RESUMEN
tRFs and tiRNAs are small noncoding RNA molecules that are widespread in eukaryotic and prokaryotic transcriptomes with extremely powerful functions. We screened three tRF molecules whose expression was stably elevated in reprogrammed cells by tRF and tiRNA sequencing, synthesized these three molecules and transfected them into human umbilical cord mesenchymal stem cells. We detected the pluripotent factor OCT4 by Western Blot (WB) after transfection. The gene and protein expression of the pluripotent genes OCT4 and NANOG increased significantly, and telomere (TEL) expression increased significantly. Cell activity was increased, apoptosis was decreased, and the cell cycle had also changed to some extent. These results showed that the three tRF molecules, tRF-16-K87965D (sequence: CCCGGGTTTCGGCACC), tRF-17-K879652 (sequence: CCCGGGTTTCGGCACCA), and tRF-22-WD8YQ84V2 (sequence: TCGACTCCTGGCTGGCTCGCCA), can promote cell rejuvenation and increase pluripotency.
Asunto(s)
Células Madre Mesenquimatosas , ARN Pequeño no Traducido , Humanos , ARN Pequeño no Traducido/metabolismo , Cordón UmbilicalRESUMEN
Breast cancer stem cells (BCSCs) play essential roles in tumor formation, drug resistance, relapse, and metastasis. NANOG is a protein required for stem cell self-renewal, but the mechanisms by which it performs this function are poorly understood. Here, we show that hypoxia-inducible factor 1α (HIF-1α) is required for NANOG-mediated BCSC enrichment. Mechanistically, NANOG is recruited by HIF-1 to cooperatively activate transcription of the TERT gene encoding the telomerase reverse transcriptase that maintains telomere length, which is required for stem cell self-renewal. NANOG stimulates HIF-1 transcriptional activity by recruitment of the deubiquitinase USP9X, which inhibits HIF-1α protein degradation, and by stabilizing HIF-1α interaction with the coactivator p300, which mediates histone acetylation. Our results delineate a cooperative transcriptional mechanism by which HIF-1 and NANOG mediate BCSC self-renewal.
Asunto(s)
Neoplasias de la Mama/metabolismo , Hipoxia de la Célula/fisiología , Subunidad alfa del Factor 1 Inducible por Hipoxia/metabolismo , Proteína Homeótica Nanog/metabolismo , Telomerasa/metabolismo , Neoplasias de la Mama/patología , Regulación Neoplásica de la Expresión Génica/genética , Humanos , Recurrencia Local de Neoplasia/metabolismo , Recurrencia Local de Neoplasia/patología , Células Madre Neoplásicas/metabolismoRESUMEN
Researchers currently lack standardized porcine-specific markers that would aid in distinguishing the naïve and primed states of porcine embryonic stem cells (ESCs). Here, we converted naïve-like porcine ESCs (nESCs, established in our lab) into primed-state cells, and we proposed a set of molecular criteria for evaluating the naïve porcine ESCs by comparing the two cell states. The reverse-primed porcine ESCs (rpESCs) are phenotypically stable and karyotypically intact. Alkaline phosphatase positivity and the ability to form embryonic bodies suggest that rpESCs still retain the capacity for self-renewal. Lineage-associated genes, such as Cdx2, Sox17, Eomes, Foxa, Fgf5, and Pitx2, exhibited significant expression in rpESCs. Nonetheless, LIF/3i-grown porcine ESCs treated with the small molecular weight inhibitors CHIR99021, PD0325901, and SB431542 expressed the greatest number of pluripotency marker genes, including Oct4, Sox2, Nog, Dppa5, Nr0b1, and Klf4, and at higher levels than were observed in rpESCs. Despite their general trend toward higher expression of critical pluripotency factors, the nESCs showed downregulation of Tbx3, Nanog, and c-Myc, which are considered typical naïve factors in other species. Entry of the nESCs into the developmentally primed state was also associated with a marked reduction in Lin28 expression. These findings extend the knowledge of porcine pluripotency markers and provide a backdrop for future analysis of naïve porcine pluripotency.
Asunto(s)
Biomarcadores/metabolismo , Células Madre Embrionarias/citología , Células Madre Embrionarias/metabolismo , Animales , Diferenciación Celular , Linaje de la Célula/genética , Cuerpos Embrioides/citología , Regulación de la Expresión Génica , Transducción de Señal , PorcinosRESUMEN
Clinical studies have revealed that breast cancers contain regions of intratumoral hypoxia (reduced oxygen availability), which activates hypoxia-inducible factors (HIFs). The relationship between intratumoral hypoxia, distant metastasis and cancer mortality has been well established. A major mechanism by which intratumoral hypoxia contributes to disease progression is through induction of the breast cancer stem cell (BCSC) phenotype. BCSCs are a small subpopulation of cells with the capability for self-renewal. BCSCs have been implicated in resistance to chemotherapy, disease recurrence, and metastasis. In this review, we will discuss our current understanding of the molecular mechanisms underlying HIF-dependent induction of the BCSC phenotype in response to hypoxia or chemotherapy.
Asunto(s)
Neoplasias de la Mama/patología , Hipoxia de la Célula/fisiología , Subunidad alfa del Factor 1 Inducible por Hipoxia/metabolismo , Células Madre Neoplásicas/patología , Animales , Neoplasias de la Mama/tratamiento farmacológico , Neoplasias de la Mama/metabolismo , Línea Celular Tumoral , Femenino , Humanos , Células Madre Neoplásicas/efectos de los fármacos , Células Madre Neoplásicas/metabolismoRESUMEN
TFCP2L1 is a transcription factor that facilitates establishment and maintenance of pluripotency in embryonic stem cells by forming a complex transcriptional network with other transcription factors (OCT4, SOX2, and NANOG). TFCP2L1 contains two distinct domains, the CP2-like domain at the N-terminus and the SAM-like domain at the C-terminus. In this study, we found that TFCP2L1 is hexamerized in solution via the C-terminal SAM-like domain. We also found that homo-oligomerization of SAM-like domain is dependent on the concentration of the proteins. Finally, we found that TFCP2L1 binds directly to DNA via the N-terminal CP2-like domain.
Asunto(s)
Diferenciación Celular/genética , Proteínas de Unión al ADN/química , Células Madre Embrionarias/metabolismo , Proteínas Represoras/química , Animales , Proteínas de Unión al ADN/genética , Proteínas de Unión al ADN/metabolismo , Células Madre Embrionarias/química , Ratones , Proteína Homeótica Nanog/genética , Proteína Homeótica Nanog/metabolismo , Factor 3 de Transcripción de Unión a Octámeros/genética , Factor 3 de Transcripción de Unión a Octámeros/metabolismo , Dominios Proteicos/genética , Multimerización de Proteína , Proteínas Represoras/genética , Proteínas Represoras/metabolismo , Factores de Transcripción SOXB1/genética , Factores de Transcripción SOXB1/metabolismoRESUMEN
We previously reported that transcripts encoding the homeoprotein EGAM1N are expressed in preimplantation mouse embryos and embryonic stem (ES) cells, and the exogenous expression of EGAM1N inhibits the differentiation of ES cells. In order to clarify the relationship between the inhibition of differentiation and EGAM1N, we generated mouse MG1.19 ES cells stably expressing EGAM1N. Control transfectants with an empty vector formed relatively flattened cell colonies similar to those observed in parental MG1.19 cells. In contrast, Egam1n transfectants formed tightly aggregated cell colonies with increased localization of CDH1 at cell-to-cell interfaces. The protein levels of pluripotency factors, including TBX3 and SOX2, were also increased. The expression of Tbx3 transcripts was induced, although the level of Sox2 transcripts was almost unchanged. The expression of EGAM1N resulted in no obvious changes in the expression of genes encoding receptors, protein kinases, transcription factors, and their encoded proteins involved in the LIF-STAT3 signaling pathway. Alkaline phosphatase activity, a marker for the undifferentiated state, in Egam1n transfectants was exhibited in a clonal proliferation assay. When differentiation of Egam1n transfectants was induced, progression was prevented with increases in transcript levels of Pou5f1, Sox2, Nanog, Klf4, Tbx3, and their encoded proteins. However, Egam1n transfectants formed relatively flattened-cell layers as observed in the control, indicating that the expression of EGAM1N could not maintain LIF-independent self-renewal of ES cells. Overall, we suggest that expression of EGAM1N could inhibit differentiation, at least in part, by elevating the protein levels of pluripotency factors in MG1.19 ES cells.
Asunto(s)
Diferenciación Celular/genética , Proteínas de Homeodominio/genética , Proteínas de Homeodominio/metabolismo , Células Madre Embrionarias de Ratones/citología , Células Madre Embrionarias de Ratones/metabolismo , Factores de Transcripción/metabolismo , Fosfatasa Alcalina/metabolismo , Animales , Proteínas Cdh1/metabolismo , Línea Celular , Autorrenovación de las Células , Forma de la Célula , Células Clonales/citología , Células Clonales/metabolismo , Perfilación de la Expresión Génica , Factor 4 Similar a Kruppel , Factores de Transcripción de Tipo Kruppel/genética , Factores de Transcripción de Tipo Kruppel/metabolismo , Factor Inhibidor de Leucemia/metabolismo , Ratones , Proteína Homeótica Nanog , Factor 3 de Transcripción de Unión a Octámeros/genética , Factor 3 de Transcripción de Unión a Octámeros/metabolismo , ARN Mensajero/metabolismo , Factores de Transcripción SOXB1/genética , Factores de Transcripción SOXB1/metabolismo , Factor de Transcripción STAT3/metabolismo , Transducción de Señal , Proteínas de Dominio T Box/genética , Proteínas de Dominio T Box/metabolismo , TransfecciónRESUMEN
Primordial germ cells (PGCs) are the embryonic progenitors of sperm and egg cells. Mammalian PGCs are thought to actively migrate from the yolk sac endoderm over long distances across the embryo to reach the somatic genital ridges. The general principles of mammalian PGC development were discovered in mice. In contrast, little is known about PGC development in primates due to extremely limited access to primate embryos. Here, we analyzed 12 well preserved marmoset monkey (Callithrix jacchus) embryos covering the phase from PGC emergence in the endoderm to the formation of the sexually differentiated gonad (embryonic day (E) 50 to E95). We show using immunohistochemistry that the pluripotency factors OCT4A and NANOG specifically mark PGCs throughout the period studied. In contrast, SALL4 and LIN28 were first expressed ubiquitously and only later down-regulated in somatic tissues. We further show, for the first time, that PGCs are located in the endoderm in E50 embryos in close spatial proximity to the prospective genital ridge, making a long-range migration of PGCs dispensable. At E65, PGCs are already present in the primitive gonad, while significantly later embryonic stages still exhibit PGCs at their original endodermal site, revealing a wide spatio-temporal window of PGC distribution. Our findings challenge the 'dogma' of active long-range PGC migration from the endoderm to the gonads. We therefore favor an alternative model based primarily on passive translocation of PGCs from the mesenchyme that surrounds the gut to the prospective gonad through the intercalar expansion of mesenchymal tissue which contains the PGCs. In summary, we (i) show differential pluripotency factor expression during primate embryo development and (ii) provide a schematic model for embryonic PGC translocation.