RESUMEN

Metaplexis japonica (Thunb.) Makino, commonly known as rough potato, has a wide distribution in China, Japan, Korea, and adjacent Russia. In China, M. japonica is a traditional herbal medicinal plant, which is also cultivated as a vegetable (Shi et al. 2020; Wei et al. 2019). In July 2023, leaves of M. japonica plants growing near a soybean field in Qingdao, Shandong province, exhibited leaf crinkling, mosaic and distorting symptoms of probable virus infection (Supplementary Figure 1). The disease incidence in a 50 m2 area was approximately 40%. To identify the suspected viral etiological agents, symptomatic leaves from 10 M. japonica plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq). TransZol Up Total RNA Extraction Kit (TransGen Biotech, Beijing, China) was used to extract total RNA. Small RNA library construction and high-throughput sequencing (HTS) were performed on Illumina NovaSeq platform by Genepioneer (Nanjing, China) (Li et al. 2024). A total of 17,384,311 raw reads were obtained. Redundant reads were removed by cutadapt software (version 1.18) to obtain 11,580,876 clean reads with 18 to 26 nucleotide (nt) sizes. The clean reads were assembled using velvet software (version 1.1.07). A total of forty-six small contigs from 42 to 283 nt were identified, with 85 to 100% nucleotide sequence identities, respectively, to metaplexis yellow mottle-associated virus (MeYMaV, genus Caulimovirus, family Caulimoviridae, accession numbers: NC_077108.1). Finally, 1,355,955 reads (11.71% mapped ratio of total reads, cover 56.7% over the MeYMaV genome) were mapped to the genome of MeYMaV by bwa software (version 0.7.17-r1188). To confirm the sRNA-Seq results, PCR was performed with specific primers MeYMaV-N-F/MeYMaV-N-R (5'-TGGTATCAGAGCCTAGTTAA-3'/5'-GGAGTTGGTAATGTATTACC-3') and MeYMaV-C-F/MeYMaV-C-R (5'-AATGGAACGGCTGTTAGTAT3'/TTAATTTCTAGCCCTTGGCTACTTAC). Both the primer pairs were designed using GenBank accession numbers: NC_077108.1 (Yang et al. 2021) to obtain the N and C terminals genome fragments of 10 MeYMaV plants. Two amplicons approximately in 4000-, and 3900-bp sizes were amplified (Supplementary Figure 2), sequenced (tsingke, Beijing, China) and aligned to obtain 7,742-nt complete MeYMaV genome sequence (Accession no. PP892524). BLASTn analysis revealed 90.16% and 92.18% sequence identity, respectively, with the MeYMaV isolate LM-Cau-A (NC_077108.1) based on complete genome and coat protein sequences, respectively. Previously, cucumber mosaic virus and MeYMaV were reported in M. japonica from Jiangsu and Liaoning provinces in China, respectively (Yang et al. 2018; 2021). To our knowledge, this is the first natural infection report of MeYMaV in M. japonica in Shandong, China. The natural occurrence of MeYMaV is not only affects the quality of M. japonica, but also poses a potential threat to surrounding crops. This study enriches information on the disease distribution of MeYMaV and will be helpful for disease management.

RESUMEN

BACKGROUND: Fewer than 20% of adults with chronic gastrointestinal (GI) symptoms have accessed care to evaluate or manage their symptoms. We sought to characterize whether adults with chronic GI symptoms would use an app for symptom monitoring and the effects of participation in a digitally delivered GI chronic care program. METHODS: We provided a digital digestive care management app to adults via their employer-sponsored benefits. We evaluated participants' self-reported GI symptoms at baseline and between 30 and 90 days post-registration. GI symptoms (e.g., abdominal pain and constipation) were rated on a scale of 0 (no symptoms) to 4 (very severe symptoms). RESULTS: A total of 1936 participants were enrolled (75% female; 67% White, 11% Asian/Pacific Islander, 6% Hispanic, 7% Black; mean age: 43 years). Their most common GI conditions were irritable bowel syndrome (IBS), gastroesophageal reflux disease (GERD), and acid reflux. Participants of all genders and races reported statistically significant improvements in all symptoms between baseline and the end of the intervention (P < 0.05). At baseline, 79.5% of participants reported at least moderate GI symptom severity for at least one symptom. In contrast, at the end of the intervention, only 47.8% of participants reported moderate or severe symptoms, and 310 (16.0%) participants reported no symptoms. Participants who were scheduled with their care team reported greater symptom improvement than those who were not scheduled (P = 0.004). Participants reported feeling greater control of their health (83%), better management of their digestive symptoms (83%), increased happiness (76%), and greater productivity at work (54%). CONCLUSION: Demographically diverse participants engaged with a digital digestive chronic care program and reported significant improvements in digestive symptom severity.

RESUMEN

BACKGROUND: People experiencing homelessness have increased prevalence, morbidity, and mortality of cardiovascular disease (CVD), attributable to several traditional and non-traditional risk factors. While this burden is well-known, mainstream CVD management plans and healthcare delivery have not been developed with people experiencing homelessness in mind nor tailored to their unique context. The overall objective of this work was to explore and synthesize what is known about CVD management experiences, programs, interventions, and/or recommendations specifically for people experiencing homelessness. METHODS: We conducted a scoping review to combine qualitative and quantitative studies in a single review using the Arksey and O'Malley framework and lived experience participation. We performed a comprehensive search of OVID Medline, Embase, PsychINFO, CINAHL, Web of Science, Social Sciences Index, Cochrane, and the grey literature with key search terms for homelessness, cardiovascular disease, and programs. All dates, geographic locations, and study designs were included. Articles were analyzed using conventional content analysis. RESULTS: We included 37 articles in this review. Most of the work was done in the USA. We synthesized articles' findings into 1) barriers/challenges faced by people experiencing homelessness and their providers with CVD management and care delivery (competing priorities, lifestyle challenges, medication adherence, access to care, and discrimination), 2) seven international programs/interventions that have been developed for people experiencing homelessness and CVD management with learnings, and 3) practical recommendations and possible solutions at the patient encounter level (relationships, appointment priorities, lifestyle, medication), clinic organization level (scheduling, location, equipment, and multi-disciplinary partnership), and systems level (root cause of homelessness, and cultural safety). CONCLUSIONS: There is no 'one-size-fits all' approach to CVD management for people experiencing homelessness, and it is met with complexity, diversity, and intersectionality based on various contexts. It is clear, however, we need to move to more practically-implemented, community-driven solutions with lived experience and community partnership at the core. Future work includes tackling the root cause of homelessness with affordable housing, exploring ways to bring cardiac specialist care to the community, and investigating the role of digital technology as an avenue for CVD management in the homeless community. We hope this review is valuable in providing knowledge gaps and future direction for health care providers, health services research teams, and community organizations.

Asunto(s)

RESUMEN

Wheat rusts, including leaf, stripe, and stem rust, have been a threat to global food security due to their devastating impact on wheat yields. In recent years, significant strides have been made in understanding wheat rusts, focusing on disease spread mechanisms, the discovery of new host resistance genes, and the molecular basis of rust pathogenesis. This review summarizes the latest approaches and studies in wheat rust research that provide a comprehensive understanding of disease mechanisms and new insights into control strategies. Recent advances in genetic resistance using modern genomics techniques, as well as molecular mechanisms of rust pathogenesis and host resistance, are discussed. In addition, innovative management strategies, including the use of fungicides and biological control agents, are reviewed, highlighting their role in combating wheat rust. This review also emphasizes the impact of climate change on rust epidemiology and underscores the importance of developing resistant wheat varieties along with adaptive management practices. Finally, gaps in knowledge are identified and suggestions for future research are made. This review aims to inform researchers, agronomists, and policy makers, and to contribute to the development of more effective and sustainable wheat rust control strategies.

RESUMEN

Background/Objectives: The literature reports that emotional disorders in asthmatic children and their parents may affect asthma control. This research explores the baseline psychological well-being of asthmatic children and their mothers' and fathers' psychological functioning, focusing on the influence of the parents' anxiety and separation anxiety on children's asthma. Methods: In this cross-sectional study, we enrolled children with non-severe asthma and their parents, and a group of healthy children and their parents. The asthmatic children underwent anamnestic investigation, including asthma control and spirometry. Then, both the asthmatic and control triads filled a survey assessing their psychological functioning. Results: Among the 40 asthmatic children enrolled (8-18 years old), most had good clinical control maintained with GINA (Global Initiative for Asthma) therapy step 1-2 (14 patients, 35%) or step 3-4 (26 patients, 65%); 12 patients (30%) had at least one steroid course in the year before enrollment. They exhibited normal psychological adjustment but elevated levels of general (U = 179,500; p < 0.001) and state anxiety (U = 170,000; p < 0.001) compared to healthy peers. Additionally, the asthmatic children's mothers displayed higher levels of separation anxiety compared to the fathers (t = -2.865, p = 0.006). Increased separation anxiety in the mothers corresponded to a history of at least one exacerbation in the previous year. Conclusions: The asthmatic children exhibited normal psychological adjustment with higher general and state anxiety. Also, their mothers showed greater levels of separation anxiety compared to their fathers. Lastly, higher mothers' separation anxiety corresponded to a history of at least one exacerbation in the previous year. The influence of the parents' psychological well-being on the children's asthma control was previously unexplored.

RESUMEN

INTRODUCTION: Idiopathic granulomatous mastitis (IGM) is an inflammatory breast disorder of unknown etiology. This benign condition can mimic the clinical presentation of breast cancer and is characterized by symptoms such as breast pain, erythema, and swelling. Over the past few years, Disease-Modifying Antirheumatic Drugs (DMARDs) have been increasingly used to manage this condition. However, strong evidence to support their use is lacking. OBJECTIVES: This systematic review aimed to summarize the evidence and evaluate the efficacy of DMARDs in the management of IGM. METHODS: A systematic literature review, adhering to PRISMA guidelines, was conducted across electronic databases, including PubMed, EMBASE, SCOPUS, directory of open access journals (DOAJ) and Cochrane Library from their inception until May 2024. We included retrospective and prospective studies while excluding case reports and case series of less than 10 patients. RESULTS: Eighteen studies met our eligibility criteria. Fifteen studies were retrospective, while 2 were prospective. No randomized controlled trials were identified. Of these, 16 papers examined the effect of methotrexate on IGM, revealing significant disease improvement in most cases. Several of the studies indicated that patients treated with azathioprine and mycophenolate mofetil also achieved favorable responses. CONCLUSION: Given the rarity of IGM, only a limited number of studies have explored the use of DMARDs as a pharmacological treatment option. A significant barrier to advancing our understanding is the substantial heterogeneity in the quality and volume of data provided by these studies. Therefore, there is a need for well-designed, randomized, placebo-controlled trials to rigorously assess the efficacy of DMARDs in the treatment of IGM.

RESUMEN

BACKGROUND: The coexistence of diabetes and hypertension is prevalent due to shared risk factors. Pharmacological treatment has been reported to be effective in managing both conditions. However, treatment effectiveness depends on the extent to which a patient adheres to their treatment. Poor adherence to long-term treatment for chronic diseases is a growing global problem of significant magnitude. Several interventions have been developed to help improve medication adherence in patients with coexisting diabetes and hypertension. This review aimed to determine the characteristics of these interventions and their impact on medication adherence. METHODS: A systematic review of the literature was conducted using the PRISMA guidelines and registered in the PROSPERO International Registry of Systematic Reviews. Studies were searched in the databases CINAHL, Embase and Medline to identify relevant articles published during 2012-2023. The search concepts included 'medication adherence', 'hypertension', 'diabetes' and 'intervention'. Studies were included if they were in English and evaluated the impact of an intervention aimed at promoting adherence to medications for both diabetes and hypertension. RESULTS: Seven studies met the inclusion criteria, with five demonstrating a statistically significant improvement in medication adherence. Of the five studies that improved medication adherence, four were multifaceted and one was a single-component intervention. All successful interventions addressed at least two factors influencing non-adherence. Patient education was the foundation of most of the successful interventions, supported by other strategies, such as follow-ups and reminders. CONCLUSION: Multifaceted interventions that also included patient education had a positive impact on medication adherence in patients with coexisting diabetes and hypertension. Improving adherence in patients with coexisting diabetes and hypertension requires a multipronged approach that considers the range of factors impacting medication-taking. PATIENT OR PUBLIC CONTRIBUTION: This systematic review provides comprehensive insights into the benefits of patient-centred approaches in intervention development and strengthening. Such patient involvement ensures that medication adherence interventions are more relevant, acceptable and effective, ultimately leading to better health outcomes and more meaningful patient engagement in healthcare research.

Asunto(s)

RESUMEN

Fusarium wilt, caused by Fusarium oxysporum f. sp. spinaciae, causes a significant challenge on vegetative spinach and seed production. Addressing this issue necessitates continuous research focused on innovative treatments and protocols through comprehensive bioassays. Recent studies have highlighted the potential of plant-based compounds in controlling fungal diseases. The present work aims to conduct a series of experiments, encompassing both in vitro and in planta assessments, to investigate the biocontrol capabilities of different essential oils (EOs) at various application rates, with the ultimate goal of reducing the incidence of Fusarium wilt in spinach. The inhibitory effect of four plant EOs (marjoram, thyme, oregano, and tea tree) was initially assessed on the spore germination of five unknown Fusarium strains. The outcomes revealed diverse sensitivities of Fusarium strains to EOs, with thyme exhibiting the broadest inhibition, followed by oregano at the highest concentration (6.66 µL/mL) in most strains. The tested compounds displayed a diverse range of median effective dose (ED50) values (0.69 to 7.53 µL/mL), with thyme and oregano consistently showing lower ED50 values. The direct and indirect inhibitory impact of these compounds on Fusarium mycelial growth ranged from ~14% to ~100%, wherein thyme and oregano consistently exhibiting the highest effectiveness. Following the results of five distinct inoculation approaches and molecular identification, the highly pathogenic strain F-17536 (F. oxysporum f.sp. spinaciae) was chosen for Fusarium wilt assessment in spinach seedlings, employing two promising EO candidates through seed and soil treatments. Our findings indicate that colonized grain (CG) proved to be a convenient and optimal inoculation method for consistent Fusarium wilt assessment under greenhouse conditions. Seed treatments with thyme and oregano EOs consistently resulted in significantly better disease reduction rates, approximately 54% and 36% respectively, compared to soil treatments (P > 0.05). Notably, thyme, applied at 6.66 µL/mL, exhibited a favorable emergence rate (ERI), exceeding seven, in both treatments, emphasizing its potential for effective disease control in spinach seedlings without inducing phytotoxic effects. This study successfully transitions from in vitro to in planta experiments, highlighting the potential incorporation of EOs into integrated disease management for Fusarium wilt in spinach production.

RESUMEN

BACKGROUND: The direct and indirect costs of chronic kidney disease (CKD) are substantial and increase over time. Concerns regarding our capacity to manage the financial burden that CKD) places on patients, caregivers, and society are raised by its increasing prevalence and progression. Lack of awareness of CKD's economic effects is a major reason that lawmakers and administrators pay little attention to this chronic illness. OBJECTIVE: We aimed to analyze the direct burden of CKD across Asian countries and evaluate the main cost drivers among all mentioned cost centers in previous studies. METHODOLOGY: Related works evaluating the expenditures of CKD from the perspective of the patient were interpreted by a thorough search of PUBMED and GOOGLE SCHOLAR. RESULTS: Country-wise, in Asia, the direct mean average medical costs in RRT patients were reported in 8 studies as $4574, $18668, $2901, $6848, $16669, $3489, $5945, and $6344 in Singapore, Korea, Taiwan, China, Jordan, Vietnam, Lebanon, and India respectively and the direct mean average medical costs in non-RRT patients were reported in six studies as $3412, $2241, $4534, $290 and $1500 in Singapore, Japan, China, Vietnam, and India respectively. CONCLUSION: Hemodialysis is the main cost driver having an average mean cost of $23,358 per patient per year while the average mean cost of disease management is $4977 per patient per year. More research is needed to understand the specific economic challenges disadvantaged populations face, including the impact of income, education, and access to healthcare resources on the financial burden of CKD.

RESUMEN

Acne vulgaris, a prevalent inflammatory skin condition, significantly impacts individuals worldwide, particularly adolescents and adults. Its chronic nature, associated sequelae, and psychosocial impact underscore the substantial burden it poses. Current treatment guidelines primarily address facial acne, with limited guidance on managing truncal acne. Personalized approaches are increasingly recognized as essential for tailoring treatments to individual patient needs. This review integrates insights from an Indian Dermatology Experts' Meeting, featuring perspectives from nine leading dermatologists. Discussions centered on analyzing acne's burden, its effects on quality of life (QoL), unmet needs in management, trifarotene's role in Indian therapy, anticipated challenges, and the importance of ancillary care. The experts highlighted acne's profound impact on patients' QoL and identified gaps in current management guidelines, especially concerning truncal acne. Trifarotene, a fourth-generation topical retinoid approved by the FDA and Drug Controller General of India (DCGI) for facial and truncal acne, demonstrated safety and efficacy across age groups. This synthesis of expert perspectives underscores the need for personalized acne management. Trifarotene emerges as a promising therapeutic option but challenges remain, particularly in optimizing ancillary care to minimize treatment-related adverse effects. Addressing these issues will enhance treatment outcomes and patient satisfaction in acne management, emphasizing the importance of tailored approaches in clinical practice.

RESUMEN

Background: Professional opinion polling has become a popular means of seeking advice for complex nephrology questions in the #AskRenal community on X. ChatGPT is a large language model with remarkable problem-solving capabilities, but its ability to provide solutions for real-world clinical scenarios remains unproven. This study seeks to evaluate how closely ChatGPT's responses align with current prevailing medical opinions in nephrology. Methods: Nephrology polls from X were submitted to ChatGPT-4, which generated answers without prior knowledge of the poll outcomes. Its responses were compared to the poll results (inter-rater) and a second set of responses given after a one-week interval (intra-rater) using Cohen's kappa statistic (κ). Subgroup analysis was performed based on question subject matter. Results: Our analysis comprised two rounds of testing ChatGPT on 271 nephrology-related questions. In the first round, ChatGPT's responses agreed with poll results for 163 of the 271 questions (60.2%; κ = 0.42, 95% CI: 0.38-0.46). In the second round, conducted to assess reproducibility, agreement improved slightly to 171 out of 271 questions (63.1%; κ = 0.46, 95% CI: 0.42-0.50). Comparison of ChatGPT's responses between the two rounds demonstrated high internal consistency, with agreement in 245 out of 271 responses (90.4%; κ = 0.86, 95% CI: 0.82-0.90). Subgroup analysis revealed stronger performance in the combined areas of homeostasis, nephrolithiasis, and pharmacology (κ = 0.53, 95% CI: 0.47-0.59 in both rounds), compared to other nephrology subfields. Conclusion: ChatGPT-4 demonstrates modest capability in replicating prevailing professional opinion in nephrology polls overall, with varying performance levels between question topics and excellent internal consistency. This study provides insights into the potential and limitations of using ChatGPT in medical decision making.

RESUMEN

BACKGROUND: This study aimed to explore the awareness, experiences, and beliefs of individuals with osteoarthritis (OA) regarding their healthcare management, along with assessing their overall satisfaction levels. METHODS: A cross-sectional online survey was conducted in Italy, Sweden, and Russia, rigorously developed based on OA international guidelines in collaboration with healthcare professionals and individuals with OA. Participants over 40 years of age with self-reported hip and/or knee OA were eligible. The analytical framework included descriptive analysis (assessment of awareness levels for 'recommended', 'optional', and 'not recommended' treatments), analysis of suggested treatments and taken treatments, exploration of beliefs, barriers and satisfaction analysis (0-100 scale). RESULTS: A total of 401 participants (mean age: 59.7, 78.3% female, 28% Italian, 49% Swedish, 23% Russian) contributed to the study. In Sweden, 57%-72% accurately identified recommended treatments, while in Russia, the range was 34%-91%, and in Italy, it was 35%-73%. The predominant suggested and taken treatments were oral anti-inflammatory drugs in Italy (87/81%) and Russia (97/97%) and specific exercise in Sweden (84/79%). Notably, only Sweden reached a consensus on the effectiveness of exercise for everyone, while Russia and Italy insisted on radiographic findings as a prerequisite for exercise. Mean satisfaction levels were 59.7 (Italy), 47.4 (Sweden), and 35.2 (Russia). CONCLUSIONS: This study uncovered variations in awareness, treatment preferences, and beliefs among the three countries, underscoring the necessity for tailored education on OA management that accounts for regional differences across Europe.

Asunto(s)

RESUMEN

Rice blast disease, caused by Magnaporthe oryzae, poses a significant threat to global rice production, necessitating the development of effective and sustainable management strategies. Biological control using beneficial microbes like Bacillus amyloliquefaciens has emerged as a promising approach due to its ability to enhance plant resistance and reduce disease incidence. Nano-encapsulation of bacteria, which involves embedding beneficial microbes within nanomaterials, offers a novel method to improve the stability, survival, and efficacy of these biocontrol agents. This study evaluated the capacity of encapsulated Bacillus amyloliquefaciens D203, embedded within an alginate-bentonite coating infused with titanium nanoparticles (TNs), to stimulate defense responses in rice seedlings challenged by the Magnaporthe oryzae the causal agent of rice blast disease. Encapsulation was achieved using the extrusion technique, with some modifications. Using a completely randomized design, the experiment was conducted in a greenhouse, with four treatments replicated four times. The experiment used the popular Kenyan rice variety "BASMATI 370". The study investigated the impact of strain D203 on the incidence, severity, and area under disease progress curves related to M. oryzae, as well as the expression of defense-related enzymes. The results demonstrated that rice plants derived from seeds coated with the D203 encapsulated B. amyloliquefaciens strain exhibited higher levels of defense-related enzyme expression, including peroxidase (POD), phenylalanine ammonia-lyase (PAL), superoxide dismutase (SOD) and catalase (CAT), compared to controls. In addition, the incidence and severity of the disease were markedly lower in plants treated with encapsulated B. amyloliquefaciens compared to controls, sometimes paralleling the efficacy of hexaconazole treatment. These findings suggest that the encapsulation of strain D203 has the potential to enhance resistance against rice blast disease by inducing systemic resistance through the production of antioxidant enzymes.

RESUMEN

Growing research shows psychosocial factors are associated with blood pressure (BP) control among individuals with hypertension. To date, little research has examined multiple psychosocial factors simultaneously to identify distinguishing profiles among individuals with hypertension. The association of psychosocial profiles and BP control remains unknown. To characterize the psychosocial profiles of individuals with hypertension and assess whether they are associated with BP control over 14 years. We included 2,665 MESA participants with prevalent hypertension in 2002-2004. Nine psychosocial variables representing individual, interpersonal, and neighborhood factors were included. BP control was achieved if systolic blood pressure (SBP) < 140 mmHg and diastolic blood pressure (DBP) < 9090 mmHg. Latent profile analysis (LPA) revealed an optimal model of three psychosocial profile groups (AIC 121,229; entropy = .88) "Healthy", "Psychosocially Distressed" and "Discriminated Against". Overall, there were no significant differences in systolic and diastolic BP control combined, across the profiles. Participants in the "Discriminated Against" profile group were significantly less likely [OR= 0.60; 95% CI: 0.43, 0.84] to have their DBP < 9090 mmHg as compared to the "Healthy" profile, but this was attenuated with full covariate adjustment. Discrete psychosocial profiles exist among individuals with hypertension but were not associated with BP control after full covariate adjustment.

RESUMEN

Background: Allergic rhinitis (AR) is a nasal disorder characterized by the simultaneous manifestation of at least 2 out of 4 possible symptoms: rhinorrhea, nasal itching, nasal pruritus, and sneezing. Presently, among Chinese young adults from Singapore, we characterised AR phenotypes, established Total Nasal Symptom Score (TNSS) baselines, and examined the management of AR. Methods: Participants completed an investigator-administered International Study of Asthma and Allergies in Childhood (ISAAC) questionnaire and underwent a skin prick test (SPT). Individuals exhibiting sensitization during the SPT while having at least 2 rhinitis symptoms were identified as AR cases, then categorized into Allergic Rhinitis in Asthma (ARIA) classifications. Results: There were 9323 subjects analyzed. AR prevalence was estimated at 35.4%. Rhinorrhea was perceived as the most severe (mean Nasal Symptom Score (mNSS) ± SD: 1.42 ± 0.74), while nasal pruritus was the least severe (mNSS ± SD: 1.24 ± 0.68). Among moderate-severe AR (68.1%), most were affected by either troublesome symptoms (27.7%) or sleep disturbances (18.4%). By ARIA classes, 26.6% were mild intermittent, 5.4% were mild persistent, 50.3% were moderate-severe intermittent, and 17.6% were moderate-severe persistent. The mean TNSS (mTNSS) of AR cases was 4.43 (SD = 2.49) and between AR classifications, the mTNSS was significantly different. Notably, a large proportion of AR cases remained undiagnosed (85.2%), untreated (72.5%), or both (65.4%); 19.8% self-medicated for AR. Conclusions: There was a significant difference in TNSS of the AR phenotypes, and among phenotypes with a higher mTNSS, a large proportion remained untreated, undiagnosed, or both. The evidence indicates an existing burden of AR among Chinese young adults in Singapore which is notably undermanaged.

RESUMEN

Few recent investigations examine coinfection interactions between fungal and viral plant pathogens. Here, we investigated coinfections between Leptosphaeria maculans and turnip mosaic virus (TuMV) in canola (Brassica napus). Different combinations of L. maculans isolate P11 and resistance breaking isolates L. maculans UWA192 and TuMV 12.1, were inoculated to three cultivars with differing pathogen resistances/susceptibilities. They were inoculated first to entire or half cotyledons 10-12 days after emergence, and second to opposite entire or half cotyledons on the same day (day 0) or 3 or 7 days afterwards. The parameters measured were L. maculans cotyledon disease index (%CDI), and TuMV systemically infected leaf symptom intensity (SI) and virus concentration (VC). Except when both day 0 inoculations were with isolate UWA192, %CDI values were supressed strongly or only weakly when isolates P11 and/or UWA192 were inoculated to plants with L. maculans single gene resistance (SGR) or polygenic resistance, respectively. However, except when isolate P11 was inoculated first and UWA192 second, these values declined after inoculation day 0 when SGR was absent. TuMV infection suppressed %CDI values, although this decrease was usually smaller following day 0 half cotyledon inoculations. When TuMV temperature sensitive extreme resistance was present and both inoculations were with TuMV, SI and VC values diminished greatly. However, the extent of this decrease was reduced when second inoculations were with L. maculans. SI and VC values were also smaller when SGR was present and second inoculations were with L. maculans. When L. maculans resistance was lacking, SI and VC values were smaller when second inoculations to entire cotyledons were with L. maculans rather than TuMV. This also occurred after second half cotyledon inoculations with isolate P11 but not isolate UWA192. Therefore, diverse inter- or intra-pathogen interactions developed depending upon host resistance, isolate combination, cotyledon inoculation approach and second inoculation timing.

RESUMEN

Bacterial blight caused by Pseudomonas syringae pv. glycines (Psg) is a widespread foliar disease. Although four Resistance to Pseudomonas syringae pv. glycinea (Rpg) 1 ~ 4 (Rpg1~4) genes that have been observed to segregate in a Mendelian pattern have been reported to confer resistance to Psg in soybean, the genetic basis of quantitative resistance to bacterial blight in soybean remains unclear. In the present study, the Psg resistance of two soybean association panels consisting of 573 and 213 lines, respectively, were phenotyped in multiple environments in 2014 - 2016. Genome-wide association study (GWAS) were performed using 2 models FarmCPU and BLINK to identify Psg resistance loci. A total of 40 soybean varieties with high level of Psg resistance were identified, and 14 quantitative trait loci (QTLs) were detected on 12 soybean chromosomes. These QTLs were identified for the first time. The majority of the QTLs were only detected in one or the other association panels, while qRPG-18-1 was detected in both association panels for at least one growing season. A total of 46 candidate Psg resistance genes were identified from the qRpg_13_1, qRPG-15-1, and qRPG-18-1 loci based on gene function annotation. In addition, we found the genomic region covering rpg1-b and rpg1-r harbored the synteny with a genomic region on chromosome 15, and identified 16 nucleotide binding site - leucine-rich repeat (NBS-LRR) genes as the candidate Psg resistance genes from the synteny blocks. This study provides new information for dissecting the genetic control of Psg resistance in soybean.

RESUMEN

Rhizoctonia zeae was recently identified as the major Rhizoctonia species in corn and soybean fields in Nebraska and was shown to be pathogenic on corn and soybean seedlings. Fungicide seed treatments commonly used to manage seedling diseases include prothioconazole (demethylation inhibitor), fludioxonil (phenylpyrrole), sedaxane (succinate dehydrogenase inhibitor), and azoxystrobin (quinone outside inhibitor; QoI). To establish the sensitivity of R. zeae to these fungicides, we isolated this pathogen from corn and soybean fields in Nebraska during 2015 to 2017 and estimated the relative effective concentration for 50% inhibition (EC50) of a total of 91 R. zeae isolates from Nebraska and Illinois. Average EC50 for prothioconazole, fludioxonil, sedaxane, and azoxystrobin was 0.219, 0.099, 0.078, and > 100 µgml-1, respectively. In planta assays showed that azoxystrobin did not significantly reduce the disease severity on soybean (P > 0.05). The cytochrome b gene of R. zeae did not harbor any mutation known to confer QoI resistance and had a type-I intron directly after codon 143 suggesting that a G143A mutation is unlikely to evolve in this pathogen. For prothioconazole, fludioxonil, and sedaxane, EC50 of isolates did not differ significantly among years of collection (P > 0.05) and their single discriminatory concentrations were identified as 0.1 µgml-1. This is the first study to establish non-target site resistance of R. zeae to azoxystrobin and the sensitivity of R. zeae to commonly used seed treatment fungicides in Nebraska. This information will help to guide strategies for chemical control of R. zeae and monitor sensitivity shifts in future.

RESUMEN

BACKGROUND: Chronic noncommunicable diseases (NCDs) account for major disability and premature mortality worldwide, with low- and middle-income countries being disproportionately burdened. Given the negative impact of NCDs on employee performance and work productivity, there is a rising need for stakeholders to identify effective workplace solutions that can improve employee health outcomes. As the workplace becomes more dispersed post pandemic, digital behavioral coaching offers a scalable, personalized, and cost-effective method of managing chronic disease risk factors among employees. OBJECTIVE: This study aimed to retrospectively evaluate the impact of a digital behavioral coaching program on year-to-year changes in employee health status in a cohort of Indonesian employees. METHODS: This retrospective real-world exploratory analysis of secondary health data followed 774 employees of an Indonesian company who completed company-sponsored health screenings between 2021 and 2022 and were given access to Naluri (Naluri Hidup Sdn Bhd), a holistic digital therapeutics platform offering digital behavioral health coaching and self-help tools. Participants were retrospectively classified as those who received active coaching (n=177), passive coaching (n=108), and no coaching (n=489). Linear mixed-effects models were used to evaluate the year-to-year changes in health outcomes across the 3 employee groups, with post hoc analyses evaluating within-group differences between the 2 time points and between-group differences at follow-up. RESULTS: Significant time×group interaction effects were detected for body weight, BMI, hemoglobin A1c, low-density lipoprotein, total cholesterol, and systolic and diastolic blood pressure. Post hoc pairwise comparisons revealed significant improvements in hemoglobin A1c (mean difference [Mdiff]=-0.14, P=.008), high-density lipoprotein (Mdiff=+2.14, P<.001), and total cholesterol (Mdiff=-11.45, P<.001) for employees in the Active Coaching group between 2021 and 2022, with the other 2 groups reporting deteriorations in multiple health outcomes throughout the 2 time points. At follow-up, those who received active coaching between 2021 and 2022 reported significantly lower body weight (P<.001), BMI (P=.001), low-density lipoprotein (P=.045), and total cholesterol (P<.001) than the No Coaching group. CONCLUSIONS: This study demonstrates real-world outcomes and implications supporting the use of workplace digital behavioral coaching in improving employee health status. Given the rising burden of NCDs in the Southeast Asian region, our findings underscore the role that workplace digital health interventions can play in preventing and managing chronic disease risk factors.

Asunto(s)

RESUMEN

Background and aim: Self-care technologies may support patients with multiple sclerosis (MS) in their everyday disease management by enabling self-monitoring of various health indicators, such as symptom levels and physical activity levels. The aim of this study was to assess the usefulness of tracking self-selected MS- and health-related measures via a digital self-tracking tool for people with MS (PwMS) over a period of six weeks. Methods: An initial development phase was followed by a six-week testing phase with 58 test participants. The evaluation phase followed a sequential, exploratory mixed-methods design, consisting of 14 interviews with test participants during the testing phase, followed by a survey of all participants after the testing phase to confirm and elaborate on the interview findings. The interview data were analyzed through a five-step thematic analysis, and the survey data were analyzed descriptively. Results: The results of the mixed-methods study can be summarized in the following findings: (1) Use of the self-tracking tool assisted users in clarifying patterns regarding their symptoms, physical activity, sleep quality and emotional well-being. (2) Tracking physical activity and, to some extent, sleep had a motivational effect on participants in relation to increasing activity and/or changing habits. (3) Data quality/accuracy constitutes an important criterion for considering the self-tracking tool relevant. (4) The self-tracking tool may support dialogue between patients and healthcare professionals, and/or it may potentially play a role in peer-to-peer support. Conclusion: The results of the present study indicate that the self-tracking of symptoms, sleep, physical activity and other measures may contribute positively to everyday self-management among PwMS. Professional support in interpreting and acting upon the data should be considered.