RESUMEN

Burdock (Arctium lappa L., belongs to the family Asteraceae), is an edible plant and an oriental medicinal herb in Korea (Han and Koo, 1993). In July 2023, burdocks showing chlorotic ringspots and yellowing on the leaves were observed in nine of approximately 4,000 plants in a greenhouse in Daegu, South Korea. To determine the causal virus species, nine symptomatic leaves from each individual plant were collected and tested using commercially available immunostrips (Agdia, Elkhart, USA) for cucumber mosaic virus (CMV) and tomato spotted wilt virus (TSWV). Seven out of nine samples tested positive for TSWV only. TSWV in South Korea was first reported on sweet pepper from Yesan in 2004 (Kim et al., 2004) and has since spread to various crops. The first report of TSWV infecting burdock plants in the world was from Hawaii in 1995 (Bautista et al., 1995), but TSWV-infected burdock has not been reported in Korea. To further confirm the presence of TSWV, total RNA was extracted from TSWV-positive burdock leaves using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and used in reverse transcription-polymerase chain reaction (RT-PCR) assays with a specific primer set that amplifies 777 bp of nucleocapsid gene (N gene) of TSWV (Yoon et al., 2014). To obtain the complete genome sequence of this TSWV in the burdock plant, named TSWV-DG, fragments of L, M, and S segments were amplified and sequenced. The complete genome sequences of the L (8914 nt), M (4773 nt), and S (2946 nt) segments were obtained by overlapping RT-PCR amplicons. RT-PCR products were cloned into the pGEM-T Easy vector, and selected DNA clones were sequenced using Sanger method (Bioneer, Korea). The complete genome sequences were deposited to GenBank (LC790665, LC790666, and LC790667, respectively). BLASTn analysis showed that sequences of each TSWV-DG segment had maximum nucleotide identities of 99.5%, 99.5%, and 99.5% with TSWV-L, TSWV-M, and TSWV-S (OM154971, OM154970, and OM154969, respectively), which were isolated from water dropwort (Oenanthe crocata) in China (Qiu et al., 2023). To assess the biological activity of TSWV-DG, A. lappa and Nicotiana benthamiana were inoculated mechanically with sap from infected burdock leaves and maintained for visual inspection of virus symptoms at 25 ℃ at 3 weeks. TSWV-DG produced symptoms on the systemic leaves of A. lappa, that included chlorotic spots and yellowing, and on the leaves of N. benthamiana, that included chlorotic spots and mosaic patterns from 14 days-post-inoculation. Meanwhile, mock-inoculated A.lappa and N.benthamiana remained symptomless. The presence of TSWV on the inoculated leaves was subsequently confirmed through Immunostrip and RT-PCR analyses. TSWV may pose a significant threat to the production of A. lappa, which is cultivated as both leafy greens and root vegetables in Korea. Furthermore, A. lappa may not only be at risk of damage from TSWV infection but also act as a potential source of TSWV infection, thereby posing a risk of transmission to other key crops in Korea, such as pepper or potato (Yoon et al., 2014). This is the first report TSWV infecting burdock in South Korea.

RESUMEN

As part of our ongoing investigation of natural bioactive substances from the genus Thermopsis of the tribe Fabaceae for agricultural protection, the chemical constituents of the herb Thermopsis lupinoides were systematically investigated, which led to the isolation of 39 quinolizidine alkaloids (QAs) (1-39), including 14 new QAs (1-14) and 14 isoflavones (40-53). Their structures were elucidated through comprehensive spectroscopic data analysis (IR, UV, NMR, HRESIMS), ECD calculations, and X-ray crystallography. The antitomato spotted wilt virus (TSWV) and antifungal (against Botrytis cinerea, Gibberella zeae, Phytophythora capsica, and Alternaria alternata) and insecticidal (against Aphis fabae and Tetranychus urticae) activities of the isolated compounds were screened using the lesion counting method, mycelial inhibition assay, and spray method, respectively. The bioassay results showed that 34 exhibited excellent protective activity against TSWV, with an EC50 value of 36.04 µg/mL, which was better than that of the positive control, ningnanmycin (86.03 µg/mL). The preliminary mechanistic exploration illustrated that 34 induced systemic acquired resistance in the host plant by acting on the salicylic acid signaling pathway. Moreover, 1 showed significant antifungal activity against B. cinerea (EC50 value of 20.83 µg/mL), while 2 exhibited good insecticidal activity against A. fabae (LC50 value of 24.97 µg/mL). This research is promising for the invention of novel pesticides from QAs with high efficiency and satisfactory ecological compatibility.

Asunto(s)

RESUMEN

Plant virus detection and identification in crops is a pillar for disease management, import of crop material, production of clean stock plants and basic plant virology studies. In this report, we present a platform for the enrichment and isolation of known or unknown viruses. This platform is based on carbon nanotube arrays inside a microfluidic device that can be a solution for the identification of low titer viruses from plants. Using our microfluidic devices, we achieved enrichment of two economically important viruses, the orthotospovirus, tomato spotted wilt orthotospovirus (TSWV) and the potyvirus, zucchini yellow mosaic virus (ZYMV). The carbon nanotube arrays integrated in these microfluidic devices are capable of trapping viruses discriminated by their size; the virus rich arrays can be then analyzed by common downstream techniques including immunoassays, PCR, HTS and electron microscopy. This procedure offers a simple to operate and portable sample preparation device capable of trapping viruses from raw plant extracts while reducing the host contamination.

Asunto(s)

RESUMEN

Tomato spotted wilt virus (TSWV) is ranked among the top 10 most destructive viruses globally. It results in abnormal leaf growth, stunting, and even death, significantly affecting crop yield and quality. Phytohormones play a crucial role in regulating plant-virus interactions. However, there is still limited research on the effect of TSWV on phytohormone levels, particularly growth hormones and genes involved in the phytohormone pathway. In our study, we combined phytohormone metabolomics and transcriptomics to examine the impact of TSWV infection on phytohormone content and gene expression profile. Metabolomic results showed that 41 metabolites, including major phytohormones and their precursors and derivatives were significantly altered after 14 days of TSWV inoculation tobacco plants cvK326, with 31 being significantly increased and 10 significantly reduced. Specifically, the levels of abscisic acid (ABA) and jasmonoyl-isoleucine (JA-Ile) were significantly reduced. The levels of indole-3-acetic acid (IAA) have remained unchanged. However, the levels of cytokinin isopentenyladenine (iP) and salicylic acid (SA) significantly increased. The transcriptome analysis revealed 2,746 genes with significant changes in expression. Out of these, 1,072 genes were significantly downregulated, while 1,674 genes were significantly upregulated. Among them, genes involved in ABA synthesis and signaling pathways, such as 9-cis-epoxycarotenoid dioxygenase (NCED), protein phosphatase 2C (PP2C), serine/threonine-protein kinase (SnRK2), and abscisic acid responsive element binding factor (ABF), exhibited significant downregulation. Additionally, expression of the lipoxygenase gene LOX, Jasmonate ZIM domain-containing protein gene JAZ, and transcription factor gene MYC were significantly down-regulated. In the cytokinin pathway, while there were no significant changes in the expression of the cytokinin synthesis genes, a significant downregulation of transcriptionally active factor type-B response regulators (type-B RRs) was observed. In terms of SA synthesis and signaling pathways, the isochorismate synthase gene ICS1 and the pathogenesis-related gene PR1 were significantly upregulated. These results can strengthen the theoretical foundation for understanding the interaction between TSWV and tobacco and provide new insights for the future prevention and control of TSWV.

Asunto(s)

RESUMEN

Plant intracellular nucleotide-binding domain leucine-rich repeat (NLR) receptors play crucial roles in immune responses against pathogens. How diverse NLRs recognize different pathogen effectors remains a significant question. A recent study published in Nature uncovered how pepper NLR Tsw detects phytohormone receptors' interference caused by tomato spotted wilt virus (TSWV) effector, triggering a robust immune response, showcasing a new manner of NLR guarding.

RESUMEN

The NLR (nucleotide-binding leucine-rich repeat) class immune receptor Sw-5b confers resistance to Tomato spotted wilt orthotospovirus (TSWV). Although Sw-5b is known to activate immunity upon recognition of the TSWV movement protein NSm, we know very little about the downstream events that lead to resistance. Here, we investigated the Sw-5b-mediated early transcriptomic changes that occur in response to mechanical and thrips-mediated inoculation of TSWV, using near-isogenic tomato lines CNPH-LAM 147 (Sw5b+/+) and Santa Clara (Sw-5b-/-). We observed earlier Sw-5b-mediated transcriptional changes in response to thrips-mediated inoculation compared with that in response to mechanical inoculation of TSWV. With thrips-mediated inoculation, differentially expressed genes (DEGs) were observed at 12, 24, and 72 h postinoculation (hpi). Whereas with mechanical inoculation, DEGs were observed only at 72 hpi. Although some DEGs were shared between the two methods of inoculation, many DEGs were specific to either thrips-mediated or mechanical inoculation of TSWV. In response to thrips-mediated inoculation, an NLR immune receptor, cysteine-rich receptor-like kinase, G-type lectin S-receptor-like kinases, the ethylene response factor 1, and the calmodulin-binding protein 60 were induced. Fatty acid desaturase 2-9, cell death genes, DCL2b, RIPK/PBL14-like, ERF017, and WRKY75 were differentially expressed in response to mechanical inoculation. Our findings reveal Sw-5b responses specific to the method of TSWV inoculation. Although TSWV is transmitted in nature primarily by the thrips, Sw-5b responses to thrips inoculation have not been previously studied. Therefore, the DEGs we have identified in response to thrips-mediated inoculation provide a new foundation for understanding the mechanistic roles of these genes in the Sw-5b-mediated resistance. [Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.

Asunto(s)

RESUMEN

Tomato spotted wilt virus (TSWV) infecting tomato has been identified as an emerging constraint for tomato cultivation in the southern Indian states of Karnataka and Tamil Nadu. Infection of TSWV produces circular necrotic ring spots on leaves, stem and floral necrosis and necrotic ringspots on fruits of tomato. In this study, we describe the characterization of TSWV isolate (Ka-To) infecting tomato from India based on biological, serological and molecular assay. Pathogenicity of TSWV (Ka-To) isolate was established by mechanical inoculation of sap from infected leaves on tomato, cowpea and datura which expressed necrotic or chlorotic local lesions. Samples were tested positive in the serological assay performed with TSWV-specific immunostrips. Further, reverse transcription polymerase chain reaction (RT-PCR) amplification of coat protein gene followed by sequencing, unequivocally confirmed the identity of TSWV. The obtained full-length nucleotide sequences of Ka-To isolate [L RNA-MK977648; M RNA-MK977649; and S RNA-MK977650] had greater similarity to the TSWV isolates of Spain and Hungary infecting tomato and pepper. The phylogenetic and recombination analysis showed the evidence for reassortment and recombination in the genome of Ka-To isolate. To the best of our knowledge, this is the first confirmed evidence for the occurrence of TSWV on tomato in India. Information obtained in this study issues a forewarning on the emergence of TSWV on vegetable ecosystem in the Indian subcontinent, requiring urgent management strategies to curtail its pestilence. Supplementary Information: The online version contains supplementary material available at 10.1007/s13205-023-03579-y.

RESUMEN

Tomato spotted wilt virus (TSWV) causes a serious plant disease and is transmitted by specific thrips including the western flower thrips, Frankliniella occidentalis. The persistent and circulative virus transmission suggests an induction of immune defenses in the thrips. We investigated the immune responses of F. occidentalis to TSWV infection. Immunofluorescence assay demonstrated viral infection in the larval midguts at early stage and subsequent propagation to the salivary gland in adults. In the larval midgut, TSWV infection led to the release of DSP1, a damage-associated molecular pattern, from the gut epithelium into the hemolymph. DSP1 up-regulated PLA2 activity, which would lead to biosynthesis of eicosanoids that activate cellular and humoral immune responses. Phenoloxidase (PO) activity was enhanced following induction of PO and its activating protease gene expressions. Antimicrobial peptide genes and dual oxidase, which produces reactive oxygen species, were induced by the viral infection. Expression of four caspase genes increased and TUNEL assay confirmed apoptosis in the larval midgut after the virus infection. These immune responses to viral infection were significantly suppressed by the inhibition of DSP1 release. We infer that TSWV infection induces F. occidentalis immune responses, which are activated by the release of DSP1 from the infection foci within midguts.

Asunto(s)

RESUMEN

Viruses deploy numerous strategies to infect plants, typically by forming complexes with another virus, leading to more efficient infection. However, the detailed plant responses to viral infection and the underlying mechanisms of co-infection remain unclear. Previously, we found that tomato spotted wilt orthotospovirus (TSWV) and Hippeastrum chlorotic ringspot orthotospovirus (HCRV) could infect plants in the field by forming a complex. In this study, we found that TSWV infected tobacco (Nicotiana benthamiana) plants in cooperation with HCRV, leading to a more efficient infection rate of both viruses. We then used the in-depth full-length transcriptome to analyze the responses of N. benthamiana to complex infection by TSWV-HCRV (TH). We found that infection with individual TSWV and HCRV triggered plant defense responses, including the jasmonic acid signaling pathway, autophagy, and secondary metabolism. However, TH co-infection could not trigger and even suppress some genes that are involved in these basal resistance responses, suggesting that co-infection is advantageous for the virus and not for the plants. Typically, the TH complex inhibits NbPR1 expression to suppress tobacco resistance. Moreover, the TH complex could alter the expression of microRNAs (miRNAs), especially novel-m0782-3p and miR1992-3p, which directly interact with NbSAM and NbWRKY6 and suppress their expression in tobacco, leading to downregulation of NbPR1 and loss of resistance in tobacco to TSWV and HCRV viruses. Overall, our results elucidated the co-infection mechanisms of TH in tobacco by deploying the miRNA of plants to suppress plant basal resistance and contributed to developing a novel strategy to control crop disease caused by this virus complex.

RESUMEN

Tomato spotted wilt orthotospovirus (TSWV) is one of the most devastating plant viruses causing crop disease epidemics of global economic significance. A single dominant resistant gene 'Sw-5' offering a broad-spectrum resistance to multiple orthotospoviruses was introduced in tomato cultivars. However, multiple resistance-breaking strains of TSWV were reported worldwide (Ciuffo 2005; Zaccardelli et al. 2008; Batuman et al. 2017; di Rienzo et al. 2018). Symptoms suggestive of orthotospoviral infection including stunting, bronzing, and inward rolling of leaves, and concentric necrotic spots on leaves, petioles, and fruits were observed in two TSWV-resistant tomato cultivars ('BL163' and 'HT 2') planted in a tomato variety trial in Bushland, TX in 2022. Leaf tissues from 45 resistant tomato plants (symptomatic or asymptomatic) from both resistant cultivars were tested using a TaqMan probe-based qPCR assay targeting a 200bp region in nucleoprotein (N) of the TSWV (Gautam et al. 2022). While 25 of those samples tested positive for TSWV, only ten expressed characteristic disease symptoms described above. The possibility of mixed infection in those samples with other endemic viruses in the region viz., alfalfa mosaic virus, groundnut ringspot orthotospovirus, tobacco mosaic virus, tomato chlorotic spot orthotospovirus, tomato mosaic virus, tomato necrotic streak virus, tomato ringspot virus, and tomato torrado virus was discounted through RT-PCR analysis (Kumar et al. 2011; Verbeek et al. 2012; Bratsch et al. 2018). To test the RB phenotype of the observed putative TSWV-RB strains, three-week-old tomato plants from eight commercially available TSWV resistant cultivars and one non-resistant cultivar (n=10 each) were mechanically inoculated with leaf tissues collected from a single symptomatic plant from one of the field-grown resistant cultivars. The experiment was replicated twice. Hypersensitive response was observed on all inoculated leaves of resistant plants one week post inoculation. Furthermore, all eight resistant cultivars started expressing local and systemic TSW symptoms 12 to 16 days post inoculation (dpi), while non-resistant cultivar started expressing symptoms at 9 dpi. TSW incidence across all resistant cultivars was 30-70%, while in susceptible cultivar it was 90%. Symptoms exhibited by all resistant cultivars resembled those of symptoms observed in field collected plants. The expression of Sw-5 gene in all eight resistant cultivars and the lack thereof in a susceptible cultivar was confirmed using Sw-5b specific primers and using Actin as a housekeeping gene in qRT-PCR (Islam et al. 2022). The RB strains in Sw-5 resistant tomato in California (Batuman et al. 2017) had the C118Y mutation in the TSWV NSm protein, consistent with the original reporting of C118Y or T120N RB mutations in 11 TSWV isolates from Spain (NCBI accession # HM015517 & HM015518) (Lopez et al. 2011). The nucleotide and amino acid sequence analysis of NSm gene from Bushland RB isolates from four resistant cultivars (NCBI accessions # OP810513-14 [field], OQ247901-05 [mechanically inoculated]) shared 98.9 and 99.4% homology with the Californian NSm sequences of TSWV RB tomato isolate (KX898453 and ASO67371), respectively. While the Nsm C118Y or T120N RB mutations were absent in all Bushland TSWV RB isolates, they had six additional unique point mutations across the NSm (I163V, P227Q, V290I, N293S, V294I, K296Q), which could potentially be responsible for resistance breaking. Despite the lack of C118Y or T120N RB mutations, Bushland isolates were capable of disrupting Sw-5-mediated TSWV resistance in all eight commercial resistant tomato cultivars. This study suggests a new or a different class of fundamental mechanisms are likely to be responsible for resistance breaking in Sw-5b resistant tomatoes. The new RB strain/s of TSWV therefore pose a substantial threat to tomato production in TX and other tomato-growing regions of the US.

RESUMEN

Introduction: Kac is a model for all acylation modification studies. Kac plays a critical role in eukaryotes and prokaryotes. It is mainly involved in six major biological functions: gene expression, signal transduction, cell development, protein conversion, metabolism, and metabolite transport. Method: We investigated and compared the acetylation modification of proteins in healthy and tomato spot wilt virus (TSWV)-infected Nicotiana benthamiana leaves. Result: We identified 3,418 acetylated lysine sites on 1962 proteins acetylation of proteins in the TSWV-infected and control groups were compared; it was observed that 408 sites on 294 proteins were upregulated and 284 sites on 219 proteins (involved in pentose phosphate, photosynthesis, and carbon fixation in photosynthesis) were downregulated after the infection. Overall, 35 conserved motifs were identified, of which xxxkxxxxx_K_ Rxxxxxxxxx represented 1,334 (31.63%) enrichment motifs and was the most common combination. Bioinformatic analysis revealed that most of the proteins with Kac sites were located in the chloroplast and cytoplasm. They were involved in biological processes, such as cellular and metabolic processes. Discussion: In conclusion, our results revealed that Kac may participate in the regulation of TSWV infection in N. benthamiana.

RESUMEN

Tomato spotted wilt virus (TSWV) is a plant virus that causes massive economic damage to high-valued crops. This virus is transmitted by specific thrips, including the western flower thrips, Frankliniella occidentalis. TSWV is acquired by the young larvae during feeding on infected host plants. TSWV infects the gut epithelium through hypothetical receptor(s) and multiplies within the cells for subsequent horizontal transmission to other plant hosts via the salivary glands during feeding. Two alimentary canal proteins, glycoprotein (Fo-GN) and cyclophilin (Fo-Cyp1), are thought to be associated with the TSWV entry into the gut epithelium of F. occidentalis. Fo-GN possesses a chitin-binding domain, and its transcript was localized on the larval gut epithelium by fluorescence in situ hybridization (FISH) analysis. Phylogenetic analysis indicated that F. occidentalis encodes six cyclophilins, in which Fo-Cyp1 is closely related to a human cyclophilin A, an immune modulator. The Fo-Cyp1 transcript was also detected in the larval gut epithelium. Expression of these two genes was suppressed by feeding their cognate RNA interference (RNAi) to young larvae. The RNAi efficiencies were confirmed by the disappearance of the target gene transcripts from the gut epithelium by FISH analyses. The RNAi treatments directed to Fo-GN or Fo-Cyp1 prevented the typical TSWV titer increase after the virus feeding, compared to control RNAi treatment. Our immunofluorescence assay using a specific antibody to TSWV documented the reduction of TSWV in the larval gut and adult salivary gland after the RNAi treatments. These results support our hypothesis that the candidate proteins Fo-GN and Fo-Cyp1 act in TSWV entry and multiplication in F. occidentalis.

RESUMEN

As a continuation of our research on the development of pesticide active quinolizidine alkaloids (QAs) from the family Fabaceae, the chemical constituents of the root of Sophora tonkinensis Gagnep. were systematically investigated. Seventeen new matrine-type alkaloids (1-17), including one new naturally occurring compound (17), along with 20 known ones were isolated from the EtOH extract of S. tonkinensis. Notably, compound 5 possessed an unprecedented 6/6/5/4/6/6 hexacyclic system. Their structures were confirmed via comprehensive spectroscopic data analysis (IR, UV, NMR, HRESIMS), ECD calculation, and X-ray crystallography. Biological tests indicated that compounds 1, 4, 10, 12, 13, and 30 displayed significant anti-tomato spotted wilt virus (TSWV) activities compared with the positive control ningnanmycin. Moreover, compound 12 strongly inhibited the expression of the TSWV N, NSs, and NSm genes and TSWV NSs protein in plant host. Furthermore, compounds 4, 10, 12, 20, and 22 exhibited moderate insecticidal activities against TSWV thrip vector (Frankliniella occidentalis).

Asunto(s)

RESUMEN

Agapanthus praecox Willd. is an ornamental flowering plant that is indigenous to southern Africa and was reported to be a host of tomato spotted wilt orthotospovirus (TSWV) in Australia in 2000 (Wilson et al. 2000). Tomato spotted wilt orthotospovirus (TSWV) belonging to the genus Orthotospovirus of the family Tospoviridae is a single-stranded negative sense RNA virus known to cause disease symptoms in many crops and ornamental plant species. This virus is in the top 10 of most economically important plant viruses worldwide (Rybicki 2015; Scholthof et al. 2011). In May 2021, leaf material from three agapanthus (Agapanthus praecox) plants displaying chlorotic mottling, and yellow lesions (Supplementary material 1A) was collected in Mbombela, South Africa. One gram of symptomatic leaf material was used for total RNA extraction from each of the three samples using a CTAB extraction protocol (Ruiz-García et al. 2019). The three RNA extracts were pooled, and a sequencing library was constructed using the Ion Total RNA-Seq Kit v2.0 and RiboMinus™ Plant Kit for RNA-Seq (ThermoFisher Scientific) (Central Analytical Facility (CAF), Stellenbosch University). The RNA library was sequenced on an Ion Torrent Proton Instrument (CAF). A total of 34,392,939 single-end reads were obtained. Data was trimmed for quality with Trimmomatic (CROP:250, MINLEN:50). De novo assembly was performed on the remaining 32,281,645 trimmed reads (average readlength: 100 nt, range: 50-250 nt) using SPAdes 3.13.0 and resulted in 4,788 contigs. BLASTn analysis identified viral contigs longer than 1,000 nucleotides (nts) with high nucleotide (nt) identity to TSWV (6 contigs), as well as to the newly discovered viruses, agapanthus tungro virus (AgTV) (1 contig), and agapanthus velarivirus (AgVV) (4 contigs) (Read et al 2021). Read mapping was performed against the relevant reference sequence with the highest nt identity to the contigs. For TSWV, 4995, 21221 and 14574 reads mapped to segment L (KY250488), M (KY250489) and S (KY250490) of isolate LK-1, respectively resulting in 99.97%, 100.00% and 99.97% genome coverage of the reference accessions. The nt identity between the reference accessions and the consensus sequences generated (OP921761-OP921763) were 97.26%, 97.64% and 97.82% for segment L, M and S. The presence of TSWV was confirmed in the HTS sample using an RT-PCR assay (primers L1 and L2) targeting the L segment of TSWV (Mumford et al. 1994). In July 2022, additional leaf samples displaying symptoms of chlorotic mottling, streaking, and ringspots were collected from 31 symptomatic and 3 asymptomatic agapanthus plants in public gardens in Stellenbosch, South Africa. Using the above-mentioned RT-PCR assay, 13 of the symptomatic samples tested positive for TSWV. All six plants displaying ring spot symptoms (Supplementary material 1B) were infected with TSWV. However, plants that displayed yellow streaking (five samples) and chlorotic mottling (two samples) (Supplementary material 1C-D) were also positive for TSWV which could be due to the presence of other viruses, plant growth stage, infection time or just variable symptom expression in a single host species as reported previously (Sherwood et al. 2003). The 275 bp RT-PCR amplicons of the HTS sample and three additional positive samples were validated with bidirectional Sanger sequencing (CAF) and had 96% identity to accession KY250488. The pairwise nt identity between amplicons was 98.55-100%. This is the first report of TSWV infecting agapanthus in South Africa. This study contributes information towards the distribution and incidence of TSWV and highlights the need for nurseries to screen plant material before propagation.

RESUMEN

Tomato spotted wilt virus is a single-stranded RNA virus and causes a serious plant disease. Its horizontal transmission depends on some thrips species including Frankliniella occidentalis. Its genome encodes a nonstructural protein, nonstructural (NSs), which acts as a silencing suppressor and plays a crucial role in the pathogenicity by defending antiviral immunity using RNA interference (RNAi) in plant hosts. However, its physiological function as a silencing suppressor was not well clarified in insect vectors. This study assessed any change of RNAi efficiencies in two other insect systems by NSs expression. To this end, the gene was cloned into a eukaryotic expression vector and transiently expressed in two different insect species via in vivo transient expression (IVTE). After feeding the recombinant construct to non-viruliferous F. occidentalis, NSs expression was observed for over 2 days in the thrips. Under this expression of NSs, thrips were rescued from a treatment of a toxic double stranded RNA specific to v-ATPase. Interestingly, the thrips treated with IVTE significantly suppressed the expression of RNAi machinery genes such as SID and Dicer-2. The recombinant vector expressing NSs was injected to a non-vector insect, Spodoptera exigua, larvae. The larvae expressing NSs by the IVTE were highly susceptible to an infection of a RNA virus called iflavirus. These suggest that NSs acts as a silencing suppressor in insects and would be used for a synergist for RNA pathogens to control insect pests.

Asunto(s)

RESUMEN

Plant immunity relies on nucleotide-binding oligomerization domain (NOD)-like receptors (NLRs) that detect microbial patterns released by pathogens, and activate localized cell death to prevent the spread of pathogens. Tsw is the only identified resistance (R) gene encoding an NLR, conferring resistance to tomato spotted wilt orthotospovirus (TSWV) in pepper species (Capsicum, Solanaceae). However, molecular and cellular mechanisms of Tsw-mediated resistance are still elusive. Here, we analysed the structural and cellular functional features of Tsw protein, and defined a hydrophobic module to improve NLR-mediated virus resistance. The plasma membrane associated N-terminal 137 amino acid in the coiled-coil (CC) domain of Tsw is the minimum fragment sufficient to trigger cell death in Nicotiana benthamiana plants. Transient and transgenic expression assays in plants indicated that the amino acids of the hydrophobic groove (134th-137th amino acid) in the CC domain is critical for its full function and can be modified for enhanced disease resistance. Based on the structural features of Tsw, a super-hydrophobic funnel-like mutant, TswY137W, was identified to confer higher resistance to TSWV in a SGT1 (Suppressor of G-two allele of Skp1)-dependent manner. The same point mutation in a tomato Tsw-like NLR protein also improved resistance to pathogens, suggesting a feasible way of structure-assisted improvement of NLRs.

Asunto(s)

RESUMEN

Tomato spotted wilt virus (TSWV) causes severe viral diseases on many economically important plants of Solanaceae. During the infection process of TSWV, a series of 3'-truncated subgenomic RNAs (sgRNAs) relative to corresponding genomic RNAs were synthesized, which were responsible for the expression of some viral proteins. However, corresponding genomic RNAs (gRNAs) seem to possess the basic elements for expression of these viral proteins. In this study, molecular characteristics of sgRNAs superior to genomic RNAs in viral protein expression were identified. The 3' ends of sgRNAs do not cover the entire intergenic region (IGR) of TSWV genomic RNAs and contain the remarkable A-rich characteristics. In addition, the 3' terminal nucleotides of sgRNAs are conserved among different TSWV isolates. Based on the eIF4E recruitment assay and subsequent northern blot, it is suggested that the TSWV sgRNA, but not gRNA, is capped in vivo; this is why sgRNA is competent for protein expression relative to gRNA. In addition, the 5' and 3' untranslated region (UTR) of sgRNA-Ns can synergistically enhance cap-dependent translation. This study further enriched the understanding of sgRNAs of ambisense RNA viruses.

Asunto(s)

RESUMEN

Since the first report of the 'spotted wilt' disease of tomato published in 1915 in Australia, tomato spotted wilt orthotospovirus (TSWV) has become a pandemic virus with an estimated economic impact of over $1 billion annually (Brittlebank 1919; German et al. 1992). TSWV strains capable of disrupting Tsw-mediated single gene resistance in pepper (i.e., resistance-breaking or RB strains) have been previously reported in multiple countries (Crescenzi et al., 2013; Deligoz et al. 2014; Margaria et al. 2004; Sharman and Persley 2006; Yoon et al. 2021), but only in California (Macedo et al. 2019) and Louisiana (Black et al. 1996) in the US. In August 2021, severe tospovirus-like disease symptoms (stunting; leaf, stem, and petiole necrosis; and concentric rings on leaves and fruits) were documented in TSWV-resistant cultivars of sweet pepper (Capsicum annuum L.) containing the Tsw gene in Bushland, TX. In the next season in August 2022, leaf samples from 214 TSWV-resistant pepper plants (with or without disease symptoms) from seven cultivars were tested with a TaqMan probe-based qPCR assay targeting coat protein (CP) of the TSWV (TSWV-F: AGAGCATAATGAAGGTTATTAAGCAAAGTGA and TSWV-R: GCCTGACCCTGATCAAGCTATC; TaqMan probe: CAGTGGCTCCAATCCT). Across all cultivars, 85 samples tested positive for TSWV. Of these, 39 showed characteristic TSW symptoms with disease incidence ranging from 10-30% depending on the cultivar. The remaining 46 samples were asymptomatic with no apparent hypersensitive response in leaves. To further confirm the RB status of TSWV strain/s in the field samples, leaves from six TSWV resistant plants from three different pepper cultivars were pooled together and used to mechanically inoculate five non-infected three-week-old pepper plants from nine cultivars: seven TSWV resistant (Tsw), one moderately resistant, and one susceptible, with three replications. Tsw expression in two representative plants from each resistant cultivar was confirmed using SYBR Green based one-step qRT-PCR with primers specified in the South Korea Patent # KR102000469B1 were used with two plants from susceptible cultivar as a negative control. Field plants that tested negative for TSWV in PCR analysis were used as a mock inoculation control and tissues from tomato plants infected with wild-type TSWV strain/s (previously isolated from non-resistant tomato plants) were used as a wild-type control. Three weeks post-inoculation, characteristic orthotospovirus symptoms were observed in plants inoculated with the putative RB isolate, in that TSW incidence ranged between 10-50% in seven resistant cultivars, 70% in a moderately resistant cultivar, and 90% in a susceptible cultivar. On the contrary, no disease incidence was observed in resistant and moderately resistant plants, whereas 50% incidence was observed in susceptible plants in the wild-type control. Hypersensitive response was observed in the local leaves of mechanically inoculated resistant plants that tested negative in PCR approximately 5-7 days post inoculation. All symptomatic and 30-100% asymptomatic TSWV-inoculated plants with RB or wild-type strain/s tested positive for TSWV in probe-based qPCR analysis confirming that none of the tested cultivars was immune to TSWV infection. All mock-inoculated plants tested negative in the qPCR analysis. Both nucleotide and amino acid sequences of complete TSWV silencing suppressor protein (NSs) recovered from six plants originally used in the mechanical inoculation (NCBI accession OP548104) and inoculated resistant plants (NCBI accession OP548113) showed 99% homology with the NSs sequences of New Mexico pepper isolates KU179589 and APG79491, respectively. The NSs point mutation T to A at 104 amino acid position responsible for resistance breaking in pepper in Hungarian TSWV isolates (NCBI accessions KJ649609 & KJ649608 (Almasi et al., 2017) was absent in the NSs sequences from all samples. Besides novel point mutations, genetic reassortment as previously reported in S. Korean TSWV RB pepper isolates (Kwon et al., 2021) and in other orthotospoviruses such as tomato chlorotic spot virus and groundnut ringspot virus (Webster et al., 2011) could be a potential RB mechanism in the Bushland TSWV RB isolates. A comprehensive genomic analysis of these isolates is required to determine the fundamental evolutionary mechanisms that enable the disruption of Tsw-mediated gene resistance. Taken together, these results indicate that at least one, but potentially multiple new strains of TSWV capable of disrupting Tsw-mediated resistance and producing moderate to severe symptoms in an array of commercial resistant pepper cultivars have emerged and pose a significant threat to pepper production in Texas.

RESUMEN

BACKGROUND: Plant viruses can facilitate their transmission by modulating the sex ratios of their insect vectors. Previously, we found that exposure to tomato spotted wilt orthotospovirus (TSWV) in the western flower thrips, Frankliniella occidentalis, led to a male-biased sex ratio in the offspring. TSWV, a generalist pathogen with a broad host range, is transmitted primarily by F. occidentalis in a circulative-propagative manner. Here, we integrated proteomic tools with RNAi to comprehensively investigate the genetic basis underlying the shift in vector sex ratio induced by the virus. RESULTS: Proteomic analysis exhibited 104 differentially expressed proteins between F. occidentalis adult males with and without TSWV. The expression of the fiber sheath CABYR-binding-like (FSCB) protein, namely FoFSCB-like, a sperm-specific protein associated with sperm capacitation and motility, was decreased by 46%. The predicted FoFSCB-like protein includes 10 classic Pro-X-X-Pro motifs and 42 phosphorylation sites, which are key features for sperm capacitation. FoFSCB-like expression was gradually increased during the development and peaked at the pupal stage. After exposure to TSWV, FoFSCB-like expression was substantially down-regulated. Nanoparticle-mediated RNAi substantially suppressed FoFSCB-like expression and led to a significant male bias in the offspring. CONCLUSION: These combined results suggest that down-regulation of FoFSCB-like in virus-exposed thrips leads to a male-biased sex ratio in the offspring. This study not only advances our understanding of virus-vector interactions, but also identifies a potential target for the genetic management of F. occidentalis, the primary vector of TSWV, by manipulating male fertility. © 2022 Society of Chemical Industry.

Asunto(s)

RESUMEN

As part of our ongoing investigation of pesticide active quinolizidine alkaloids (QAs) from the family Fabaceae, the chemical constituents of the seeds of Thermopsis lanceolata R. Br. were systematically investigated. Bioassay-guided fractionation and purification of the crude extract led to the isolation of seventeen new QAs (1-17), including three new naturally occurring compounds (15-17), along with 15 known compounds (18-32). Their structures were elucidated by comprehensive spectroscopic data analysis (IR, UV, NMR, and HRESIMS) and quantum chemistry calculations (13C NMR and ECD). The antitomato spotted wilt virus activities and insecticidal activities against Aphis fabae, Nilaparvata lugens (Stal), and Tetranychus urticae of compounds 1-32 were screened using the lesion counting method, spray method, and rice-stem dipping method, respectively. Biological tests indicated that compounds 6, 9, 10, and 18 displayed significant anti-TSWV activities compared with the positive control ningnanmycin. Compounds 3, 4, and 5 showed better insecticidal activities against A. fabae with LC50 values of 10.07, 12.07, and 6.56 mg/L, respectively. Moreover, compounds 5, 18, and 24 exhibited moderate insecticidal activities against N. lugens (Stal) with LC50 values of 37.91, 53.44, and 31.21 mg/L, respectively. Furthermore, compounds 9 and 10 exhibited moderate insecticidal activities against T. urticae.

Asunto(s)