RESUMEN

Metaplexis japonica (Thunb.) Makino, commonly known as rough potato, has a wide distribution in China, Japan, Korea, and adjacent Russia. In China, M. japonica is a traditional herbal medicinal plant, which is also cultivated as a vegetable (Shi et al. 2020; Wei et al. 2019). In July 2023, leaves of M. japonica plants growing near a soybean field in Qingdao, Shandong province, exhibited leaf crinkling, mosaic and distorting symptoms of probable virus infection (Supplementary Figure 1). The disease incidence in a 50 m2 area was approximately 40%. To identify the suspected viral etiological agents, symptomatic leaves from 10 M. japonica plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq). TransZol Up Total RNA Extraction Kit (TransGen Biotech, Beijing, China) was used to extract total RNA. Small RNA library construction and high-throughput sequencing (HTS) were performed on Illumina NovaSeq platform by Genepioneer (Nanjing, China) (Li et al. 2024). A total of 17,384,311 raw reads were obtained. Redundant reads were removed by cutadapt software (version 1.18) to obtain 11,580,876 clean reads with 18 to 26 nucleotide (nt) sizes. The clean reads were assembled using velvet software (version 1.1.07). A total of forty-six small contigs from 42 to 283 nt were identified, with 85 to 100% nucleotide sequence identities, respectively, to metaplexis yellow mottle-associated virus (MeYMaV, genus Caulimovirus, family Caulimoviridae, accession numbers: NC_077108.1). Finally, 1,355,955 reads (11.71% mapped ratio of total reads, cover 56.7% over the MeYMaV genome) were mapped to the genome of MeYMaV by bwa software (version 0.7.17-r1188). To confirm the sRNA-Seq results, PCR was performed with specific primers MeYMaV-N-F/MeYMaV-N-R (5'-TGGTATCAGAGCCTAGTTAA-3'/5'-GGAGTTGGTAATGTATTACC-3') and MeYMaV-C-F/MeYMaV-C-R (5'-AATGGAACGGCTGTTAGTAT3'/TTAATTTCTAGCCCTTGGCTACTTAC). Both the primer pairs were designed using GenBank accession numbers: NC_077108.1 (Yang et al. 2021) to obtain the N and C terminals genome fragments of 10 MeYMaV plants. Two amplicons approximately in 4000-, and 3900-bp sizes were amplified (Supplementary Figure 2), sequenced (tsingke, Beijing, China) and aligned to obtain 7,742-nt complete MeYMaV genome sequence (Accession no. PP892524). BLASTn analysis revealed 90.16% and 92.18% sequence identity, respectively, with the MeYMaV isolate LM-Cau-A (NC_077108.1) based on complete genome and coat protein sequences, respectively. Previously, cucumber mosaic virus and MeYMaV were reported in M. japonica from Jiangsu and Liaoning provinces in China, respectively (Yang et al. 2018; 2021). To our knowledge, this is the first natural infection report of MeYMaV in M. japonica in Shandong, China. The natural occurrence of MeYMaV is not only affects the quality of M. japonica, but also poses a potential threat to surrounding crops. This study enriches information on the disease distribution of MeYMaV and will be helpful for disease management.

RESUMEN

Monstera deliciosa Liebm. (Araceae) is a monocotyledonous plant that is native to tropical forests of southern Mexico to Panama. It is widely grown as an ornamental in the United States because of its easy maintenance and attractive, fenestrate leaves. On May 10th, 2024, at a nursery and garden center in Henrico County, Virginia, four M. deliciosa plants in 3.8 L containers were observed with necrotic spots surrounded by a yellow halo on the leaves (Fig. 1A). Uredinia were present in the center of the lesions with dense, reddish-brown sporulation mostly on the abaxial surface of the leaves (Fig. 1B). Urediniospores with pedicels were golden brown in color, globose, echinulate, with two opposite germ pores, averaging (28) 25.2 x 25 (23) µm (n = 40) in size and a wall thickness of 1.5 to 2 µm (n = 40) (Fig. 1F - K). Telia were not present. The host, symptoms, and urediniospore size was comparable to reports of Pseudocerradoa paullula (Syd. & P. Syd.) M. Ebinghaus & Dianese from South Carolina (22.9 to 27.9 µm), Florida (24 to 31 µm), and Japan (24.8 to 29.3 µm) (Ebinghaus et al. 2022; Sakamoto et al. 2023; Urbina et al. 2023; Yang et al. 2023). Urediniospores from the infected plants were collected with a sterile needle and DNA was extracted using a Qiagen DNeasy PowerLyzer Microbial Kit (Germantown, MD) according to the manufacturer's instructions. PCR and sequencing of the small ribosomal subunit (SSU) and large ribosomal subunit (LSU) gene regions was performed with primer sets NS1/Rust18SR and LRust1R/LR3 (Beenken et al. 2012; Vilgalys and Hester 1990). The resulting 1,630bp and 638 bp sequence fragments of the SSU and LSU loci from strain GS24-AE50 were deposited into the NCBI Genbank database under accessions PQ059898 and PQ059897, respectively. A pairwise alignment of the SSU gene shared 1,363/1,366 (99%) nucleotides with the P. paullula voucher (ON887197) from Florida. A Genbank nBLAST analysis of the LSU gene shared 636/638 (99%), 636/638 (99%), and 592/600 (99%) nucleotides with vouchers from M. deliciosa from South Carolina (OQ746460), Florida (ON887197) and Japan (OK509070) (Sakamoto et al. 20222; Urbina et al. 2023; Yang et al. 2023). Koch's postulates were fulfilled by spraying four, healthy, non-wounded M. deliciosa plants to run-off with a urediniospore suspension (1 x 106 spores/ml distilled water, 20 ml per plant) that was collected from the original infected plants. An additional four, healthy control plants were sprayed with distilled water only. After 6 weeks in a greenhouse at 22 ± 2°C with ≥85% relative humidity under an 8-h photoperiod, uredinia in the center of lesions identical to those on the original symptomatic plants developed on 12 out of 20 leaves from the inoculated plants, while all the leaves from the control plants remained asymptomatic (Fig.1C - E). Urediniospores collected from the inoculated plants were morphologically identical to the urediniospores from the original infected plants with 100% LSU sequence homology to accession PQ059897. Globally, P. paullula has been reported from Australia, China, Japan, Malaysia, the Philippines, and the United States, where the pathogen was detected at the port of Los Angeles in 2014, Florida in 2019, and South Carolina in 2023 (Sakamoto et al. 2023; Shaw et al. 1991; Urbina et al. 2023; Yang et al. 2023). Although the pathogen is not known to be established in Virginia, the recent surge of reports suggests that the pathogen's distribution is expanding. The impact of aroid leaf rust on M. deliciosa production is unclear, but it has the potential to reduce the aesthetic and commercial value of plants under favorable conditions.

RESUMEN

Magnolia delavayi, known as Delavay's magnolia or Chinese evergreen magnolia, is an enchanting deciduous tree native to southwestern China (Xu et al. 2020). In March 2024, leaf spots were observed on M. delavayi plants at Qujing Normal University (25.527°N, 103.744°E), Qujing, Yunnan, China. About 80% of the trees (n=92) on campus were infected, with infected leaves accounting for about 10 to 30% of all leaves. The leaf spots exhibited a round or oval shape, with a yellowish-brown center and a brown outer ring. As the spots expanded, the leaves gradually dried up and fell off. Five symptomatic leaves were collected from the middle sections of five diseased plants. Tissue samples (5 × 5 mm) were excised from the lesion margins and subjected to surface sterilization in 75% ethanol for 30 seconds and 1% sodium hypochlorite for 60 seconds. They were then rinsed three times with sterile water and dried on sterilized paper. The samples were plated on potato dextrose agar (PDA) and incubated at 28 °C for 3 days. Developing colonies were retransferred to new PDA and purified by the hyphal tip technique (Senanayake et al. 2020). Two representative isolates (SYL1 and SYL2) were selected and confirmed to be the same species based on morphological characteristics and molecular identification. On PDA, the fungal colonies initially appeared grayish-white and turned dark gray over time with cotton-like aerial hyphae on the surface. The conidia are light brown, pear-shaped or rod-shaped, with 1 to 4 transverse septa and 0 to 1 oblique septa, and measured 5.4 to 12.7 × 10.4 to 25.7 µm (n = 50). Molecular identification was performed by partial sequencing of the internal transcribed spacer (ITS: ITS4/ITS5) region, glyceraldehyde 3-phosphate dehydrogenase (GAPDH:gpd1/gpd2), translation elongation factor 1-alpha (TEF1:EF1/EF2), and Alternaria major allergen (Alt a 1:Alt-for/Alt-rev) (Woudenberg et al. 2015). The resulting sequences of ITS (PP951882, PP951883), GAPDH (PP968942, PP968943), Alt a 1(PP968940, PP968941) and TEF1 (PP968938, PP968939) were deposited in GenBank. BLAST analyses revealed that the sequences from these two isolates showed 100% identity with those from Alternaria alternata strains for each gene. Additionally, a multigene phylogenetic analysis revealed a distinct group containing SYL1, SYL2 and other A. alternata strains with a posterior probability of 100%. The morphological and phylogenetic evidence collectively suggested that the two isolates belonged to A. alternata. Strain SYL1 was used for the pathogenicity test on three 5-year-old M. delavayi plants on campus. Three healthy leaves of each plant were punctured with a sterile needle and sprayed with 20 µl of spore suspension (1 × 106 conidia/ml). Similarly, another nine wounded leaves were sprayed with 20 µl of sterile water. All inoculated leaves were enclosed in plastic bags for 48 hours. Disease symptoms were observed on leaves inoculated with spore suspension after 7 days, while control plants remained healthy. This experiment was repeated three times with same results. To fulfill Koch's postulates, A. alternata was reisolated from the inoculated leaves and identified based on morphological characteristics and ITS sequencing. To our knowledge, this is the first report of A. alternata causing leaf spot on M. delavayi in China. This research expands the known host range of this pathogen and provides relevant information to the design of disease management strategies.

RESUMEN

Winter jasmine (Jasminum nudiflorum Lindl.) is a medium-sized, deciduous shrub native to China that has become a popular choice among gardeners and landscapers. In 2020 to 2021, symptoms of anthracnose including brown necrotic spots, enlarged irregular lesions and leaf blight were observed on leaves of 20 winter jasmine shrubs in a public garden (22°34'58'' N; 113°56'23'' E) in Shenzhen, China, and with an estimated disease incidence of 65%. Tissues samples (6 × 6 mm2) surrounding the necrotic spots were surface sterilized with 75% ethanol for 30 s, followed by 2% NaClO for 1 min, then rinsed with sterile water for three times and dried with sterile filter paper. Tissues were placed on potato dextrose agar (PDA) medium and incubated at 25℃. After 3 to 7 d, pure cultures were obtained by transferring hyphal tips to new plates and 32 isolates producing Colletotrichum-like colonies were obtained from 40 tissues (isolation frequency=32/(4×10)=80%). Three representative isolates YCH09, YCH23 and YCH32 were selected for further study. Three selected isolates were identical in morphological characteristics. Colonies on PDA after 5 d at 25℃ were white to gray with cottony mycelia and grayish-white on the underside of the culture. Conidia (n = 60) measured 15.4 ± 1.1 µm (13.0 to 17.1 µm) in length and 5.4 ± 0.3 µm (4.9 to 6.0 µm) in width and were hyaline, single-celled, cylindrical with rounded ends. Appressoria (n = 15) measured 7.1 ± 0.1 µm (5.3 to 8.9 µm) in length and 5.2 ± 0.2 µm (4.1 to 6.2 µm) in width and were brown to dark brown, ovoid. These morphological features were aligned with those of Colletotrichum spp. (Weir et al. 2012). Sequences of five genetic markers of representative isolates YCH09, YCH23 and YCH32 including the rDNA internal transcribed spacer region, chitin synthase, partial actin, ß-tubulin 2 and Apn2-Mat1-2 intergenic spacer and partial mating type (Mat1-2) region were 99.3 to 100% identical to the ex-type isolate of C. fructicola strain ICMP 18581 (Zhang et al., 2020). From the maximum likelihood phylogenetic tree which was constructed based on concatenated sequences, three representative isolates (YCH09, YCH23 and YCH32) were clustered with other isolates of C. fructicola. The above morphological and molecular characteristics suggest that causal agent was C. fructicola. Pathogenicity was tested using a whole-plant assay. Five healthy plants were inoculated by spraying a conidial suspension (1.5×104 conidia/ml; 20 ml per plant) of the isolate YCH23 onto the foliage (Marshall et al., 2023). Three noninoculated control plants were sprayed with sterile water. All plants were placed in a greenhouse at 25±2℃ with approximately 75% relative humidity. Yellow lesions appeared on leaves of inoculated plants as early as 4 days after inoculation (DAI), and irregularly shaped brown spots similar to those observed in the field were formed on 10 DAI. Noninoculated plants remained asymptomatic. Colletotrichum isolates resembling morphological characters of YCH23 were reisolated from all inoculated plants, then identified as C. fructicola by DNA sequence analysis. C. fructicola is a well-known fungus causing anthracnose on more than 63 plant species including agricultural and horticultural plants worldwide (Talhinhas and Baroncelli, 2021). To our knowledge, this is the first report of C. fructicola infecting J. nudiflorum plants in China. Since its potential risk to other horticultural plant species, precautions may be necessary to minimize the spread of this fungi.

RESUMEN

Ivy (Hedera nepalensis var. sinensis (Tobl.) Rehd) is an evergreen root-climbing vine, widely cultivated in eastern Asia because of its ornamental, environmental, and medicinal value (Wu et al. 2019). In October 2023, the leaf spot symptom of Ivy was observed in the Kunming Botanical Garden in Yunnan Province, China (25.14°N, 102.75°E), and the disease incidence was up to 38% (76 of 200 leaves). Initially, dark-brown or black small spots appeared on the leaves. As the lesions progressed, their center emerged tawny, and the black halos were expanded around the lesions. In severe cases, small spots could link together to form leaf blight even resulting in blade death. In order to obtain pure isolates, 10 diseased leaves were collected and cut into 1 mm × 1 mm pieces, surface disinfected with 75 % ethanol for 30 s, followed by 3% NaClO for 3 min, and finally washed three times with sterilized water. The pieces were placed on the potato dextrose agar (PDA) media, which was incubated at 25°C for 3 days. Individual hyphal tips from the developing fungal colonies were placed on PDA and incubated for 5 to 10 days. Six strains (6 out of 10) were obtained with same colony morphology. Conidia were hyaline, unicellular, nonseptate, ellipsoidal or fusiform, thin walled, externally smooth and ranged from 15.0 to 22.0 (avg. 18.4) µm × 5.0 to 8.0 (avg. 7.2) µm (n=30). Morphological comparison proposed that the present fungi belonged to Neofusicoccum (Zhang et al. 2021). Two isolates (GUCC23-0141 and GUCC23-0142) were selected for multi-gene phylogenetic analyses. The PCR reaction of the internal transcribed spacer region (ITS), translation elongation factor 1-α (EF1-α), and ß-tubulin genes were run using primers ITS1/ ITS4 (White et al. 1990), EF1-728F/ EF1-986R (Carbone and Kohn 1999), and Bt2a/ Bt2b (Glass and Donaldson 1995). The accession numbers of DNA sequences of GUCC23-0141 and GUCC23-0142 are ITS: PP728109 and PP728110; TUB2: PP744490 and PP744491; and TEF1-α: PP744488 and PP744489. BLAST analysis showed 100% identity for ITS and TUB2, and 98.97% for TEF1-α with the Neofusicoccum yunnanense (CSF6142). Phylogenetic analyses also supported that our isolates kept a close relationship to N. yunnanense. Three one-year plants were used for pathogenicity test, two of which were inoculated with PDA plugs containing N. yunnanense and one of which was inoculated with blank PDA plugs and used as control. For each plant, three leaves were selected to conduct the test, whose surfaces were sterilized with 75% alcohol. All the leaves were covered with cotton moistened with sterilized water on top. All plants were placed in a greenhouse with 25℃ and 75% humidity. Few small black spots were observed at the inoculation site after 3 days, which were enlarged gradually after 7 days. However, control plants remained healthy. N. yunnanense was reisolated from the diseased tissues and identified based on morphological and molecular characteristics. On basis of pathogen identification and Koch's test, we proposed the leaf spot of Ivy caused by N. yunnanense. This was the first report about N. yunnanense causing the disease of Ivy. This result provides a theoretical basis for further research into the control of the disease. As an important ornamental plant, we should pay attention to the management of this disease.

RESUMEN

Verbena × hybrida, also known as common garden verbena, has an important ornamental value for their wide range of flower colors and for attracting hummingbirds and butterflies. During the winter of 2021-2022 (December through February), more than 50% pot-grown verbena plants showed symptoms of powdery mildew in a field trial at a Syngenta Crop Protection research facility in Vero Beach, FL. Symptoms were characterized by the development of white, superficial mycelium on the adaxial side of leaves which, eventually, progressed to covering the whole surface of leaves, causing leaf discoloration, shoot distortion, and eventual plant death. Morphological characterization was carried out by observing powdery mildew colonies under the microscope. This powdery mildew forms dense patches of white mycelia, mainly on the adaxial leaf surfaces. The mycelium was a mat of hyphae with septa. Conidiophores were erect. The foot cells were straight, followed by one to three short cells bearing short chains of up to four conidia. The conidia were hyaline and ellipsoidal to doliiform in shape. Conidial germination is of the Eudoidium type. The conidia ranged from 25 to 32 µm long by 12 to 16 µm wide. The length to width ratio ranged between 1.6 and 2.3, but most were between 2.0 and 2.2. This is further verification of its identity as Golovinomyces ambrosiae and not Golovinomyces latisporus, because the length to width ratio of the latter species is consistently less than 2.0 (Qiu et al. 2020). Chasmothecia were not observed. Additionally, the ITS, GAPDH, and IGS regions were sequenced using the primer pairs ITS4/ITS5 (White et al. 1990), PMGAPDH1/PMGAPDH3R (Bradshaw et al. 2022a), and IGS-12a/NS1R (Carbone and Kohn 1999), respectively. The ITS region (GenBank number=PP924119) cannot distinguish between G. latisporus and G. ambrosiae and as such aligned 100% with both species on GenBank. However, the GAPDH and IGS regions can be used to distinguish G. ambrosiae from G. latisporus (Bradshaw et al. 2022b). The GAPDH (GenBank number=PP931995) and IGS (GenBank number=PP931996) regions aligned 100% with multiple G. ambrosiae sequences from GenBank including ON360708 and MK452567, respectively. The specimen was deposited in the Larry F. Grand Mycological Herbarium (NCSLG 24479). To confirm pathogenicity, 'Tuscany® Pink Picotee' and 'Quartz XP Violet with Eye' plugs were transplanted to 10-cm diameter pots containing ProMix potting mix and maintained in a greenhouse (± 26 °C). Inoculation was carried out 21 days after transplanting by touching infected leaves onto healthy leaves of 15 disease-free plants of each variety. Fifteen non-inoculated plants of each variety were used as controls. Typical powdery mildew symptoms and signs were first observed ten days after inoculation and the pathogen was more aggressive on 'Tuscany® Pink Picotee'. Symptoms were not observed on non-inoculated plants. The fungus was morphologically identical to the one originally recovered from infected plants in the field. There have been many reports of Golovinomyces spp. affecting Verbena spp. worldwide; however, this is the first report of G. ambrosiae causing powdery mildew on Verbena × hybrida in the U.S. (Braun and Cook, 2012, Choi et al., 2021; Bradshaw et al. 2024). Powdery mildews reduce plant quality and decreases the aesthetics value of infected plants, causing great losses to the ornamental industry. Correct identification of the causal agent is crucial to recommend appropriate control methods, as they may differ according to the pathogen species.

RESUMEN

Tomato zonate spot virus (TZSV, Orthotospovirus tomatozonae, genus Orthotospovirus, family Tospoviridae) was first reported to infect tomato (Solanum lycopersicum) in China in 2008 (Dong et al. 2008). Belamcanda chinensis (L.) Redouté is a perennial herbaceous medicinal plant of the family Iridaceae, which is widely distributed in China. Its rhizome contains abundant active components, mainly including flavonoids, and has antibacterial, anticancer, and antioxidative effects. In July 2023, four B. chinensis plants with virus-like symptoms were collected in Fuyuan County, Yunnan Province in China. The diseased leaves showed chlorosis and ringspots (Fig. S1). Spherical virus particles with a diameter of 80-100 nm were observed in the saps of diseased leaves under a transmission electron microscope (Fig. S2). The presence of an orthotospovirus was confirmed by the previously reported method to amplify the partial sequence (312 nt) of L segment (Huang et al. 2018) (Fig. S3). BLASTn analysis showed that the obtained 312-nt sequence was 95.62% nucleotide identity with TZSV tomato-YN isolate (accession no. NC_010491.1). To obtain the complete genome of this isolate, total RNA from symptomatic leaves of two single diseased B. chinensis were extracted using Hipure Universal RNA Mini Kit (Magen Biotech) and subjected to high-throughput sequencing with a NovaPE150 (Illumina, USA) at MAGIGENE (Shenzhen, China). A total of 41,144,571 clean reads were obtained after removing low quality reads. Quality-controlled, qualified reads were assembled into contigs using Megahit v1.1.2 software. Thirteen contigs shared nucleotide identity ranging 86.94%-97.73% with the L, S, and M segments of TZSV using BLASTn searches online (https://blast.ncbi.nlm.nih.gov/Blast.cgi). In addition, no contigs were mapped to other viral (taxid:10239) and viroidal (taxid:12884) sequences in GenBank Databases. The full-length L, M, and S RNA segments of TZSV-Bc isolate was determined tbe 8917 nt (PP314222), 4718 nt (PP314223) and 3213 nt (PP314224), respectively. These segments were validated by RT-PCR, and Sanger sequencing. They shared nucleotide sequence identities of 95.9%, 97.2%, and 93.1% of the L (NC_010491.1), M (NC_010490.1), and S (NC_010489.1) segments, of the TZSV tomato-YN isolate, respectively. Compared to the TZSV tomato-YN isolate, there exists a missing segment with 113 nt in the intergenic region of S RNA and a segment with 199 nt in M RNA. To further confirm the TZSV infection on B. chinensis, three primers pairs Tosp10/ Tosp11， Tosp5/Tosp6, and NSs-F/NSs-R were tested by RT-PCR for TZSV based on the previous report (Dong et al, 2008). The sequences of amplicons shared >99% nucleotide identity with the corresponding TZSV-Bc isolate sequences. Total of 14 B. chinensis samples were detected with the primer pair N-F/N-R (5'-ATGTCTAACGTCCGGAGTTTAACA-3'/ 5'-AAAAGACAGATCATTGCTGCTCTT-3') by One Step RT-PCR, 6 samples (42.85%) showed the positive results. The mechanical inoculation and RT-PCR detection confirmed TZSV-Bc isolate can infect N. bethamiana. So far, tomato zonate spot virus has been detected in different plants including tobacco (N. tabacum) (Huang et al. 2017), sticktight (Bidens pilosa) (Xu et al. 2022), pepper (Capsicum annuum) (Li et al. 2023) in China. To our knowledge, it is the first report of TZSV naturally infecting B. chinensis plants, which enriches information on the host range of TZSV and will be helpful for disease management.

RESUMEN

Xanthium strumarium, known as cocklebur, is an annual herb and has been used in traditional Chinese medicine. In October 2020, powdery mildew-like disease signs and symptoms were observed on X. strumarium grown in a crop field, Xinxiang city, Henan Province, China (35.36076° N, 113.93467° E). The specimen (PX-XS2023) was stored in Xinxiang Key Laboratory of Plant Stress Biology. White colonies in irregular or coalesced circular shaped-lesions were abundant on both ad- and abaxial surfaces of leaves and covered up to 99 % of the leaf area. Some of the infected leaves were senesced. More than 70 % of plants (n = 130) exhibited these signs and symptoms. Conidiophores were straight or slightly curved, 55 to 160 × 11 to 13 µm composed of foot-cells, shorter cells and conidia. Conidia were ellipsoid to oval, 29 to 40 × 14 to 20 µm (n = 50), with a length/width ration of 2.0 to 2.5, containing fibrosin bodies. Dark brown to black chasmothecia were found on infected leaves. The appendages were mycelium-shaped and at the base of scattered or gregarious chasmothecia (n = 50, 70 to 120 µm in diameter). Asci were 55 to 80 × 50 to 65 µm (n=30). These morphological characteristics were consistent with those of Podosphaera xanthii (Braun and Cook 2012). The internal transcribed spacer (ITS) region and Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) region of the fungus (PX-XS2023) were amplified and sequenced with primers ITS1/ITS4 (White et al. 1990) and GAPDH1/GAPDH3R (Bradshaw et al. 2022) according to a previously reported method (Zhu et al. 2022). The resulting sequences were respectively deposited into GenBank (Accession No. MW300956 and PP236083). BLASTn analysis indicated that the sequences were respectively 99.82 % (564/565) and 100% (272/272) identical to P. xanthii (MT260063 and ON075658). The phylogenetic analysis indicated that the strain PX-XS2023 and P. xanthii were clustered into a same branch. Therefore, the causal agent of powdery mildew on X. strumarium was P. xanthii. To conduct pathogenicity assays, mature leaves of five healthy X. strumarium (height in 50 centimeters) were inoculated with fungal conidia by gently pressing surfaces of infested leaves onto leaves of healthy plants (Zhu et al. 2020). Five untreated plants served as controls. The controls and inoculated plants were separately maintained in greenhouses (humidity, 60%; light/dark, 16 h/8 h; temperature, 18°C). Eight days post-inoculation, signs of powdery mildew were detectable on inoculated plants, however, the controls were asymptomatic. Thus, the fungal pathogen was morphologically and molecularly identified and confirmed as P. xanthii. This powdery mildew caused by P. xanthii was previously reported on X. strumarium in Korea, Russia and India (Farr and Rossman, 2021). In addition, P. xanthii was recorded on X. strumarium in Xinjiang Province, China (Tai 1979). However, this is the first report of P. xanthii on X. strumarium in central China, where is around 3000 km away from Xinjiang Province with geographically differences. The sudden presence of powdery mildew caused by P. xanthii may adversely affect plant health and thus reduce medical value of X. strumarium. Therefore, the identification and confirmation of P. xanthii infecting X. strumarium enhance the knowledge on the hosts of this pathogen in China and will provide fundamental information for disease control in the future.

RESUMEN

Lonicera japonica Thunb. is a traditional Chinese medicinal plant, which widely cultivated in China, Japan and Korea. From August to October in 2021 and 2022, severe leaf spots symptoms were observed on L. japonica in medicinal botanical garden of Shandong University of Traditional Chinese Medicine (36°55'89"N, 116°79'91"E), Jinan, Shandong Province, China. The disease incidence was above 80% in the 25 acre cultivation area. Early symptoms were small brown spots on the leaves. Then the number of small spots gradually increased and spread over the entire leaves. The small brown spots seldom merge together to form larger lesions. Leaves with typical symptoms were collected from twenty individual plants, and cut into small 5×5 mm fragments in the junction of infected and healthy tissues. The fragments were sterilized in 75% ethanol for 30 s and 1% NaClO for 60 s, rinsed three times in sterile water, and then placed on potato dextrose agar (PDA). After 3 days of incubation at 25°C, fungal plugs along the edge of the colony were cut and transferred to new PDA for purification. A total number of 23 colonies with similar morphological characteristics were obtained, and three representative strains (Lj14, Lj18 and Lj20) were selected for subsequent study. The colonies grew rapidly on PDA and covered the entire petri dish in 4 days. Colonies had abundant aerial hyphae, initially white, round, later turning gray and black. Conidia were oblate or nearly spherical, single-celled, black, and measured in size from 9.6 to 13.2 µm × 7.9 to 16.1 µm in diameter (n=150) (Figure S1). The observed characteristics were close to those of Nigrospora spp. ( Wang et al. 2017). The genomic DNA was extracted, and PCR amplification of the rDNA internal transcribed spacer (ITS), ß-tubulin gene (TUB), and translation elongation factor 1-alpha gene (TEF1) were completed by primers ITS1/ITS4, Bt2a/Bt2b and EF1-728F/EF1-986R (Carbone and Kohn, 1999). Sequences were deposited in GenBank (accession nos. OR936661, OR936662, OR936671 for ITS, OR947626, OR947627, OR947628 for TUB, and OR947629, OR947630, OR947631 for TEF1 sequences, respectively). BLAST analyses of ITS (OR936661), TUB(OR947626) and TEF1 (OR947629) sequences exhibited 100% (487 bp out of 487 bp), 99.48% (380 bp out of 382 bp), and 99.6% (248 bp out of 249 bp) similarity to the sequences of N. oryzae strains KoLRI_053384 (MZ855426), LC2991 (KY019496) and LC7307 (KY019409), respectively. Lj14, Lj18 and Lj20 formed a clade with N. oryzae LC6763 and LC2991 in phylogenetic tree (Figure S2). Based on morphological and molecular evidence, the pathogen was identified as N. oryzae (Berk. &Broome) Petch. To fulfill Koch's postulates, the pathogenicity was tested in vivo experiments. Thirty non-wounded healthy leaves of ten intact plants were inoculated with 10 µl spore suspension (106 spores/ml) of three strains, respectively. As negative control, thirty leaves of ten healthy plants were inoculated with sterile water. The inoculated plants were placed at 28°C in the growth chamber with high relative humidity. The pathogenicity tests were repeated three times. Distinct symptoms similar to that of natural conditions were observed on the leaves of inoculated plants after 4 to 7 days. The strain was reisolated from the lesions and identified as N. oryzae by morphological features and ITS sequence. The pathogen has been reported to cause leaf spot disease on tobacco (Wang et al. 2022) and asiatic dayflower (Qiu et al. 2022). To our knowledge, this is the first report of leaf spot caused by N. oryzae on Lonicera japonica in China. The research will be helpful for leaf spot disease control.

RESUMEN

Floral transition from the vegetative to the reproductive stages is precisely regulated by both environmental and endogenous signals. Among these signals, photoperiod is one of the most important environmental factors for onset of flowering. A florigen, FLOWERING LOCUS T (FT) in Arabidopsis, has thought to be a major hub in the photoperiod-dependent flowering time regulation. Expression levels of FT likely correlates with potence of flowering. Under long days (LD), FT is mainly synthesized in leaves, and FT protein moves to shoot apical meristem (SAM) where it functions and in turns induces flowering. Recently, it has been reported that Arabidopsis grown under natural LD condition flowers earlier than that grown under laboratory LD condition, in which a red (R)/far-red (FR) ratio of light sources determines FT expression levels. Additionally, FT expression profile changes in response to combinatorial effects of FR light and photoperiod. FT orthologs exist in most of plants and functions are thought to be conserved. Although molecular mechanisms underlying photoperiodic transcriptional regulation of FT orthologs have been studied in several plants, such as rice, however, dynamics in expression profiles of FT orthologs have been less spotlighted. This review aims to revisit previously reported but overlooked expression information of FT orthologs from various plant species and classify these genes depending on the expression profiles. Plants, in general, could be classified into three groups depending on their photoperiodic flowering responses. Thus, we discuss relationship between photoperiodic responsiveness and expression of FT orthologs. Additionally, we also highlight the expression profiles of FT orthologs depending on their activities in flowering. Comparative analyses of diverse plant species will help to gain insight into molecular mechanisms for flowering in nature, and this can be utilized in the future for crop engineering to improve yield by controlling flowering time.

RESUMEN

Caladium (Caladium × hortulanum) is an ornamental plant popular for its variable and colorful foliage. In 2020, plants showing leaf spots and blight, typical of anthracnose, were found in a field trial at the University of Florida's Gulf Coast Research and Education Center in Wimauma, Florida, U.S.A. Leaf samples consistently yielded a Colletotrichum-like species with curved conidia and abundant setae production in the acervuli. The internal transcribed spacer (ITS), partial sequences of the glyceraldehyde-3-phosphate dehydrogenase gene (gapdh), actin gene (act), chitin synthase 1 gene (chs-1), beta-tubulin gene (tub2), and histone3 gene (his3) were amplified and sequenced. BLASTN searches in the NCBI GenBank database revealed similarities to species of the Colletotrichum truncatum species complex. Phylogenetic analyses using multilocus sequence data supports a distinct species within this complex, with the closest related species being C. curcumae. Based on morphological and phylogenetic analyses, a new species of Colletotrichum, named C. caladii, is reported. Pathogenicity assays and subsequent isolation confirmed that this species was the causal agent of the disease.

RESUMEN

MAIN CONCLUSION: Significant past, present, and potential future research into the organellar (plastid and mitochondrial) genomes of gymnosperms that can provide insight into the unknown origin and evolution of plants is highlighted. Gymnosperms are vascular seed plants that predominated the ancient world before their sister clade, angiosperms, took over during the Late Cretaceous. The divergence of gymnosperms and angiosperms took place around 300 Mya, with the latter evolving into the diverse group of flowering plants that dominate the plant kingdom today. Although gymnosperms have reportedly made some evolutionary innovations, the literature on their genome advances, particularly their organellar (plastid and mitochondrial) genomes, is relatively scattered and fragmented. While organellar genomes can shed light on plant origin and evolution, they are frequently overlooked, due in part to their limited contribution to gene expression and lack of evolutionary dynamics when compared to nuclear genomes. A better understanding of gymnosperm organellar genomes is critical because they reveal genetic changes that have contributed to their unique adaptations and ecological success, potentially aiding in plant survival, enhancement, and biodiversity conservation in the face of climate change. This review reveals significant information and gaps in the existing knowledge base of organellar genomes in gymnosperms, as well as the challenges and research needed to unravel their complexity.

Asunto(s)

RESUMEN

Salvia farinacea, commonly referred as mealycup sage, is a perennial herbaceous plant belonging to the Salvia genus of the Lamiaceae family. It originates from the Mediterranean region, North America, and Europe and is globally cultivated due to its appealing and captivating flowers. Moreover, mealycup sage is utilized as traditional Chinese medicinal plant for treatment of cardiovascular diseases (Li et al. 2018). In October 2023, powdery mildew-like symptoms were observed on Salvia farinacea plants cultivated in a garden located in Xinxiang City, Henan Province, China (113.93, 35.29). The leaves were covered with white and thin masses of mycelia, conidiophores and conidia of the fungus. About 100 plants were checked and 90 % were infected. There were a large number of white colonies with irregular or continuous round lesions on the adaxial and abaxial surfaces of the leaves, covering approximately 80% of the leaf area. The slightly or straight curved conidiophores (n = 30) were 46 to 145× 8 to 11 µm in size and consisted of foot cells, shorter cells and conidia. The ellipsoidal to oval conidia (n = 30), containing fibrosin bodies, were 24 to 35 × 12 to 19 µm in size and had a length/width ratio of 1.8 to 2.1. No chasmothecia were observed on leaves. These morphological features were consistent with those of Podosphaera xanthii (Braun and Cook 2012). Following the previously described method (White et al. 1990; Bradshaw et al. 2022; Zhu et al. 2022a), the sequences of ITS and Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) regions were amplified with specific primers ITS1/ITS4 (ITS1 5'-TCCGTAGGTGAACCTGCGG-3' ; ITS4 5'-TCCTCCGCTTATTGATATGC-3') and PMGAPDH1/PMGAPDH3R (PMGAPDH1 5'-GGAATGGCTATGCGTGTACC-3'; PMGAPDH3R 5'-CCCCATTCGTTGTCGTACCATG-3'), and the resulting sequences were uploaded in GenBank (Accession No. OR761885 and PP236082, respectively). BLASTn analysis showed that the sequence shared 560/565 (99%) and 272/272 (100%) homology with P. xanthii (MW301281) on Impatiens balsamina (Zhu et al. 2022b) and with P. xanthii (ON075658) on Cucumis melo (Bradshaw et al. 2022), respectively. The phylogenetic analysis clearly illustrated that the collected isolate of P. xanthii clustered in the same clade. The pathogenicity was tested according to the method previously described (Zhu et al. 2021). The fungus was inoculated onto the leaf surfaces of three healthy plants by blowing conidia from infected leaves with pressurized air. Non-inoculated plants were treated as control. Both the control and inoculated plants were separately placed in growth chambers under 60% humidity; light/dark, 16 h/8 h; and a temperature of 18°C. After a period of 12-15 days, the leaves of the inoculated plants exhibited signs of powdery mildew, whereas the control group remained unaffected. Therefore, the fungal pathogen was identified and confirmed as P. xanthii (isolate PXSF202310). Previously, P. xanthii was reported on Impatiens balsamina and S. farinacea from China and Korea (Zhu et al. 2021; Choi et al. 2022). As far as we know, this is the first documentation of P. xanthii on S. farinacea in central China. The presence of P. xanthii can lead to a deterioration in plant health and stunted growth, thereby negatively impacting both the decorative and medicinal value of S. farinacea. The recognition of P. xanthii on S. farinacea enhances our comprehension of this pathogen hosts and provides fundamental information for forthcoming disease control studies.

RESUMEN

Lippia (Phyla canescens) is a fast-growing, mat-forming, and prostrate perennial plant well adapted to infertile, high-saline, and drought environments (Leigh, et al. 2004). It arrived in China from Japan as a flowering ground cover in 2001 (Cai, et al. 2004). In June 2022, southern blight appeared in our nursery of the Floriculture Research Institute of Guangdong Academy of Agricultural Sciences. High temperature and damp environment are major factors for this disease. The symptoms of top-layer plants were not easily detected, but they were slightly yellowed. A yellowish-brown water-soak lesion appeared on the stems and lowest leaves exposed to soil. White mycelium appeared in the middle stage. Finally, the surface plants showed water-soak decay, and a mass of beige to black-brown rapeseed-shaped sclerotia appeared on the residue and surrounding soil; these plants died. Sclerotia and mycelia were collected from disease tissue, and after surface sterilization, sclerotia was cultured on potato dextrose agar (PDA) at 28±2°C in an incubator without light. Eight fungal isolates with similar colony morphologies were consistently isolated by purifying from different sampling areas. The isolates exhibited obvious septa and a clamp connection structure within the white mycelium. The average growth rate was 26.86±0.06 mm/day. Numerous white granular sclerotia were produced on the mycelium 6 days later. The sclerotia with a diameter of 1.24±0.07mm (n=189) gradually changed from diage to yellow to brown. A typical strain B1 was selected for further identification, targeting its 18S rRNA and LSU rRNA sequences (Yang, et al. 2011; Xue, et al. 2019). Its 18S rRNA sequence (GenBank Accession No. OR517233, 1626 bp) is 99.63% and 99.57% identical to Athelia rolfsii (AY665774, 1179bp; KC670714, 1775bp; JF819726, 1781bp). Its LSU rRNA sequence (OR539570, 757 bp) is 99.87% identical to Agroathelia rolfsii (OR526537, 904 bp). For Athelia rolfsii, a synonym of Agroathelia rolfsii, by combining the morphological characteristics and molecular identification, the isolate pathogen B1 was confirmed to be Agroathelia rolfsii (the teleomorph of Sclerotium rolfsii). To fullfill Koch's postulates, we inoculated the mycelial plugs to healthy lippia stems and leaves which has grown for one year, with PDA plugs free of mycelium as the control. All the plants were kept in a greenhouse at 28±2°C with a 14-h photoperiod and 80% relative humidity. Each treatment was repeated thrice and vaccinated with 6 points. At 7 d following inoculation, all plants inoculated with B1 showed typical symptoms, but the control group was asymptomatic, and sclerotia appeared 17d after inoculation. Using the same protocol mentioned above, pathogenic fungal was reisolated only from treated groups, but not from the control group. Chose three of the pathogens for 18S rRNA and LSU rRNA sequencing, the results showed 100% identity to B1, the same as its microstructure. There are few reports about the disease on P. canescens. Sosa (2007) investigated the pathogens on P. canescens in Argentina, 16 fungi were found but no A. rolfsii. Sclerotium rolfsii were identified on P. nodiflora or P. lanceolata (Michaux) Greene in America (Farr, et al. 1989). To our knowledge, this is the first report in China. Because this pathogen has wide-ranging hosts and causes serious damage, the results from this study will offer guidance for the prevention and treatment of this disease.

RESUMEN

In 2004, David Frodin published a landmark review of the history and concepts of big plant genera. Two decades of taxonomic activity have taken place since, coinciding with a revolution in phylogenetics and taxonomic bioinformatics. Here we use data from the World Flora Online (WFO) to provide an updated list of big (more than 500 species) and megadiverse (more than 1000 species) flowering plant genera and highlight changes since 2004. The number of big genera has increased from 57 to 86; today one of every four plant species is classified as a member of a big genus, with 14% in just 28 megadiverse genera. Most (71%) of the growth in big genera since 2000 is the result of new species description, not generic re-circumscription. More than 15% of all currently accepted flowering plant species described in the last two decades are in big genera, suggesting that groups previously considered intractable are now being actively studied taxonomically. Despite this rapid growth in big genera, they remain a significant yet understudied proportion of plant diversity. They represent a significant proportion of global plant diversity and should remain a priority not only for taxonomy but for understanding global diversity patterns and plant evolution in general.

Asunto(s)

RESUMEN

Acalypha indica L. is an annual erect herb of the Euphorbiaceae family. This plant is found widely in the tropics and parts of Africa and Asia (Chakraborty et al. 2023). In China, A. indica is a vegetable and also used as a folk medicine due to its antipyretic and hemostatic, antibacterial and anti-inflammatory properties. In February 2022 and 2023, powdery mildew symptoms were observed on 70% of A. indica plants on the Hainan Medical University campus (19° 58' 53″ N; 110° 19' 47″ E) in Haikou, Hainan Province, China. Powdery mildew colonies covered the leaf surfaces and stems of affected plants, causing discoloration and defoliation. Mycelia were superficial and hyphal appressoria were nipple-shaped. Conidiophores (n =30) were unbranched, cylindrical, 66 to 150 × 10 to 15 µm, and produced three to five immature conidia in chains with a crenate outline. Foot cells (n =30) were cylindrical, straight or sometimes curved at the base, and 31 to 59 µm long. Conidia (n =100) were ellipsoid-ovoid to doliiform, 20 to 33 ×12 to 20 µm (length/width ratio = 1.3 to 2.4), with well-developed fibrosin bodies, and produced germ tubes from the lateral position. Based on these morphological characteristics, the pathogen was provisionally identified as Podosphaera xanthii (Braun and Cook 2012). The teleomorph was not observed. A specimen was deposited in the Hainan Medical University Plant Pathology Herbarium as HMAI-23. To confirm the genus identification and ascertain a putative species, genomic DNA was extracted from mycelium, conidiophores, and conidia using a fungal DNA kit (Omega Bio-Tek, USA). The rDNA internal transcribed spacer (ITS) region was amplified with primers ITS1/ITS4 (White et al. 1990) and sequenced directly. The resulting 575-bp sequence was deposited in GenBank (accession no. OR775733). A BLASTn search in GenBank of this sequence showed 99% similarity with the ITS sequences of P. xanthii on plants of Fabaceae, Malvaceae and Cucurbitaceae family from China (MH143485, MT242593, MK439611 and MH143483), Thailand (LC270779 and LC270778), Korea (MG754404), Vietnam (KM260704), and Puerto Rico (OP882310). Additionally, the 28S rDNA region was amplified using the primer pairs NL1 and NL4 (O´Donnell 1993; accession no. OR784547). This region shared 99% similarity with P. xanthii isolates (LC371333, LC270780, AB936277, and OP765401) as well. To confirm pathogenicity, five healthy potted plants of A. indica were inoculated by gently pressing a powdery mildew-infected leaf onto 15 young leaves. Five non-inoculated plants served as controls. All plants were maintained in a greenhouse at 24 to 30°C, 70% relative humidity, with a 16-h photoperiod. After 7 days, inoculated leaves showed powdery mildew symptoms whereas no symptoms were observed on control plants. The fungal colonies observed on inoculated plants were morphologically identical to those found on the originally infected leaves collected from Hainan Province. Based on the morphological characteristics and molecular identification, the fungus was identified as P. xanthii. In different countries and regions, P. xanthii has been previously reported on A. indica from Sudan and India (Amano 1986). To our knowledge, this is the first record of P. xanthii infecting A. indica in China. We are concerned that the pathogen could become a threat to the widespread planting of A. indica in the future.

RESUMEN

Echeveria gigantea, native of Mexico (Reyes et al. 2011), holds economic importance as it is marketed as a potted plant and cut flower due to its drought-tolerant capabilities and aesthetic appeal. In September 2023, a field sampling was conducted at the Research Center in Horticulture and Native Plants (18°55'56.6" N, 98°24'01.5" W) of UPAEP University. Echeveria gigantea cv. Quilpalli plants with white mold symptoms were found in an area of 0.5 ha, with an incidence of 40% and severity of 50% on severely affected stems. The symptoms included chlorosis of older foliage, necrosis at the base of the stem, and soft rot with abundant white to gray mycelium and abundant production of irregular sclerotia resulting in wilted plants. The fungus was isolated from 30 symptomatic plants. Sclerotia were collected, sterilized in 3% NaOCl, rinsed with sterile distilled water (SDW), and plated on Potato Dextrose Agar (PDA) with sterile forceps. Subsequently, a dissecting needle was used to place fragments of mycelium directly on PDA. Plates were incubated at 23 °C in darkness. A total of 30 isolates were obtained using the hyphal-tip method, one from each diseased plant (15 isolates from sclerotia and 15 from mycelium). After 6 days, colonies had fast-growing, dense, cottony-white aerial mycelium forming irregular sclerotia of 3.67 ± 1.13 mm (n=100). Each Petri dish produced 32.47 ± 7.5 sclerotia (n=30), after 12 days. The sclerotia were initially white and gradually turned black. The isolates were tentatively identified as Sclerotinia sclerotiorum based on morphological characteristics (Saharan and Mehta 2008). Two isolates were selected for molecular identification. Genomic DNA was extracted using the CTAB protocol. The ITS region and the glyceraldehyde 3-phosphate dehydrogenase (G3PDH) gene were sequenced for two randomly selected isolates (White et al. 1990; Staats et al. 2005). The ITS and G3PDH sequences of the SsEg9 isolate were deposited in GenBank (ITS-OR816006; G3PDH-OR879212). BLAST analysis of the partial ITS (510 bp) and G3PDH (915 bp) sequences showed 100% and 99.78% similarity to S. sclerotiorum isolates (GenBank: MT101751 and MW082601). Pathogenicity was confirmed by inoculating 30 120-day-old E. gigantea cv. Quilpalli plants grown in pots with sterile soil. Ten sclerotia were deposited at the base of the stem, 10 mm below the soil surface. As control treatment, SDW was applied to 10 plants. The plants were placed in a greenhouse at 23 °C and 90% relative humidity. After 16 days, all inoculated plants displayed symptoms similar to those observed in the field. Control plants did not display any symptoms. The fungus was reisolated from the inoculated stems, fulfilling Koch's postulates. The pathogenicity tests were repeated three times. Recently S. sclerotiorum has been reported causing white mold on cabbage in the state of Puebla, Mexico (Terrones-Salgado et al. 2023). To the best of our knowledge, this is the first report of S. sclerotiorum causing white mold on E. gigantea in Mexico. Information about diseases affecting this plant is very limited, so this research is crucial for designing integrated management strategies and preventing spread to other production areas.

RESUMEN

Chrysanthemum (Chrysanthemum morifolium cv. Fubaiju) is used as medicinal herb (Chen et al. 2020). In October 2021, a leaf spot disease was observed on leaves of C. morifolium in Huanggang, Hubei province. Disease incidence was approximately 40%. Leaf lesions manifested as necrotic spots, coalesced, and expanded to form brown-black spots, leading to wilting of the leaves. On stems, the lesions manifested as dark brown necrotic spots. To identify the pathogen, 29 pieces (5 × 5 mm) from lesion margins were surface sterilized in 1% NaOCl and rinsed three times with sterile water. The pieces were transferred onto potato dextrose agar (PDA) for incubation at 25℃ for 3 d in the dark. Fifteen fungal colonies were successfully isolated. The colony morphology with flat wavy edge, sparse aerial mycelia, and surface olivaceous black were observed at 7 days post incubation. Subglobular pycnidia were brown with a short beak, and pycnidia diameters were thick (212 to 265 × 189 to 363 µm, n = 20). Ovoid conidia were aseptate and hyaline, conidia diameters were thick (4.0 to 9.8 × 1.8 to 4.7 µm, n = 100). The morphological characters of these isolates were consistent with those of Stagonosporopsis chrysanthemi (Zhao et al. 2021). Pure culture of representative HGNU2021-18 isolated from the diseased leaves subjected to molecular identification. Sequences of the rDNA internal transcribed spacer (ITS) region, 28S large subunit ribosomal RNA (LSU), ß-tubulin (TUB2), actin (ACT), and partial RNA polymerase II largest subunit (RPB2) genes were amplified from genomic DNA of isolate HGNU2021-18 using the following primer pairs: ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Rehner et al. 1994), Btub2Fd/Btub4Rd (Woudenberg et al. 2009), ACT512F/ACT783R (Carbone et al.1999), and RPB2-5F2 (Sung et al. 2007)/fRPB2-7cR (Liu et al. 1999), respectively. The PCR products were purified and then sequenced by Sangon Biotech (China). Nucleotide sequences of ITS (544 bp, OM346748), LSU (905 bp, OM758418), TUB2 (563 bp, OM945724), ACT (294 bp, OM793715), and RPB2 (957 bp, OM793716) amplified from the isolate HGNU2021-18 were subjected to BLASTn analysis. The results showed that ITS, LSU, TUB2, ACT, and RPB2 shared 100.00%, 99.45%, 99.20%, 100.00%, and 100.00% sequence identity to the five published sequences (MW810272.1, MH869953.1, MW815129.1, JN251973.1, and MT018012.1, respectively) of the S. chrysanthemi isolate CBS 500.63. Phylogenetic analysis of the multilocus sequences of ITS, LSU, RPB2, ACT, and TUB2 belonging to different Stagonosporopsis species was performed in MEGA 7.0 (Chen et al. 2015). Isolate HGNU2021-18 was placed in a clade with S. chrysanthemi with 99% bootstrap support. Thus, the results of morphological and molecular analyses indicated that the disease symptoms on chrysanthemum plants were caused by S. chrysanthemi. Under conditions of 25°C and 85% relative humidity, pathogenicity test was performed on 2-month-old healthy plants using isolate HGNU2021-18. The leaves were inoculated with 5 mm diameter mycelial plugs or with sterile agar plugs (control). Six plants were used in each treatment. Disease symptoms were observed on treated plants at 2 weeks post inoculation which were those previously observed in the field, while the control plants remained symptomless. The pathogen was re-isolated from the diseased plants, and S. chrysanthemi was confirmed as the causal pathogen. This is the first report of S. chrysanthemi causing stem and foliage blight of chrysanthemum in China.

RESUMEN

Sphagneticola trilobata (L.) Pruski is a perennial creeping herb of the Asteraceae family, which is native to South America. It was introduced into Southern China as a groundcover in the 1970s (Zhang et al. 2023). Now it is mainly used for folk medicine to treat various kinds of inflammatory, incuding joint pain, rheumatic diseases, arthritis, in addition to treating persistent wounds, ulcers, and edemas (Gonçalves et al. 2022). In February and November 2023, powdery mildew symptoms were observed on 60% of S. trilobata plants on the Hainan Medical University campus (19° 58' 53″ N; 110° 19' 47″ E) in Haikou, Hainan Province, China. Powdery mildew colonies covered the leaf surfaces and stems of affected plants, causing discoloration and defoliation. Mycelia were superficial and hyphal appressoria were nipple-shaped. Conidiophores (n =30) were unbranched, cylindrical, 74 to 161 × 10 to 14 µm, and produced three to five immature conidia in chains with a crenate outline. Foot cells (n =30) were cylindrical, straight or sometimes curved at the base, and 27 to 56 µm long. Conidia (n =100) were ellipsoid-ovoid to doliiform, 17 to 30 ×14 to 28 µm (length/width ratio = 1.1 to 1.9), with well-developed fibrosin bodies, and produced germ tubes from the lateral position. Based on these morphological characteristics, the pathogen was provisionally identified as Podosphaera xanthii (Braun and Cook 2012). The teleomorph was not observed. A specimen was deposited in the Hainan Medical University Plant Pathology Herbarium as HMST-23. To confirm the genus identification and ascertain a putative species, genomic DNA was extracted from mycelium, conidiophores, and conidia using a fungal DNA kit (Omega Bio-Tek, USA). The rDNA internal transcribed spacer (ITS) region was amplified with primers ITS1/ITS4 (White et al. 1990) and sequenced directly. The resulting 577-bp sequence was deposited in GenBank (accession no. OR784549). A BLASTn search in GenBank of this sequence showed 100% similarity with the ITS sequences of P. xanthii isolates from China (MT260063, MN203658, OP765400, and MT739423), Thailand (LC270780), and Vietnam (KM260731, KM260730, and KR779870). Additionally, the 28S rDNA region was amplified using the primer pairs NL1 and NL4 (O´Donnell 1993; accession no. OR784550). This region shared 100% similarity with P. xanthii isolates (LC371334, LC270782, AB936277, and OP765401) as well. Powdery mildew from Hainan sample belonged to the P. xanthii group with strong bootstrap values support 99% in maximum likelihood phylogenetic tree based on ITS and 28S gene sequences. To confirm pathogenicity, five healthy potted plants of S. trilobata were inoculated by gently pressing a powdery mildew-infected leaf onto 15 young leaves. Five non-inoculated plants served as controls. All plants were maintained in a greenhouse at 24 to 30°C, 70% relative humidity, with a 16-h photoperiod. After 7 days, inoculated leaves showed powdery mildew symptoms whereas no symptoms were observed on control plants. The fungal colonies observed on inoculated plants were morphologically identical to those found on the originally infected leaves collected from Hainan Province. Based on the morphological characteristics and molecular identification, the fungus was identified as P. xanthii. In different countries and regions, P. xanthii has been previously reported on S. trilobata in Taiwan (Yeh et al. 2021). To our knowledge, this is the first record of P. xanthii infecting S. trilobata in Hainan Province, China. S. trilobata is often planted as an ornamental plant on both sides of the road, and we are concerned that it may serve as a new host, spreading this pathogen to other economic crops.

RESUMEN

Salvia splendens is a popular ornamental plant in China with extensive potentials, including value in traditional Chinese medicine and in environmental restoration function (Li et al. 2008). In September 2019, leaf blight disease was observed on road side plants of S. splendens in Bayi park, Nanchang city, Jiangxi province, China. The typical symptoms appeared as irregular necrotic spots or leaf blight, accompanied by extensive scorch necrosis or ultimately defoliation. Small segments cut from diseased leaves were surface sterilized in a 2% sodium hypochlorite solution for 2 min and rinsed three times with sterile distilled water. Then, the samples were placed on potato dextrose agar (PDA) plates incubated at 25°C in darkness. Pure cultures were obtained by the hyphal tip method. Morphologically, all 11 colonies were identical to each other on PDA. Two strains, YZU 191468 and YZU 191481, were selected for further study and deposited in the Fungal Herbarium of Yangtze University (YZU), Jingzhou, Hubei, China. The 7-day-old colonies were circular, 53 to 56 mm in diameter, and consisted of white mycelium with a buff margin, and were cinnamon colored in the center of the reverse side. To examine conidial morphology, the mycelium was transferred onto potato carrot agar (PCA) and incubated at 23°C with a period of 8 h light/16 h dark for 7 days. Conidia were normally solitary or two in a chain, ellipsoid or long ellipsoid, beakless, 10 to 23×30 to 60 µm in size (n=50). Based on morphology, the isolates were consistent with Stemphylium lycopersici (Yamamoto 1960). To confirm the identification, genomic DNA was extracted from both isolates and used to amplify the internal transcribed spacer rDNA region (ITS), glyceraldehydes-3-phosphate dehydrogenase (GAPDH) and calmodulin (CAL) genes with primer pairs ITS5/ITS4, gpd1/gpd2, and CALDF1/CALDR2, respectively (Woudenberg et al. 2017). Sequences were deposited in GenBank with accession numbers OP564983 and OP564984 (ITS), OP892529 and OP892530 (GAPDH), OP584970 and OP584971 (CAL). A neighbor-joining tree was constructed with Mega 7.0 based on the combined dataset with 1,000 bootstrap replicates. The resulting phylogenetic tree showed that the strains from S. splendens clustered with S. lycopersici (CBS 122639 and CBS 124980) supported with 100% bootstrap values. The molecular analyses confirmed that the species causing leaf blight symptoms was S. lycopersici. To test pathogenicity, healthy leaves of S. splendens were surface sterilized and inoculated by mycelium blocks (6 mm in diameter) and spore suspension (1×106 spore/mL) of representative strains YZU 191468 and YZU 191481, respectively. Controls were inoculated with blocks of PDA and sterile water. Each strain was inoculated on three leaves of a plant. One clean plant was used as control. The test was replicated three times. After inoculation, the plants were covered with plastic bags and incubated in a greenhouse (25℃, 80 % relative humidity, 8 h light/16 h dark). After 5 days, the inoculated leaves exhibited dark brown spots with white mycelium, followed by withering of necrotic tissues. There were no symptoms observed on the controls. The fungal isolates inoculated leaves had the same morphological characteristics as the strains used for inoculation. S. lycopersici has been found on eggplant and Zinnia elegans in China (He et al. 2019; Yang et al. 2017). To the best of our knowledge, this is the first report of S. lycopersici causing leaf blight on S. splendens in China. This finding offers a new reference for the management and control of S. splendens leaf diseases in China.