF-7M, K562, and B-LL cells were downloaded from the GEO database. Enrichment analysis was performed to elucidate the mechanisms underlying the activation of anti-tumor immunity induced by HNRNPA1 knockdown. mRNA alternative splicing was analyzed and neoantigens were predicted by JCAST v.0.3.5 and Immune epitope database. The immunogenicity of candidate neoantigens was calculated by Class I pMHC Immunogenicity and validated by the IFN-γ ELISpot assay. The effect of shHNRNPA1 on tumor growth and immune cells in vivo was evaluated by xenograft model combined with immunohistochemistry. RESULTS: HNRNPA1 was upregulated in a majority of malignancies and correlated with immunosuppressive status of the tumor immune microenvironment. Downregulation of HNRNPA1 could induce the activation of immune-related pathways and biological processes. Disruption of HNRNPA1 resulted in aberrant alternative splicing events and generation of immunogenic neoantigens. Downregulation of HNRNPA1 inhibited tumor growth and increased CD8+ T cell infiltration in vivo. CONCLUSION: Our study demonstrated that targeting HNRNPA1 could produce immunogenic neoantigens that elicit anti-tumor immunity by inducing abnormal mRNA splicing. It suggests that HNRNPA1 may be a potential target for immunotherapy.

Asunto(s)

Empalme Alternativo , Antígenos de Neoplasias , Ribonucleoproteína Nuclear Heterogénea A1 , Ribonucleoproteína Nuclear Heterogénea A1/genética , Ribonucleoproteína Nuclear Heterogénea A1/metabolismo , Ribonucleoproteína Nuclear Heterogénea A1/inmunología , Humanos , Animales , Antígenos de Neoplasias/inmunología , Antígenos de Neoplasias/genética , Antígenos de Neoplasias/metabolismo , Línea Celular Tumoral , Ratones , Regulación Neoplásica de la Expresión Génica , Microambiente Tumoral/inmunología , Microambiente Tumoral/genética , Femenino , Ensayos Antitumor por Modelo de Xenoinjerto , Regulación hacia Abajo , Neoplasias/inmunología , Neoplasias/genética , Neoplasias/terapia , Neoplasias/metabolismo

RESUMEN

A positive-sense (+) single-stranded RNA (ssRNA) virus (e.g. enterovirus A71, EV-A71) depends on viral polypeptide translation for initiation of virus replication after entry. We reported that EV-A71 hijacks Hsp27 to induce hnRNP A1 cytosol redistribution to initiate viral protein translation, but the underlying mechanism is still elusive. Here, we show that phosphorylation-deficient Hsp27-3A (Hsp27S15/78/82A) and Hsp27S78A fail to translocate into the nucleus and induce hnRNP A1 cytosol redistribution, while Hsp27S15A and Hsp27S82A display similar effects to the wild type Hsp27. Furthermore, we demonstrate that the viral 2A protease (2Apro) activity is a key factor in regulating Hsp27/hnRNP A1 relocalization. Hsp27S78A dramatically decreases the IRES activity and viral replication, which are partially reduced by Hsp27S82A. However, Hsp27S15A displays the same activity as the wild-type Hsp27. Peptide S78 potently suppresses EV-A71 protein translation and reproduction through blockage of EV-A71-induced Hsp27 phosphorylation and Hsp27/hnRNP A1 relocalization. A point mutation (S78A) on S78 impairs its inhibitory functions on Hsp27/hnRNP A1 relocalization and viral replication. Taken together, we demonstrate the importance of Ser78 phosphorylation of Hsp27 regulated by virus infection in nuclear translocation, hnRNP A1 cytosol relocation, and viral replication, suggesting a new path (such as peptide S78) for target-based antiviral strategy.

Asunto(s)

Enterovirus Humano A , Proteínas de Choque Térmico HSP27 , Ribonucleoproteína Nuclear Heterogénea A1 , Replicación Viral , Enterovirus Humano A/efectos de los fármacos , Enterovirus Humano A/fisiología , Enterovirus Humano A/genética , Fosforilación , Humanos , Replicación Viral/efectos de los fármacos , Ribonucleoproteína Nuclear Heterogénea A1/metabolismo , Ribonucleoproteína Nuclear Heterogénea A1/genética , Proteínas de Choque Térmico HSP27/metabolismo , Proteínas de Choque Térmico HSP27/genética , Infecciones por Enterovirus/virología , Infecciones por Enterovirus/metabolismo , Antivirales/farmacología , Proteínas Virales/metabolismo , Proteínas Virales/genética , Serina/metabolismo , Células HeLa , Biosíntesis de Proteínas , Cisteína Endopeptidasas/metabolismo , Cisteína Endopeptidasas/genética , Chaperonas Moleculares/metabolismo , Chaperonas Moleculares/genética , Proteínas de Choque Térmico

RESUMEN

RNA processing is an essential post-transcriptional phenomenon that provides the necessary complexity of transcript diversity prior to translation. Aberrations in this process could contribute to tumourigenesis, and we have previously reported increased splicing alterations in giant cell tumor of bone (GCTB), which carries mutations in the histone variant H3.3 encoding glycine 34 substituted for tryptophan (H3.3-G34W). G34W interacts with several splicing factors, most notably the trans-acting splicing factor hnRNPA1L2. To gain a deeper understanding of RNA processing in GCTB and isogenic HeLa cells with H3.3-G34W, we generated RNA-immunoprecipitation sequencing data from hnRNPA1L2 and H3.3-G34W associated RNAs, which showed that 80% overlapped across genic regions and were frequently annotated as E2F transcription factor binding sites. Splicing aberrations in both GCTB and HeLa cells with H3.3-G34W were significantly enriched for known hnRNPA1L2 binding motifs (p value < 0.01). This splicing aberration differed from hnRNPA1L2 knockouts, which showed alterations independent of H3.3-G34W. Of functional significance, hnRNPA1L2 was redistributed to closely match the H3.3 pattern, likely driven by G34W, and to loci not occupied in normal parental cells. Taken together, our data reveal a functional overlap between hnRNPA1L2 and H3.3-G34W with likely significant consequences for RNA processing during GCTB pathogenesis. This provides novel opportunities for therapeutic intervention in future modus operandi.

Asunto(s)

Neoplasias Óseas , Exones , Tumor Óseo de Células Gigantes , Histonas , Humanos , Empalme Alternativo , Neoplasias Óseas/genética , Neoplasias Óseas/metabolismo , Neoplasias Óseas/patología , Tumor Óseo de Células Gigantes/genética , Tumor Óseo de Células Gigantes/metabolismo , Tumor Óseo de Células Gigantes/patología , Células HeLa , Ribonucleoproteína Nuclear Heterogénea A1/metabolismo , Ribonucleoproteína Nuclear Heterogénea A1/genética , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B/metabolismo , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B/genética , Histonas/metabolismo , Histonas/genética , Empalme del ARN

RESUMEN

Lysyl oxidase-like 2 (LOXL2) is a member of the lysyl oxidase family and has the ability to catalyze the cross-linking of extracellular matrix collagen and elastin. High expression of LOXL2 is related to tumor cell proliferation, invasion, and metastasis. LOXL2 contains 14 exons. Previous studies have found that LOXL2 has abnormal alternative splicing and exon skipping in a variety of tissues and cells, resulting in a new alternatively spliced isoform denoted LOXL2Δ13. LOXL2Δ13 lacks LOXL2WT exon 13, but its encoded protein has greater ability to induce tumor cell proliferation, invasion, and metastasis. However, the molecular events that produce LOXL2Δ13 are still unclear. In this study, we found that overexpression of the splicing factor hnRNPA1 in cells can regulate the alternative splicing of LOXL2 and increase the expression of LOXL2Δ13. The exonic splicing silencer exists at the 3' splice site and 5' splice site of LOXL2 exon 13. HnRNPA1 can bind to the exonic splicing silencer and inhibit the inclusion of exon 13. The RRM domain of hnRNPA1 and phosphorylation of hnRNPA1 at S91 and S95 are important for the regulation of LOXL2 alternative splicing. These results show that hnRNPA1 is a splicing factor that enhances the production of LOXL2Δ13.

Asunto(s)

Empalme Alternativo , Aminoácido Oxidorreductasas , Exones , Ribonucleoproteína Nuclear Heterogénea A1 , Ribonucleoproteína Nuclear Heterogénea A1/metabolismo , Ribonucleoproteína Nuclear Heterogénea A1/genética , Humanos , Aminoácido Oxidorreductasas/genética , Aminoácido Oxidorreductasas/metabolismo , Células HEK293 , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B/metabolismo , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B/genética , Isoformas de Proteínas/genética , Isoformas de Proteínas/metabolismo

RESUMEN

Dysregulation of long noncoding RNA (lncRNA) expression plays a pivotal role in the initiation and progression of gastric cancer (GC). However, the regulation of lncRNA SNHG15 in GC has not been well studied. Mechanisms for ferroptosis by SNHG15 have not been revealed. Here, we aimed to explore SNHG15-mediated biological functions and underlying molecular mechanisms in GC. The novel SNHG15 was identified by analyzing RNA-sequencing (RNA-seq) data of GC tissues from our cohort and TCGA dataset, and further validated by qRT-PCR in GC cells and tissues. Gain- and loss-of-function assays were performed to examine the role of SNHG15 on GC both in vitro and in vivo. SNHG15 was highly expressed in GC. The enhanced SNHG15 was positively correlated with malignant stage and poor prognosis in GC patients. Gain- and loss-of-function studies showed that SNHG15 was required to affect GC cell growth, migration and invasion both in vitro and in vivo. Mechanistically, the oncogenic transcription factors E2F1 and MYC could bind to the SNHG15 promoter and enhance its expression. Meanwhile, SNHG15 increased E2F1 and MYC mRNA expression by sponging miR-24-3p. Notably, SNHG15 could also enhance the stability of SLC7A11 in the cytoplasm by competitively binding HNRNPA1. In addition, SNHG15 inhibited ferroptosis through an HNRNPA1-dependent regulation of SLC7A11/GPX4 axis. Our results support a novel model in which E2F1- and MYC-activated SNHG15 regulates ferroptosis via an HNRNPA1-dependent modulation of the SLC7A11/GPX4 axis, which serves as the critical effectors in GC progression, and provides a new therapeutic direction in the treatment of GC.

Asunto(s)

Sistema de Transporte de Aminoácidos y+ , Progresión de la Enfermedad , Ferroptosis , Regulación Neoplásica de la Expresión Génica , Ribonucleoproteína Nuclear Heterogénea A1 , Fosfolípido Hidroperóxido Glutatión Peroxidasa , ARN Largo no Codificante , Neoplasias Gástricas , Neoplasias Gástricas/genética , Neoplasias Gástricas/patología , Neoplasias Gástricas/metabolismo , Humanos , ARN Largo no Codificante/genética , ARN Largo no Codificante/metabolismo , Ribonucleoproteína Nuclear Heterogénea A1/metabolismo , Ribonucleoproteína Nuclear Heterogénea A1/genética , Animales , Línea Celular Tumoral , Ratones , Ferroptosis/genética , Masculino , Sistema de Transporte de Aminoácidos y+/genética , Sistema de Transporte de Aminoácidos y+/metabolismo , Femenino , Fosfolípido Hidroperóxido Glutatión Peroxidasa/metabolismo , Fosfolípido Hidroperóxido Glutatión Peroxidasa/genética , Proliferación Celular/genética , Factor de Transcripción E2F1/metabolismo , Factor de Transcripción E2F1/genética , Movimiento Celular/genética , Proteínas Proto-Oncogénicas c-myc/metabolismo , Proteínas Proto-Oncogénicas c-myc/genética , Persona de Mediana Edad , Pronóstico , Ratones Desnudos , Transducción de Señal/genética , Retroalimentación Fisiológica

RESUMEN

Cancer metastasis is the major cause of death in patients with breast cancer (BC). The liver is a common site of breast cancer metastasis, and the 5-year survival rate of patients with breast cancer liver metastases (BCLMs) is only about 8.5 %. CircRNAs are involved in a variety of cancer-related pathological behaviors, and their unique structure and resistance to RNA degradation enable them to serve as ideal diagnostic biomarkers and therapeutic targets. Therefore, it is important to investigate the role and molecular mechanism of circRNAs in cancer metastasis. CircLIFR-007 was identified as a critical circular RNA in BC metastasis by circRNAs microarray and qRT-PCR experiment. Cell function assays were performed to explore the effect of circLIFR-007 in breast cancer cells. Experiments in vivo validated the function of circLIFR-007. Several molecular assays were performed to investigate the underlying mechanisms. We found that circLIFR-007 acted as a negative controller in breast cancer liver metastasis. CircLIFR-007 upregulates the phosphorylation level of YAP by exporting hnRNPA1 to promote the combination between hnRNPA1 and YAP in the cytoplasm. Overexpression of circLIFR-007 suppressed the expression of liver metastasis-related proteins, SREBF1 and SNAI1, which were regulated by transcription factor YAP. Functionally, circLIFR-007 inhibits the proliferation and metastasis of breast cancer cells both in vivo and in vitro.

Asunto(s)

Neoplasias de la Mama , Ribonucleoproteína Nuclear Heterogénea A1 , Neoplasias Hepáticas , ARN Circular , Factores de Transcripción , Proteínas Señalizadoras YAP , Humanos , Neoplasias de la Mama/patología , Neoplasias de la Mama/metabolismo , Neoplasias de la Mama/genética , Neoplasias Hepáticas/secundario , Neoplasias Hepáticas/metabolismo , Neoplasias Hepáticas/genética , Femenino , Proteínas Señalizadoras YAP/metabolismo , Fosforilación , Animales , Ribonucleoproteína Nuclear Heterogénea A1/metabolismo , Ribonucleoproteína Nuclear Heterogénea A1/genética , ARN Circular/genética , ARN Circular/metabolismo , Factores de Transcripción/metabolismo , Factores de Transcripción/genética , Ratones , Línea Celular Tumoral , Regulación Neoplásica de la Expresión Génica , Proteínas Adaptadoras Transductoras de Señales/metabolismo , Proteínas Adaptadoras Transductoras de Señales/genética , Transporte Activo de Núcleo Celular , Ratones Desnudos , Proliferación Celular , Ratones Endogámicos BALB C , Células MCF-7

RESUMEN

Several RNA binding proteins involved in membraneless organelles can form pathological amyloids associated with neurodegenerative diseases, but the mechanisms of how this aggregation is modulated remain elusive. Here we investigate how heterotypic protein-RNA interactions modulate the condensation and the liquid to amyloid transition of hnRNPA1A, a protein involved in amyothropic lateral sclerosis. In the absence of RNA, formation of condensates promotes hnRNPA1A aggregation and fibrils are localized at the interface of the condensates. Addition of RNA modulates the soluble to amyloid transition of hnRNPA1A according to different pathways depending on RNA/protein stoichiometry. At low RNA concentrations, RNA promotes both condensation and amyloid formation, and the catalytic effect of RNA adds to the role of the interface between the dense and dilute phases. At higher RNA concentrations, condensation is suppressed according to re-entrant phase behaviour but formation of hnRNPA1A amyloids is observed over longer incubation times. Our findings show how heterotypic nucleic acid-protein interactions affect the kinetics and molecular pathways of amyloid formation.

Asunto(s)

Amiloide , Ribonucleoproteína Nuclear Heterogénea A1 , ARN , Ribonucleoproteína Nuclear Heterogénea A1/química , Ribonucleoproteína Nuclear Heterogénea A1/metabolismo , Amiloide/química , Amiloide/metabolismo , ARN/química , ARN/metabolismo , Humanos , Condensados Biomoleculares/química , Condensados Biomoleculares/metabolismo , Cinética

RESUMEN

hnRNP A1 is an important RNA-binding protein that influences many stages of RNA processing, including transcription, alternative splicing, mRNA nuclear export, and RNA stability. However, the role of hnRNP A1 in immune cells, specifically CD4+ T cells, remains unclear. We previously showed that Akt phosphorylation of hnRNP A1 was dependent on TCR signal strength and was associated with Treg differentiation. To explore the impact of hnRNP A1 phosphorylation by Akt on CD4+ T cell differentiation, our laboratory generated a mutant mouse model, hnRNP A1-S199A (A1-MUT) in which the major Akt phosphorylation site on hnRNP A1 was mutated to alanine using CRISPR Cas9 technology. Immune profiling of A1-MUT mice revealed changes in the numbers of Tregs in the mesenteric lymph node. We found no significant differences in naive CD4+ T cell differentiation into Th1, Th2, Th17, or T regulatory cells (Tregs) in vitro. In vivo, Treg differentiation assays using OTII-A1-Mut CD4+ T cells exposed to OVA food revealed migration and homing defects in the A1-MUT but no change in Treg induction. A1-MUT mice were immunized with NP- keyhole limpet hemocyanin, and normal germinal center development, normal numbers of NP-specific B cells, and no change in Tfh numbers were observed. In conclusion, Akt phosphorylation of hnRNP A1 S199 does not play a role in CD4+ T cell fate or function in the models tested. This hnRNP A1-S199A mouse model should be a valuable tool to study the role of Akt phosphorylation of hnRNP A1-S199 in different cell types or other mouse models of human disease.

Asunto(s)

Diferenciación Celular , Ribonucleoproteína Nuclear Heterogénea A1 , Linfocitos T , Animales , Ratones , Ribonucleoproteína Nuclear Heterogénea A1/metabolismo , Fosforilación , Proteínas Proto-Oncogénicas c-akt/genética , Proteínas Proto-Oncogénicas c-akt/metabolismo , Receptores de Antígenos de Linfocitos T/metabolismo , Serina/metabolismo , Transducción de Señal , Linfocitos T/citología

RESUMEN

Exploring the mechanism of self-renewal and pluripotency maintenance of human embryonic stem cells (hESCs) is of great significance in basic research and clinical applications, but it has not been fully elucidated. Long non-coding RNAs (lncRNAs) have been shown to play a key role in the self-renewal and pluripotency maintenance of hESCs. We previously reported that the lncRNA ESRG, which is highly expressed in undifferentiated hESCs, can maintain the self-renewal and pluripotency of hPSCs. RNA pull-down mass spectrometry showed that ESRG could bind to other proteins, among which heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1) attracted our attention. In this study, we showed that HNRNPA1 can maintain self-renewal and pluripotency of hESCs. ESRG bound to and stabilized HNRNPA1 protein through the ubiquitin-proteasome pathway. In addition, knockdown of ESRG or HNRNPA1 resulted in alternative splicing of TCF3, which originally and primarily encoded E12, to mainly encode E47 and inhibit CDH1 expression. HNRNPA1 could rescue the biological function changes of hESCs caused by ESRG knockdown or overexpression. Our results suggest that ESRG regulates the alternative splicing of TCF3 to affect CDH1 expression and maintain hESCs self-renewal and pluripotency by binding and stabilizing HNRNPA1 protein. This study lays a good foundation for exploring the new molecular regulatory mechanism by which ESRG maintains hESCs self-renewal and pluripotency.

Asunto(s)

Empalme Alternativo , Ribonucleoproteína Nuclear Heterogénea A1 , Células Madre Embrionarias Humanas , ARN Largo no Codificante , Humanos , Empalme Alternativo/genética , Células Madre Embrionarias Humanas/metabolismo , Células Madre Embrionarias Humanas/citología , ARN Largo no Codificante/genética , ARN Largo no Codificante/metabolismo , Ribonucleoproteína Nuclear Heterogénea A1/metabolismo , Ribonucleoproteína Nuclear Heterogénea A1/genética , Autorrenovación de las Células/genética , Células Madre Pluripotentes/metabolismo , Células Madre Pluripotentes/citología , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B/metabolismo , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B/genética , Diferenciación Celular/genética , Factores de Transcripción con Motivo Hélice-Asa-Hélice Básico/metabolismo , Factores de Transcripción con Motivo Hélice-Asa-Hélice Básico/genética

RESUMEN

Ischemic stroke remains one of the major causes of serious disability and death globally. LncRNA maternally expressed gene 3 (MEG3) is elevated in middle cerebral artery occlusion/reperfusion (MCAO/R) rats and oxygen-glucose deprivation/reperfusion (OGD/R)-treated neurocytes cells. The objective of this study is to investigate the mechanism underlying MEG3-regulated cerebral ischemia/reperfusion (I/R) injury. MCAO/R mouse model and OGD/R-treated HT-22 cell model were established. The cerebral I/R injury was monitored by TTC staining, neurological scoring, H&E and TUNEL assay. The levels of MEG3, hnRNPA1, Sirt2 and other key molecules were detected by qRT-PCR and western blot. Mitochondrial dysfunction was assessed by transmission Electron Microscopy (TEM), JC-1 and MitoTracker staining. Oxidative stress was monitored using commercial kits. Bioinformatics analysis, RIP, RNA pull-down assays and RNA FISH were employed to detect the interactions among MEG3, hnRNPA1 and Sirt2. The m6A modification of MEG3 was assessed by MeRIP-qPCR. MEG3 promoted MCAO/R-induced brain injury by modulating mitochondrial fragmentation and oxidative stress. It also facilitated OGD/R-induced apoptosis, mitochondrial dysfunction and oxidative stress in HT-22 cells. Mechanistically, direct associations between MEG3 and hnRNPA1, as well as between hnRNPA1 and Sirt2, were observed in HT-22 cells. MEG3 regulated Sirt2 expression in a hnRNPA1-dependent manner. Functional studies showed that MEG3/Sirt2 axis contributed to OGD/R-induced mitochondrial dysfunction and oxidative stress in HT-22 cells. Additionally, METTL3 was identified as the m6A transferase responsible for the m6A modification of MEG3. m6A-induced lncRNA MEG3 promoted cerebral I/R injury via modulating oxidative stress and mitochondrial dysfunction by hnRNPA1/Sirt2 axis.

Asunto(s)

Ribonucleoproteína Nuclear Heterogénea A1 , Mitocondrias , Estrés Oxidativo , ARN Largo no Codificante , Daño por Reperfusión , Sirtuina 2 , Animales , Masculino , Ratones , Adenosina/análogos & derivados , Apoptosis/genética , Isquemia Encefálica/metabolismo , Isquemia Encefálica/patología , Isquemia Encefálica/genética , Línea Celular , Ribonucleoproteína Nuclear Heterogénea A1/metabolismo , Ribonucleoproteína Nuclear Heterogénea A1/genética , Infarto de la Arteria Cerebral Media/patología , Infarto de la Arteria Cerebral Media/metabolismo , Infarto de la Arteria Cerebral Media/genética , Ratones Endogámicos C57BL , Mitocondrias/metabolismo , Estrés Oxidativo/fisiología , Estrés Oxidativo/genética , Daño por Reperfusión/metabolismo , Daño por Reperfusión/patología , Daño por Reperfusión/genética , ARN Largo no Codificante/genética , ARN Largo no Codificante/metabolismo , Transducción de Señal/fisiología , Sirtuina 2/metabolismo , Sirtuina 2/genética

RESUMEN

BACKGROUND: A large number of Fusobacterium nucleatum (Fn) are present in colorectal cancer (CRC) tissues of patients who relapse after chemotherapy, and Fn has been reported to promote oxaliplatin and 5-FU chemoresistance in CRC. Pathogens such as bacteria and parasites stimulate exosome production in tumor cells, and the regulatory mechanism of exosomal circRNA in the transmission of oxaliplatin and 5-FU chemotherapy resistance in Fn-infected CRC remains unclear. METHODS: Hsa_circ_0004085 was screened by second-generation sequencing of CRC tissues. The correlation between hsa_circ_0004085 and patient clinical response to oxaliplatin/5-FU was analyzed. Exosome tracing experiments and live imaging systems were used to test the effect of Fn infection in CRC on the distribution of hsa_circ_0004085. Colony formation, ER tracking analysis and immunofluorescence were carried out to verify the regulatory effect of exosomes produced by Fn-infected CRC cells on chemotherapeutic resistance and ER stress. RNA pulldown, LC-MS/MS analysis and RIP were used to explore the regulatory mechanism of downstream target genes by hsa_circ_0004085. RESULTS: First, we screened out hsa_circ_0004085 with abnormally high expression in CRC clinical samples infected with Fn and found that patients with high expression of hsa_circ_0004085 in plasma had a poor clinical response to oxaliplatin/5-FU. Subsequently, the circular structure of hsa_circ_0004085 was identified. Fn infection promoted hsa_circ_0004085 formation by hnRNP L and packaged hsa_circ_0004085 into exosomes by hnRNP A1. Exosomes produced by Fn-infected CRC cells transferred hsa_circ_0004085 between cells and delivered oxaliplatin/5-FU resistance to recipient cells by relieving ER stress. Hsa_circ_0004085 enhanced the stability of GRP78 mRNA by binding to RRBP1 and promoted the nuclear translocation of ATF6p50 to relieve ER stress. CONCLUSIONS: Plasma levels of hsa_circ_0004085 are increased in colon cancer patients with intracellular Fn and are associated with a poor response to oxaliplatin/5-FU. Fn infection promoted hsa_circ_0004085 formation by hnRNP L and packaged hsa_circ_0004085 into exosomes by hnRNP A1. Exosomes secreted by Fn-infected CRC cells deliver hsa_circ_0004085 between cells. Hsa_circ_0004085 relieves ER stress in recipient cells by regulating GRP78 and ATF6p50, thereby delivering resistance to oxaliplatin and 5-FU.

Asunto(s)

Neoplasias del Colon , Neoplasias Colorrectales , Exosomas , Ribonucleoproteína Heterogénea-Nuclear Grupo L , MicroARNs , Humanos , Oxaliplatino/farmacología , Oxaliplatino/uso terapéutico , Oxaliplatino/metabolismo , Fusobacterium nucleatum/genética , Fusobacterium nucleatum/metabolismo , Ribonucleoproteína Nuclear Heterogénea A1/metabolismo , Neoplasias Colorrectales/metabolismo , Exosomas/metabolismo , Cromatografía Liquida , Chaperón BiP del Retículo Endoplásmico , Ribonucleoproteína Heterogénea-Nuclear Grupo L/metabolismo , Espectrometría de Masas en Tándem , Neoplasias del Colon/tratamiento farmacológico , Neoplasias del Colon/metabolismo , Fluorouracilo/farmacología , Fluorouracilo/uso terapéutico , MicroARNs/metabolismo , Proliferación Celular

RESUMEN

Dysregulation of gene expression is critical for the progression of cancer. The augmented expression of hnRNP A1 in patients with hepatocellular carcinoma (HCC) has been related to its oncogenic functions. However, the underlying mechanisms responsible for upregulation of hnRNP A1 have not been fully elucidated. In the present study, we identified microRNA-195-5p (miR-195-5p), a miRNA downregulated in HCC, as a novel regulator governing hnRNP A1 expression. Notably, our investigations showed an inverse correlation between hnRNP A1 level, which was increased in HCC, and miR-195-5p level, which was decreased. Our findings demonstrated that hnRNP A1 significantly enhanced the migration and invasion of PLC/PRF/5 cells through its association with mRNAs regulating metastasis. MiR-195-5p also interfered with the hnRNP A1-mediated cell migration by targeting hnRNP A1. Our results underscore the significance of the miR-195-5p/hnRNP A1 axis in regulating the migratory potential of cancer cells and its role in promoting HCC by orchestrating cell migration processes.

Asunto(s)

Carcinoma Hepatocelular , Neoplasias Hepáticas , MicroARNs , Humanos , Carcinoma Hepatocelular/patología , Ribonucleoproteína Nuclear Heterogénea A1/genética , Ribonucleoproteína Nuclear Heterogénea A1/metabolismo , Neoplasias Hepáticas/patología , Proliferación Celular/genética , MicroARNs/genética , MicroARNs/metabolismo , Línea Celular Tumoral , Movimiento Celular/genética , Regulación Neoplásica de la Expresión Génica

RESUMEN

The human telomere contains multiple copies of the DNA sequence d(TTAGGG) which can fold into higher order intramolecular G-quadruplexes and regulate the maintenance of telomere length and chromosomal integrity. The nucleic acid binding protein heteronuclear ribonucleoprotein A1 (hnRNP A1) and its N-terminus proteolytic product UP1 have been shown to efficiently bind and unfold telomeric DNA G-quadruplex. However, the understanding of the molecular mechanism of the UP1 binding and unfolding telomeric G-quadruplexes is still limited. Here, we performed biochemical and biophysical characterizations of UP1 binding and unfolding of human telomeric DNA G-quadruplex d[AGGG(TTAGGG)3], and in combination of systematic site-direct mutagenesis of two tandem RNA recognition motifs (RRMs) in UP1, revealed that RRM1 is responsible for initial binding and unfolding, whereas RRM2 assists RRM1 to complete the unfolding of G-quadruplex. Isothermal titration calorimetry (ITC) and circular dichroism (CD) studies of the interactions between UP1 and DNA G-quadruplex variants indicate that the "TAG" binding motif in Loop2 of telomeric G-quadruplex is critical for UP1 recognition and G-quadruplex unfolding initiation. Together we depict a model for molecular mechanism of hnRNP A1 (UP1) binding and unfolding of the human telomeric DNA G-quadruplex.

Asunto(s)

G-Cuádruplex , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B , Humanos , Ribonucleoproteína Nuclear Heterogénea A1/genética , Ribonucleoproteína Nuclear Heterogénea A1/metabolismo , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B/química , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B/genética , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B/metabolismo , ADN/metabolismo , Ribonucleoproteínas/metabolismo , Telómero/genética , Telómero/metabolismo

RESUMEN

BACKGROUND: RUNX2 (Runt-related transcription factor 2) acts as a key regulator in the odontogenic differentiation of human dental pulp stem cells (hDPSCs). Moreover, the inclusion of exon 5 is important for RUNX2 function. Our previous study showed that Y-Box Binding Protein 1 (YBX1) promoted RUNX2 exon 5 inclusion and mineralization of hDPSCs. However, the regulatory mechanism of RUNX2 exon 5 alternative splicing needed further exploration. METHODS: The expression level of heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) during the odontogenic differentiation of hDPSCs was analyzed by RT-PCR and Western blot. The roles of hnRNP A1 in the alternative splicing of RUNX2 exon 5 and the odontogenic differentiation of dental mesenchymal cells were analyzed by gain- and loss-of-function experiments. RESULTS: Surprisingly, we found an alternative splicing factor, hnRNP A1, which had an opposite role to YBX1 in regulating RUNX2 exon 5 inclusion and odontogenic differentiation of hDPSCs. Through gain- and loss-of-function assay, we found that hnRNP A1 suppressed the inclusion of RUNX2 exon 5, resulting in the inhibition of odontoblastic differentiation. The overexpression of hnRNP A1 can inhibit the expression of ALP (alkaline phosphatase) and OCN (osteocalcin), and the formation of mineralized nodules during the odontogenic differentiation of both hDPSCs and mouse dental papilla cells (mDPCs), whereas the opposite results were obtained with an hnRNP A1 knockdown preparation. CONCLUSIONS: The present study indicated that hnRNP A1 suppressed RUNX2 exon 5 inclusion and reduced the odontogenic differentiation ability of hDPSCs and mDPCs.

Asunto(s)

Subunidad alfa 1 del Factor de Unión al Sitio Principal , Células Madre , Animales , Humanos , Ratones , Diferenciación Celular/genética , Células Cultivadas , Subunidad alfa 1 del Factor de Unión al Sitio Principal/genética , Subunidad alfa 1 del Factor de Unión al Sitio Principal/metabolismo , Pulpa Dental/metabolismo , Exones/genética , Ribonucleoproteína Nuclear Heterogénea A1/metabolismo , Células Madre/metabolismo

RESUMEN

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

Asunto(s)

Neoplasias de la Mama , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B , Humanos , Femenino , Ribonucleoproteína Nuclear Heterogénea A1/genética , Ribonucleoproteína Nuclear Heterogénea A1/metabolismo , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B/genética , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B/metabolismo , Neoplasias de la Mama/genética , Isoformas de Proteínas/genética , Isoformas de Proteínas/metabolismo , Empalme Alternativo , Exones/genética , Proteínas de la Membrana/genética , Proteínas de la Membrana/metabolismo , Proteínas Supresoras de Tumor/metabolismo