RESUMEN
Dyspnea is a common symptom in neuromuscular disorders and, although multifactorial, it is usually due to respiratory muscle involvement, associated musculoskeletal changes such as scoliosis or, in certain neuromuscular conditions, cardiomyopathy. Clinical history can elicit symptoms such as orthopnea, trepopnea, sleep disruption, dysphagia, weak cough, and difficulty with secretion clearance. The examination is essential to assist with the diagnosis of an underlying neurologic disorder and determine whether dyspnea is from a cardiac or pulmonary origin. Specific attention should be given to possible muscle loss, use of accessory muscles of breathing, difficulty with neck flexion/extension, presence of thoraco-abdominal paradox, conversational dyspnea, cardiac examination, and should include a detailed neurological examination directed at the suspected differential diagnosis. Pulmonary function testing including sitting and supine spirometry, measures of inspiratory and expiratory muscle strength, cough peak flow, sniff nasal inspiratory pressure, pulse oximetry, transcutaneous CO2, and arterial blood gases will help determine the extent of the respiratory muscle involvement, assess for hypercapnic or hypoxemic respiratory failure, and qualify the patient for noninvasive ventilation when appropriate. Additional testing includes dynamic imaging with sniff fluoroscopy or diaphragm ultrasound, and diaphragm electromyography. Polysomnography is indicated for sleep related symptoms that are not otherwise explained. Noninvasive ventilation alleviates dyspnea and nocturnal symptoms, improves quality of life, and prolongs survival. Therapy targeted at neuromuscular disorders may help control the disease or favorably modify its course. For patients who have difficulty with secretion clearance, support of expiratory function with mechanical insufflation-exsufflation, oscillatory devices can reduce the aspiration risk.
RESUMEN
Objective: Many artificial intelligence approaches to muscle ultrasound image analysis have not been implemented on usable devices in clinical neuromuscular medicine practice, owing to high computational demands and lack of standardised testing protocols. This study evaluated the feasibility of using real-time texture analysis to differentiate between various pathological conditions. Methods: We analysed 17,021 cross-sectional ultrasound images of the biceps brachii of 75 participants, including 25 each with neurogenic disorders, myogenic disorders, and healthy controls. The size and location of the regions of interest were randomly selected to minimise bias. A random forest classifier utilising texture features such as Dissimilarity and Homogeneity was developed and deployed on a mobile PC, enabling real-time analysis. Results: The classifier distinguished patients with an accuracy of 81â¯%. Echogenicity and Contrast from the Co-Occurrence Matrix were significant predictive features. Validation on 15 patients achieved accuracies of 78â¯%/93â¯% per image/patient over 15-second videos, respectively. The use of a mobile PC facilitated real-time estimation of the underlying pathology during ultrasound examination, without influencing procedures. Conclusions: Real-time automatic texture analysis is feasible as an adjunct for the diagnosis of neuromuscular disorders. Significance: Artificial intelligence using texture analysis with a light computational load supports the semi-quantitative evaluation of neuromuscular ultrasound.
RESUMEN
The Revised upper limb module (RULM) has been increasingly used in clinical trials and in clinical settings. The aim of this study was to use the 'shift analysis' to assess the patterns of lost or gained abilities for each item on the RULM in an untreated cohort, stratified by SMA type, age, SMN2 copy number, and motor functional status. The analysis was performed on 222 12-month paired assessments from 129 individuals (115 assessment from type II and 107 from type III) who had at least two assessments at yearly intervals. There was a loss of one or more activities in 54% in type II and in 29% type III. A gain of one or more activities was found in 42% type II and in 22% type III. There were concomitant gains and losses in 27% in SMA II and in 9% in SMA III. Our results, measuring the number of abilities that are lost or gained, provide an additional method of detecting changes that can be used for the interpretation of the longitudinal data collected in treated SMA individuals.
RESUMEN
Neuromuscular diseases impact on children's health related quality of life but there is a lack of studies in Latin America that measured this construct. To respond to this need, this study aimed to explore quality of life and its relationship with age, functional dependence and specific diagnosis in children and adolescents in Latin America. A cross-sectional correlation study was carried out with 133 caregivers on children (2-18 years old) with various neuromuscular disorders. Parents reported on their children's health related quality of life through the PedsQL GCS and the PedsQL NMM. Differences in quality of life were found when comparing children with high functional dependence with those with mild dependence (p = 0.05). No significant differences were found regarding the child diagnosis. Finally, quality of life was highly correlated with the child's age, even when controlling for functional dependence differences between ages. Children and adolescents with neuromuscular show a diminished health related quality of life, not only in physical functioning but in their psychosocial functioning. Health related quality of life may vary according to the child's age and functional dependence.
Asunto(s)
Enfermedades Neuromusculares , Calidad de Vida , Humanos , Calidad de Vida/psicología , Niño , Enfermedades Neuromusculares/psicología , Enfermedades Neuromusculares/diagnóstico , Masculino , Adolescente , Preescolar , Femenino , Estudios Transversales , América Latina/epidemiología , Factores de EdadRESUMEN
Background: Progressive respiratory muscle weakness and ineffective cough contribute to morbidity and mortality in children with neuromuscular disorders (NMD). Inspiratory muscle training (IMT) aims to preserve or improve respiratory muscle strength and reduce respiratory morbidity. This study aimed to determine the safety and efficacy of IMT in children with NMD. Methods/design: A randomised cross-over study compared a 3-month intervention (IMT) with control periods (no IMT). Children diagnosed with NMD (5 years - 18 years) performed 30 breaths (at 30% of maximum inspiratory mouth pressure [Pimax]) with an electronic threshold device, twice daily. During the control period, participants did not perform any IMT. Discussion: Twenty three children (median [interquartile range {IQR}] age of 12.33 [10.03-14.17] years), mostly male (n = 20) and non-ambulant (n = 14) participated. No adverse events related to IMT were reported. No difference in median patient hospitalisation and respiratory tract infection (RTI) rates between non-training and intervention periods (p = 0.60; p = 0.21) was found. During IMT, Pimax and peak cough flow improved with a mean ± standard deviation (s.d.) of 14.57 ± 15.67 cmH2O and 32.27 ± 36.60 L/min, compared to 3.04 ± 11.93 cmH2O (p = 0.01) and -16.59 ± 48.29 L/min (p = 0.0005) during the non-training period. Similar to other studies, spirometry did not show a significant change. Conclusion: A 3-month IMT programme in children with NMD appears safe and well-tolerated, with significant improvement in respiratory muscle strength and cough efficacy. Clinical implications: Inspiratory muscle training could be considered a cost-effective adjunct to respiratory management in children with NMD. Trial Registration: Pan African Clinical Trial Registry, PACTR201506001171421, https://pactr.samrc.ac.za.
RESUMEN
Magnetic Resonance (MR) parameters mapping in muscle Magnetic Resonance Imaging (mMRI) is predominantly performed using pattern recognition-based algorithms, which are characterised by high computational costs and scalability issues in the context of multi-parametric mapping. Deep Learning (DL) has been demonstrated to be a robust and efficient method for rapid MR parameters mapping. However, its application in mMRI domain to investigate Neuromuscular Disorders (NMDs) has not yet been explored. In addition, data-driven DL models suffered in interpretation and explainability of the learning process. We developed a Physics Informed Neural Network called Myo-Regressor Deep Informed Neural NetwOrk (Myo-DINO) for efficient and explainable Fat Fraction (FF), water-T2 (wT2) and B1 mapping from a cohort of NMDs.A total of 2165 slices (232 subjects) from Multi-Echo Spin Echo (MESE) images were selected as the input dataset for which FF, wT2,B1 ground truth maps were computed using the MyoQMRI toolbox. This toolbox exploits the Extended Phase Graph (EPG) theory with a two-component model (water and fat signal) and slice profile to simulate the signal evolution in the MESE framework. A customized U-Net architecture was implemented as the Myo-DINO architecture. The squared L2 norm loss was complemented by two distinct physics models to define two 'Physics-Informed' loss functions: Cycling Loss 1 embedded a mono-exponential model to describe the relaxation of water protons, while Cycling Loss 2 incorporated the EPG theory with slice profile to model the magnetization dephasing under the effect of gradients and RF pulses. The Myo-DINO was trained with the hyperparameter value of the 'Physics-Informed' component held constant, i.e. λmodel = 1, while different hyperparameter values (λcnn) were applied to the squared L2 norm component in both the cycling loss. In particular, hard (λcnn=10), normal (λcnn=1) and self-supervised (λcnn=0) constraints were applied to gradually decrease the impact of the squared L2 norm component on the 'Physics Informed' term during the Myo-DINO training process. Myo-DINO achieved higher performance with Cycling Loss 2 for FF, wT2 and B1 prediction. In particular, high reconstruction similarity and quality (Structural Similarity Index > 0.92, Peak Signal to Noise ratio > 30.0 db) and small reconstruction error (Normalized Root Mean Squared Error < 0.038) to the reference maps were shown with self-supervised weighting of the Cycling Loss 2. In addition muscle-wise FF, wT2 and B1 predicted values showed good agreement with the reference values. The Myo-DINO has been demonstrated to be a robust and efficient workflow for MR parameters mapping in the context of mMRI. This provides preliminary evidence that it can be an effective alternative to the reference post-processing algorithm. In addition, our results demonstrate that Cycling Loss 2, which incorporates the Extended Phase Graph (EPG) model, provides the most robust and relevant physical constraints for Myo-DINO in this multi-parameter regression task. The use of Cycling Loss 2 with self-supervised constraint improved the explainability of the learning process because the network acquired domain knowledge solely in accordance with the assumptions of the EPG model.
Asunto(s)
Algoritmos , Aprendizaje Profundo , Imagen por Resonancia Magnética , Redes Neurales de la Computación , Enfermedades Neuromusculares , Humanos , Imagen por Resonancia Magnética/métodos , Enfermedades Neuromusculares/diagnóstico por imagen , Adulto , Masculino , Femenino , Procesamiento de Imagen Asistido por Computador/métodos , Persona de Mediana EdadRESUMEN
Neuromuscular disorders are a group of rare heterogenous diseases with profound impact on quality of life, for which overall pediatric prevalence has rarely been reported. The purpose of this study was to determine the point prevalence of pediatric neuromuscular disorders and its subcategories in the central region of Portugal. Retrospective case identification was carried out in children with neuromuscular disorders seen between 1998 and 2020 from multiple data sources. Demographics, clinical and molecular diagnoses were registered. On January 1, 2020, the point overall prevalence in the population <18 years of age was 41.20/100 000 (95% confidence interval 34.51-49.19) for all neuromuscular disorders. The main case proportion were genetic disorders (95.7%). We found a relatively higher occurrence of limb-girdle muscular dystrophies, congenital myopathies, and spinal muscular atrophy and a slightly lower occurrence of Duchenne muscular dystrophy, hereditary spastic paraparesis, and acquired neuropathies compared to previous studies in other countries. Molecular confirmation was available in 69.5% of pediatric neuromuscular patients in our cohort.Total prevalence is high in comparison with the data reported in the only previous study on the prevalence of pediatric neuromuscular disorders in our country. Our high definitive diagnostic rate underscores the importance of advances in investigative genetic techniques, particularly new sequencing technologies, in the diagnostic workup of neuromuscular patients.
Asunto(s)
Enfermedades Neuromusculares , Humanos , Portugal/epidemiología , Enfermedades Neuromusculares/epidemiología , Enfermedades Neuromusculares/genética , Enfermedades Neuromusculares/clasificación , Niño , Masculino , Femenino , Prevalencia , Adolescente , Preescolar , Estudios Retrospectivos , Lactante , Recién NacidoRESUMEN
Homozygous variants of Calcium Voltage-Gated Channel Subunit Alpha1 S (CACNA1S) gene mutation were previously identified as causes of periodic paralysis and congenital early-onset myopathy, while it could be manifested as a late-onset congenital core myopathy. Abstract: Calcium Voltage-Gated Channel Subunit Alpha1 S (CACNA1S) gene mutation has been linked to various neuromuscular conditions in recent years. Congenital myopathy with core-like features is one of the cardinal associations reported previously, causing severe respiratory insufficiency and death in neonates. Informed consent was received from the patients. Subsequently, peripheral blood leukocytes were utilized to extract genomic DNA. Moreover, exome enrichment was implemented through the Twist Human Core Exome Kit (Twist Bioscience) and exome sequenced using Illumina NovaSeq 6000 platform (Illumina, San Diego, CA, USA). Sanger sequencing using BIG Dye Terminators confirmed the presence of the final variant. Finally, the candidate variants were classified based on the American College of Medical Genetics and Genomics (ACMG) guidelines. In this report, we describe two siblings, who presented with childhood and late-onset progressive muscle weakness, and had a homozygous variant in exon 2 of the CACNA1S gene defined as c.188C > A (p.Ala63Asp) (NM_000069.3). The SIFT, Polyphen2, CADD PHRED, and Mutation Taster analysis tools classified the variant as pathogenic/damaging. The muscle biopsy of the younger brother revealed intermyofibrillar network pattern disruption as cytoplasmic core-like lesions. The muscle magnetic resonance imaging (MRI) reported grade IIa and IIb fatty changes. Finally, the electromyography (EMG) findings suggested a myopathic change pattern. This report illustrates the clinical variability in CACNA1S-related myopathy by reviewing prior reports and adding newly found aspects, additionally expanding the gene defects associated with core myopathy.
RESUMEN
OBJECTIVES: To determine the content validity of cardiopulmonary exercise testing (CPET) for assessing peak oxygen uptake (VO2peak) in neuromuscular diseases (NMD). DESIGN: Baseline assessment of a randomized controlled trial. SETTING: Academic hospital. PARTICIPANTS: Eighty-six adults (age: 58.0±13.9 y) with Charcot-Marie-Tooth disease (n=35), postpolio syndrome (n=26), or other NMD (n=25). INTERVENTION: Not applicable. MAIN OUTCOME MEASURES: Workload, gas exchange variables, heart rate, and ratings of perceived exertion were measured during CPET on a cycle ergometer, supervised by an experienced trained assessor. Muscle strength of the knee extensors was assessed isometrically with a fixed dynamometer. Criteria for confirming maximal cardiorespiratory effort during CPET were established during 3 consensus meetings of an expert group. The percentage of participants meeting these criteria was assessed to quantify content validity. RESULTS: The following criteria were established for maximal cardiorespiratory effort: a plateau in oxygen uptake (VO2plateau) as the primary criterion, or 2 of 3 secondary criteria: (1) peak respiratory exchange ratio (RERpeak) ≥1.10 (2), peak heart rate ≥85% of predicted maximal heart rate; and (3) peak rating of perceived exertion (RPEpeak) ≥17 on the 6-20 Borg scale. These criteria were attained by 71 participants (83%). VO2plateau, RERpeak ≥1.10, peak heart rate ≥85%, and RPEpeak ≥17 were attained by 31%, 73%, 69%, and 72% of the participants, respectively. Peak workload, VO2peak, and knee extension muscle strength were significantly higher, and body mass index was lower (all P<.05), in participants with maximal cardiorespiratory effort than other participants. CONCLUSIONS: Most people with NMD achieved maximal cardiorespiratory effort during CPET. This study provides high quality evidence of sufficient content validity of VO2peak as a maximal aerobic capacity measure. Content validity may be lower in more severely affected people with lower physical fitness.
RESUMEN
Objectives: The functions of eating, drinking, speaking, and breathing demand close coordination of the upper airway musculature which may be challenged by the long-term use of daytime non-invasive ventilation (NIV). This rapid review explores the challenges and practicalities of these interactions in people with neuromuscular disorders. Methods: A search was performed on PubMed (period 2000-2023) using generic terms to refer to eating, drinking, and speaking related to people with neuromuscular disorders on NIV. A narrative approach was used to summarize the available literature. Results: Our review shows only a small number of studies exist exploring the use of NIV on swallowing and speaking in people with neuromuscular disorders. We summarize study findings and provide practical advice on eating, drinking and speaking with NIV. Conclusions: By understanding breathing, NIV mechanics and upper airway interactions, it is possible to optimize swallowing and speaking whilst using NIV. There is a lack of specific guidelines, and concerns regarding aspiration warrant further research and guideline development.
Asunto(s)
Deglución , Enfermedades Neuromusculares , Ventilación no Invasiva , Humanos , Enfermedades Neuromusculares/complicaciones , Enfermedades Neuromusculares/fisiopatología , Ventilación no Invasiva/métodos , Deglución/fisiología , Habla/fisiología , Trastornos de Deglución/etiología , Trastornos de Deglución/terapia , Trastornos de Deglución/fisiopatologíaRESUMEN
Autoimmune neuromuscular disorders in patients with eosinophilic granulomatosis with polyangiitis (EGPA) are relatively uncommon. Although two cases of myasthenia gravis (MG) comorbid with EGPA have been reported, both patients developed EGPA several years after starting immunosuppressive treatment for MG. We herein report a 75-year-old man with a rare co-occurrence of EGPA and MG that developed simultaneously and was successfully treated with immunosuppressive therapy. Distinguishing the neurological symptoms of EGPA from complications of other neurological autoimmune diseases, such as MG, is crucial, especially in patients with eosinophilia.
RESUMEN
The role of long-term parenteral support in patients with underlying benign conditions who do not have intestinal failure (IF) is contentious, not least since there are clear benefits in utilising the oral or enteral route for nutritional support. Furthermore, the risks of long-term home parenteral nutrition (HPN) are significant, with significant impacts on morbidity and mortality. There has, however, been a recent upsurge of the use of HPN in patients with conditions such as gastro-intestinal neuromuscular disorders, opioid bowel dysfunction, disorders of gut-brain interaction and possibly eating disorders, who do not have IF. As a result, the European Society of Clinical Nutrition and Metabolism (ESPEN), the European Society of Neuro-gastroenterology and Motility (ESNM) and the Rome Foundation for Disorders of Gut Brain Interaction felt that a position statement is required to clarify - and hopefully reduce the potential for harm associated with - the use of long-term parenteral support in patients without IF. Consensus opinion is that HPN should not be prescribed for patients without IF, where the oral and/or enteral route can be utilised. On the rare occasions that PN commencement is required to treat life-threatening malnutrition in conditions such as those listed above, it should only be prescribed for a time-limited period to achieve nutritional safety, while the wider multi-disciplinary team focus on more appropriate biopsychosocial holistic and rehabilitative approaches to manage the patient's primary underlying condition.
Asunto(s)
Nutrición Parenteral , Humanos , Nutrición Parenteral/métodos , Eje Cerebro-Intestino/fisiología , Insuficiencia Intestinal/terapia , Nutrición Parenteral en el DomicilioRESUMEN
The role of long-term parenteral support in patients with underlying benign conditions who do not have intestinal failure (IF) is contentious, not least since there are clear benefits in utilising the oral or enteral route for nutritional support. Furthermore, the risks of long-term home parenteral nutrition (HPN) are significant, with significant impacts on morbidity and mortality. There has, however, been a recent upsurge of the use of HPN in patients with conditions such as gastro-intestinal neuromuscular disorders, opioid bowel dysfunction, disorders of gut-brain interaction and possibly eating disorders, who do not have IF. As a result, the European Society of Clinical Nutrition and Metabolism (ESPEN), the European Society of Neuro-gastroenterology and Motility (ESNM) and the Rome Foundation for Disorders of Gut Brain Interaction felt that a position statement is required to clarify - and hopefully reduce the potential for harm associated with - the use of long-term parenteral support in patients without IF. Consensus opinion is that HPN should not be prescribed for patients without IF, where the oral and/or enteral route can be utilised. On the rare occasions that PN commencement is required to treat life-threatening malnutrition in conditions such as those listed above, it should only be prescribed for a time-limited period to achieve nutritional safety, while the wider multi-disciplinary team focus on more appropriate biopsychosocial holistic and rehabilitative approaches to manage the patient's primary underlying condition.
Asunto(s)
Nutrición Parenteral en el Domicilio , Humanos , Nutrición Parenteral en el Domicilio/métodos , Eje Cerebro-Intestino/fisiología , Nutrición Parenteral/métodos , Insuficiencia Intestinal/terapia , Consenso , Europa (Continente) , Sociedades MédicasRESUMEN
BACKGROUND: Respiratory muscle training (RMT) aims to improve inspiratory and/or expiratory muscle function in neuromuscular disorders (NMDs). A comprehensive overview of the available literature is lacking. This scoping review explores methodological characteristics, (adverse) effects, and adherence of RMT studies in NMDs. Moreover, it identifies limitations and research gaps in the literature and provides future research directions. SUMMARY: Eligible studies were identified using MEDLINE, Embase, Cochrane Database of Systematic Reviews, and Cochrane Central Register of Controlled Trials databases. Three reviewers independently selected articles. Inclusion criteria were English language, original research articles on RMT using a device, patients with an NMD, and pulmonary function tests or respiratory muscle strength as outcome measures. We included NMDs with slow, intermediate and fast progression. Exclusion criteria were critically ill patients, weaning from mechanical ventilation, other neurological disorders, and RMT combined with non-respiratory interventions. One reviewer extracted the data on patients' characteristics, methodological characteristics, results of outcome measures, adverse events, and patient adherence. Forty-five studies were identified. We found a large diversity in study designs and training protocols. The effects of RMT on respiratory muscle strength and/or endurance are variable. Patient adherence was high and no serious adverse events were reported. KEY MESSAGES: The diversity in studies across the available literature precludes definitive conclusions regarding the effects of RMT on respiratory muscle function and clinically relevant outcomes in NMDs. Therefore, well-powered and -designed studies that focus on clinically relevant outcomes and assess whether RMT can improve or offset deterioration of respiratory muscle weakness in NMDs are needed.
RESUMEN
In vivo, muscle and neuronal cells are post-mitotic, and their function is predominantly regulated by proteostasis, a multilayer molecular process that maintains a delicate balance of protein homeostasis. The ubiquitin-proteasome system (UPS) is a key regulator of proteostasis. A dysfunctional UPS is a hallmark of muscle ageing and is often impacted in neuromuscular disorders (NMDs). Malfunction of the UPS often results in aberrant protein accumulation which can lead to protein aggregation and/or mis-localization affecting its function. Deubiquitinating enzymes (DUBs) are key players in the UPS, controlling protein turnover and maintaining the free ubiquitin pool. Several mutations in DUB encoding genes are linked to human NMDs, such as ATXN3, OTUD7A, UCHL1 and USP14, whilst other NMDs are associated with dysregulation of DUB expression. USP5, USP9X and USP14 are implicated in synaptic transmission and remodeling at the neuromuscular junction. Mice lacking USP19 show increased maintenance of lean muscle mass. In this review, we highlight the involvement of DUBs in muscle physiology and NMDs, particularly in processes affecting muscle regeneration, degeneration and inflammation following muscle injury. DUBs have recently garnered much respect as promising drug targets, and their roles in muscle maturation, regeneration and degeneration may provide the framework for novel therapeutics to treat muscular disorders including NMDs, sarcopenia and cachexia.
Asunto(s)
Enzimas Desubicuitinizantes , Humanos , Animales , Enzimas Desubicuitinizantes/metabolismo , Músculo Esquelético/metabolismo , Complejo de la Endopetidasa Proteasomal/metabolismo , Ubiquitina/metabolismo , Enfermedades Neuromusculares/metabolismo , Enfermedades Neuromusculares/genética , Enfermedades Neuromusculares/fisiopatología , Enfermedades Neuromusculares/enzimología , Enfermedades Musculares/metabolismo , Enfermedades Musculares/genética , Ratones , ProteostasisRESUMEN
Objective: Exoband (by Moveo, Padova, Italy) functions as a walking brace, comprising a belt and two leg loops connected by a mechanism that stores energy during the initial phase of the gait cycle and releases it in the subsequent phase. This enhances hip flexor thrust, leading to functional improvement in walking for individuals with conditions characterized by proximal weakness. It has been approved as a passive wearable device for individuals with impaired walking abilities. Objective of this study was to establish a protocol to assess the use of Exoband in patients with various neuromuscular disorders. Methods: This exploratory retrospective study includes consecutive patients diagnosed with neuromuscular disorders (CIDP, motor polyneuropathy, MND), exhibiting a proximal involvement and gait abnormalities. The evaluation protocol incorporated specific walking-related outcome measures, the 10-meter walk test (10mWT), Time-up-and-go test (TUG), and 2-minute walking test (2MWT). The assessments were conducted both with and without the Exoband under standard conditions. Results: Eight patients (6 males, aged 60-78 years) were tested. An increase in velocity was observed in the 10mWT (median 13.4âsec, IQR 12.0-15.7 vs. 12.2âsec, IQR 11.3-14.2 seconds, pâ<â0.05) and the TUG (14.0âsec, IQR 13-16.2 vs 13.35âsec, IQR 11-13.8; pâ<â0.05, by non-parametric Wilcoxon test), and a trend of increase in 2MWT (median 88.2 vs 92.6âm, n.s.). Six out of 8 patients reported subjective benefits from the very first use, including improved walking stability, speed, confidence, and reduced fatigue. Conclusions: Our protocol provides a quantitative assessment of Exoband usefulness for patients affected by neuropathies with gait abnormalities. Further investigations are warranted to assess the long-term effects of its regular Exoband use, its efficacy in specific neuromuscular diseases, and its potential role as a rehabilitation device.
Asunto(s)
Enfermedades Neuromusculares , Caminata , Dispositivos Electrónicos Vestibles , Humanos , Masculino , Persona de Mediana Edad , Femenino , Anciano , Estudios Retrospectivos , Enfermedades Neuromusculares/rehabilitación , Enfermedades Neuromusculares/fisiopatología , Caminata/fisiología , Prueba de Paso , Trastornos Neurológicos de la Marcha/rehabilitación , Trastornos Neurológicos de la Marcha/fisiopatología , Trastornos Neurológicos de la Marcha/etiologíaRESUMEN
In recent years, clustered regularly interspaced short palindromic repeats (CRISPRs) and CRISPR-associated (Cas) protein have emerged as a revolutionary gene editing tool to treat inherited disorders affecting different organ systems, such as blood and muscles. Both hematological and neuromuscular genetic disorders benefit from genome editing approaches but face different challenges in their clinical translation. The ability of CRISPR/Cas9 technologies to modify hematopoietic stem cells ex vivo has greatly accelerated the development of genetic therapies for blood disorders. In the last decade, many clinical trials were initiated and are now delivering encouraging results. The recent FDA approval of Casgevy, the first CRISPR/Cas9-based drug for severe sickle cell disease and transfusion-dependent ß-thalassemia, represents a significant milestone in the field and highlights the great potential of this technology. Similar preclinical efforts are currently expanding CRISPR therapies to other hematologic disorders such as primary immunodeficiencies. In the neuromuscular field, the versatility of CRISPR/Cas9 has been instrumental for the generation of new cellular and animal models of Duchenne muscular dystrophy (DMD), offering innovative platforms to speed up preclinical development of therapeutic solutions. Several corrective interventions have been proposed to genetically restore dystrophin production using the CRISPR toolbox and have demonstrated promising results in different DMD animal models. Although these advances represent a significant step forward to the clinical translation of CRISPR/Cas9 therapies to DMD, there are still many hurdles to overcome, such as in vivo delivery methods associated with high viral vector doses, together with safety and immunological concerns. Collectively, the results obtained in the hematological and neuromuscular fields emphasize the transformative impact of CRISPR/Cas9 for patients affected by these debilitating conditions. As each field suffers from different and specific challenges, the clinical translation of CRISPR therapies may progress differentially depending on the genetic disorder. Ongoing investigations and clinical trials will address risks and limitations of these therapies, including long-term efficacy, potential genotoxicity, and adverse immune reactions. This review provides insights into the diverse applications of CRISPR-based technologies in both preclinical and clinical settings for monogenic blood disorders and muscular dystrophy and compare advances in both fields while highlighting current trends, difficulties, and challenges to overcome.
Asunto(s)
Sistemas CRISPR-Cas , Edición Génica , Terapia Genética , Humanos , Terapia Genética/métodos , Sistemas CRISPR-Cas/genética , Animales , Edición Génica/métodos , Distrofia Muscular de Duchenne/terapia , Distrofia Muscular de Duchenne/genética , Ensayos Clínicos como Asunto , Repeticiones Palindrómicas Cortas Agrupadas y Regularmente Espaciadas/genéticaRESUMEN
Mechanical insufflation-exsufflation (MI-E) is essential for secretion clearance, especially in neuromuscular disorders. For the best outcomes, initiation of MI-E should be started at the correct time with regular evaluation to the response to treatment. Typically, cough peak flow has been used to evaluate cough effectiveness with and without MI-E. This review highlights the limitations of this and discussed other tools to evaluate MI-E efficacy in this rapidly developing field. Such tools include the interpretation of parameters (like pressure, flow and volumes) that derive from the MI-E device and external methods to evaluate upper airway closure. In this review we pinpoint the differences between different devices in the market and discuss new tools to better titrate MI-E and detect pathological responses of the upper airway. We discuss the importance of point of care ultrasound (POCUS), transnasal fiberoptic laryngoscopy and wave form analysis in this setting. To improve clinical practice newer generation MI-E devices should allow real-time evaluation of waveforms and standardize some of the derived parameters.
RESUMEN
Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.
RESUMEN
Neuromuscular disorders (NMDs) include a wide range of diseases affecting the peripheral nervous system. The genetic diagnoses are increasingly obtained with using the next generation sequencing (NGS). We applied the custom-design targeted NGS panel including 89 genes, together with genotyping and multiplex ligation-dependent probe amplification (MLPA) to identify a genetic spectrum of NMDs in 52 Polish patients. As a result, the genetic diagnosis was determined by NGS panel in 29 patients so its diagnostic utility is estimated at 55.8%. The most pathogenic variants were found in CLCN1, followed by CAPN3, SCN4A, and SGCA genes. Genotyping of myotonic dystrophy type 1 and 2 (DM1 and DM2) as a secondary approach has been performed. The co-occurrence of CAPN3 and CNBP mutations in one patient as well as DYSF and CNBP mutations in another suggests possibly more complex inheritance as well as expression of a phenotype. In 7 individuals with single nucleotide variant found in NGS testing, the MLPA of the CAPN3 gene was performed detecting the deletion encompassing exons 2-8 in the CAPN3 gene in one patient, confirming recessive limb-girdle muscular dystrophy type 1 (LGMDR1). Thirty patients obtained a genetic diagnosis (57.7%) after using NGS testing, genotyping and MLPA analysis. The study allowed for the identification of 27 known and 4 novel pathogenic/likely pathogenic variants and variants of uncertain significance (VUS) associated with NMDs.In conclusion, the diagnostic approach with diverse molecular techniques enables to broaden the mutational spectrum and maximizes the diagnostic yield. Furthermore, the co-occurrence of DM2 and LGMD has been detected in 2 individuals.