RESUMEN

Biomarkers are specific indicators that can be used to authenticate vegetable oils by reflecting unique characteristics such as variety or geographical origin. Biomarkers can originate from the primary components of the vegetable oil itself or from contaminants and trace substances linked to processing methods or adulterants. The review highlights the key findings in the identification of novel biomarkers for vegetable oil authentication. Various analytical techniques have proven effective in distinguishing unique biomarkers associated with specific vegetable oil varieties or geographical origins. The use of biomarkers of vegetable oils and associated contaminants or trace substances offers a comprehensive approach to authentication. However, the identification of novel biomarkers holds immense potential for enhancing food safety, preventing fraud, and safeguarding consumer health in the vegetable oil industry. The ongoing research and advancements in biomarker identification represent a promising avenue for addressing authenticity concerns in vegetable oils.

RESUMEN

Forwarding development of identification methods for novel foods, derived from edible insects, is necessary to ensure control over their marketing within the framework of the current legislation's requirements. The purpose of the research was the development and validation of a monoplex TaqMan-PCR assay protocol (a real-time polymerase chain reaction with TaqMan technology) for the insect Hermetia Illucens' taxon-specific DNA detection and identification in food raw materials and foods. Material and methods. Studies were performed using samples containing the target DNA sequence (dried whole larvae of H. Illucens as well as H. Illucens in oilcake meal and powdered capsule forms) and inherently not containing the target DNA sequence (other insect species, mammals, plants, microorganisms as well as multicomponent food: meat, dairy and plant food). DNA extraction and purification were performed by CTAB methods [commercial kits "Sorb-GMO-B" (Syntol, Russia) and "DNeasy mericon Food Kit" (QIAGEN, Germany)]. For amplification of the target sequence, which was a fragment of the cytochrome c oxidase subunit I mitochondrial gene, we used primers and the probe: Hei-COI-F (CCTGAGCTGGTATAGTGGGAAC); Hei-COI-R (AATTTGGTCATCTCCAATTAAGC); Hei-COI-P (FAM-CGAGCCGAATTAGGTCATCCAGG-BHQ-1). PCR conditions were optimized using CFX96TM Real-Time PCR System (Bio-Rad, USA) and Rotor-Gene Q (QIAGEN, Germany) amplifiers by empirical selection of primer and probe concentrations and amplification of the time/temperature profile. Specificity and limit of detection were evaluated as part of method validation. Results and discussion. The optimized reaction mixture included 2.5-fold of Master Mix B [KCl, TrisCl (pH 8.8), 6.25 mM MgCl2], SynTaq DNA-polymerase, dNTP, glycerol, Tween 20, of each primers - 550 nM, probe - 100 nM. The time/temperature profile of the reaction: 95 °C - 180 s (95 °C - 15 s, 57 °C - 60 s), 40 cycles. The detection limit of the method was 0.19 ng of H. illucens DNA per reaction. The specificity of primer system and probe were experimentally confirmed in studies with DNA of other insects, animals, plants and microorganisms. Conclusion. A protocol of a monoplex TaqMan-PCR assay for the taxon-specific DNA of insect Hermetia Illucens' detection and identification in food raw materials and foods has been developed. Validity of the method has been confirmed by laboratory tests which allows to recommend it for use in surveillance of Hermetia Illucens-derived raw materials.

Asunto(s)

RESUMEN

Honey is a natural product widely consumed all over the world due to its relationship with healthy benefits. Additionally, environmental and ethical issues have a higher weight in the consumer's choice to buy honey as a natural product. Following the high demand of this product, several approaches have been suggested and developed aiming at the assessment of honey's quality and authenticity. Target approaches, such as pollen analysis, phenolic compounds, sugars, volatile compounds, organic acids, proteins, amino acids, minerals, and trace elements, showed an efficacy, particularly concerning the honey origin. However, a special highlight is given to DNA markers, due to their useful applicability in environmental and biodiversity studies, besides the geographical, botanical, and entomological origins. Different DNA target genes were already explored for addressing diverse sources of honey DNA, with DNA metabarcoding attaining a relevant importance. This review aims to describe the latest advances on DNA-based methods applied in honey related studies, identifying the research needs for the development of new and additional required methodologies, and to select the most adequate tools for future research projects.

Asunto(s)

RESUMEN

Food adulteration is one of the most serious problems regarding food safety and quality worldwide. Besides misleading consumers, it poses a considerable health risk associated with the potential non-labeled allergen content. Fish and fish products are one of the most expensive and widely traded commodities, which predisposes them to being adulterated. Among all fraud types, replacing high-quality or rare fish with a less valuable species predominates. Because fish differ in their allergen content, specifically the main one, parvalbumin, their replacement can endanger consumers. This underlines the need for reliable, robust control systems for fish species identification. Various methods may be used for the aforementioned purpose. DNA-based methods are favored due to the characteristics of the target molecule, DNA, which is heat resistant, and the fact that through its sequencing, several other traits, including the recognition of genetic modifications, can be determined. Thus, they are considered to be powerful tools for identifying cases of food fraud. In this review, the major DNA-based methods applicable for fish meat and product authentication and their commercial applications are discussed, the possibilities of detecting genetic modifications in fish are evaluated, and future trends are highlighted, emphasizing the need for comprehensive and regularly updated online database resources.

RESUMEN

The increasing number of people with seafood allergy has caused a series of problems for practitioners and consumers in the seafood industry year by year. Thereby, development of efficient, convenient and low-cost allergen detection methods is urgently needed. This review introduces three important existing seafood allergen detection methods associated with DNA-based, protein-based and aptamer-based. Their principles and biological characteristics are firstly presented. The core of these three methods are DNA amplification techniques, specific binding of antigens and antibodies, and specific binding of aptamers and ligands, respectively. Among them, DNA-based detection method is an indirect analysis, which takes the gene of allergen as the detection object and is characterized by good stability and high sensitivity. Protein-based and aptamer-based, methods employ indirect analysis for allergen detection. The difference is that the latter uses an easily synthesized and highly efficient aptamer as the detection probe, showing great promising potentials. The advantages and disadvantages of the three mentioned detection methods are also discussed. In the future, as more efficient and reliable detection methods for seafood allergens come into practice, the possibility of seafood allergy patients eating seafood products by mistake will be greatly reduced, which will ensure the food safety and the health of allergy patients.

Asunto(s)

RESUMEN

The ecological assessment of European aquatic ecosystems is regulated under the framework directives on strategy for water and marine environments. Benthic macroinvertebrates are the most used biological quality element for ecological assessment of rivers, coastal-marines, and transitional waters. The morphological identification of benthic macroinvertebrates is the current tool for their assessment. Recently, DNA-based tools have been proposed as effective alternatives. The main current limits of DNA-based applications include the incompleteness of species recorded in the DNA barcode reference libraries and the primers bias. Here, we analysed the influence of the incompleteness of DNA barcode databases on species diversity indices, ecological indicators, and ecological assessment in transitional waters of the southeast Mediterranean, taking into account the availability of commonly sequenced and deposited genomic regions for listed species. The ecological quality status assigned through the potential application of both approaches to the analysed transitional water ecosystems was different in 27% of sites. We also analysed the inter-specific genetic distances to evaluate the potential application of the DNA metabarcoding method. Overall, this work highlights the importance to expand the barcode databases and to analyse, at the regional level, the gaps in the DNA barcodes.

RESUMEN

Global trade of seafood has increased in the last decade, leading to significant concerns associated with seafood fraud. Seafood fraud involves the intentional misrepresentation of fish or shellfish for the purpose of economic gain and includes acts such as species substitution, illegal transshipment, overtreatment/short weighting, and mislabeling country of origin or production method. These fraudulent acts have had economic, environmental, and public health consequences on a global level. DNA-based techniques for seafood authentication are utilized by regulatory agencies and can be employed as part of a food fraud risk mitigation plan. This chapter will focus specifically on the use of DNA-based methods for the detection of seafood species substitution. Various methods have been developed for DNA-based species identification of seafood, including polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), species-specific PCR, real-time PCR, Sanger sequencing, microarrays, and high-resolution melting (HRM). Emerging techniques for seafood authentication include droplet digital PCR, isothermal amplification, PCR-enzyme-linked immunosorbent assay (ELISA), and high-throughput or next-generation sequencing. Some of these DNA-based methods target specific species, such as real-time PCR and droplet digital PCR, while other methods allow for simultaneous differentiation of a wide range of fish species, including Sanger sequencing and high-throughput sequencing. This chapter will begin with an introduction on seafood fraud and species substitution, followed by an analysis of the main DNA-based authentication methods and emerging techniques for species identification.

Asunto(s)

RESUMEN

Nematodes are among the most diverse but least studied organisms. The classic morphology-based identification has proved insufficient to the study of nematode identification and diversity, mainly for lack of sufficient morphological variations among closely related taxa. Different molecular methods have been used to supplement morphology-based methods and/or circumvent these problems with various degrees of success. These methods range from fingerprint to sequence analyses of DNA- and/or protein-based information. Image analyses techniques have also contributed towards this success. In this review, we highlight what each of these methods entail and provide examples where more recent advances of these techniques have been employed in nematode identification. Wherever possible, emphasis has been given to nematodes of agricultural significance. We show that these alternative methods have aided nematode identification and raised our understanding of nematode diversity and phylogeny. We discuss the pros and cons of these methods and conclude that no one method by itself provides all the answers; the choice of method depends on the question at hand, the nature of the samples, and the availability of resources.

RESUMEN

Considering that mislabeled milk products have been widely reported throughout the world and that the authentication of food components is one of the key issues in food safety and quality, the aim of this study was to use DNA-based methods to investigate the prevalence of mislabeling among goat-milk products and, consequently, how far the ingredients matched the labels. The study reveals a high degree of species mislabeling in milk products (80%), underlining the need to enhance dairy traceability practices, so as to guarantee product authenticity, and provide reliable information to consumers.

Asunto(s)

RESUMEN

Gadiform order includes several fish families, from which Gadidae and Merlucciidae are part of, comprising the most commercially important and highly appreciated fish species, such as cod, pollock, haddock, and hake. Parvalbumins, classified as calcium-binding proteins, are considered the main components involved in the majority of fish allergies. Nine and thirteen parvalbumins were identified in different fish species from Gadidae and Merlucciidae families, respectively. This review intends to describe their molecular characterization and the clinical relevance, as well as the prevalence of fish allergy. In addition, the main protein- and DNA-based methods to detect fish allergens are fully reviewed owing to their importance in the safeguard of sensitized/allergic individuals.

Asunto(s)

RESUMEN

Currently, food allergies are an important health concern worldwide. The presence of undeclared allergenic ingredients or the presence of traces of allergens due to contamination during food processing poses a great health risk to sensitized individuals. Therefore, reliable analytical methods are required to detect and identify allergenic ingredients in food products. The present review addresses the recent developments regarding the application of DNA- and protein-based methods for the detection of allergenic ingredients in foods. The fitness-for-purpose of reviewed methodology will be discussed, and future trends will be highlighted. Special attention will be given to the evaluation of the potential of newly developed and promising technologies that can improve the detection and identification of allergenic ingredients in foods, such as the use of biosensors and/or nanomaterials to improve detection limits, specificity, ease of use, or to reduce the time of analysis. Such rapid food allergen test methods are required to facilitate the reliable detection of allergenic ingredients by control laboratories, to give the food industry the means to easily determine whether its product has been subjected to cross-contamination and, simultaneously, to identify how and when this cross-contamination occurred.

Asunto(s)

Asunto(s)