RESUMEN

Apple latent spherical virus (ALSV) is widely used as a virus-induced gene silencing (VIGS) vector for function genome study. However, the application of ALSV to soybeans is limited by the resistance of many varieties. In this study, the genetic locus linked to the resistance of a resistant soybean variety Heinong 84 was mapped by high-throughput sequencing-based bulk segregation analysis (HTS-BSA) using a hybrid population crossed from Heinong 84 and a susceptible variety, Zhonghuang 13. The results showed that the resistance of Heinong 84 to ALSV is controlled by two genetic loci located on chromosomes 2 and 11, respectively. Cleaved amplified polymorphic sequence (CAPS) markers were developed for identification and genotyping. Inheritance and biochemical analyses suggest that the resistance locus on chromosome 2 plays a dominant dose-dependent role, while the other locus contributes a secondary role in resisting ALSV. The resistance locus on chromosome 2 might encode a protein that can directly inhibit viral proliferation, while the secondary resistance locus on chromosome 11 may encode a host factor required for viral proliferation. Together, these data reveal novel insights on the resistance mechanism of Heinong 84 to ALSV, which will benefit the application of ALSV as a VIGS vector.

Asunto(s)

RESUMEN

Angelica sinensis (Oliv.) Diels is a perennial herb of the genus Angelica in the family Umbelliferae. The dried root of A. sinensis has have long been used medicinally (Zhang et al., 2016). Several plant viruses have been reported to infect A. sinensis: tomato mosaic virus, Japanese hornwort mosaic virus, and konjak mosaic virus (Zhang et al., 2020). In July 2019, we collected A. sinensis samples exhibiting symptoms of yellowing, mottling, and wrinkling from fields in Gansu Province. Seven plants were mixed in a composite sample and were commissioned to Biotech Bioengineering (Shanghai) Co., Ltd. for small RNA sequencing. Total RNA of A. sinensis was extracted according to the manufacturer's directions using the total RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.). The library was constructed using the TruSeq™ Small RNA Sample Prep Kits (Illumina, San Diego, USA) kit and was sequenced using the Illumina Hiseq2000/2500 with a single-end read length of 1X50bp. Samples were sequenced to obtain 1199561625 raw reads and 281093971 clean reads by removing low quality reads. Quality-controlled qualified reads were assembled using SPAdes (Bankevich et al., 2012) with a k-mer value of 17 and the obtained results were compared with NCBI's nucleotide database. Eight contigs were annotated as homologous to apple latent spherical virus (ALSV, AB030940.1 and AB030941.1). The similarity between the eight contigs and the reference genome ranged from 84% to 90%. The sequencing coverage of RNA1 and RNA2 of ALSV were 23.00% and 32.36%, respectively.The specific primers F 5`-CAGGGCCCAGATTTCACTAGAATTA-3` and R 5`- CTAAGTGTAGCCAGCCTTGAGCAATC -3` were designed based on acquired contigs to validate the sequencing results in the individual samples. One of the original composite samples was ALSV positive. Polymerase chain reaction products were detected in 1.5% agarose geland 1761 bp target band was obtained. The obtained sequence (OP038546) was searched against the NCBI nucleotide database using the BLASTn algorithm. Results showed that it shared 81.53% nucleotide sequence identities with the genome of ALSV ((AB030941.1) and this is the first time that ALSV was found to naturally infect A. sinensis. ALSV belongs to the genus Cheravirus in the family Secoviridae that was first identified in apple leaves (Li et al., 2000). To analyze the phylogenetic relationships of ALSV, all the coat protein genes of genus Cheravirus were downloaded from NCBI and a phylogenetic tree was constructed using the Construct/Test Maximum Likelihood Tree method using MEGA7.0 software. The self-extension value was 1000, and the branches with evolutionary numbers below 50% were removed. The ALSV isolate obtained from Gansu A. sinensis in this experiment aggregated in the same branch as the ALSV infested apple, again proving that the virus is ALSV (Fig.1A). Additionally, a total of 111 A. sinensis samples were collected and validated by RT-PCR with primers ALSV-F and ALSV-R. Among these samples, 15 were positive for ALSV. The overall infection rate of ALSV on A. sinensis was 13.51%. The detection rates of Weiyuan, Zhangxian, Tanchang, Minxian and Yuzhong were 15.38%, 40.00%, 23.08%, 7.84% and 8.33%, respectively (Table.1). A. sinensis infested with ALSV may produce symptoms of chlorotic and mottle (Fig.1C and D), which is similar to that in quinoa. Accordingly, larger scale A. sinensis investigations must be conducted to determine the distribution and prevalence of ALSV in China.

RESUMEN

Pine wilt disease (PWD), which is caused by the pine wood nematode Bursaphelenchus xylophilus, is among the most serious tree diseases worldwide. PWD is thought to be initiated by sequential excessive hypersensitive responses to B. xylophilus. Previous studies have reported candidate pathogenic molecules inducing hypersensitive responses in pine trees susceptible to B. xylophilus. The functions of some of these molecules have been analyzed in model plants using transient overexpression; however, whether they can induce hypersensitive responses in natural host pines remains unclear due to the lack of a suitable functional analysis method. In this study, we established a novel functional analysis method for susceptible black pine (Pinus thunbergii) seed embryos using transient overexpression by the Apple latent spherical virus vector and investigated five secreted proteins of B. xylophilus causing cell death in tobacco to determine whether they induce hypersensitive responses in pine. We found that three of five molecules induced significantly higher expression in pathogenesis-related genes ( p < 0.05), indicating hypersensitive response in pine seed embryos compared with mock and green fluorescence protein controls. This result suggests that tobacco-based screening may detect false positives. This study is the first to analyze the function of pathogenic candidate molecules of B. xylophilus in natural host pines using exogenous gene expression, which is anticipated to be a powerful tool for investigating the PWD mechanism.

RESUMEN

Crude-sap of apple latent spherical virus (ALSV)-infected Chenopodium quinoa leaves was rub-inoculated on the expanded cotyledons of various Cucurbitaceae plants. Most of the species were systemically infected with the virus without obvious symptoms, except pumpkin (Cucurbita maxima). In pumpkin, the ALSV infection was restricted to inoculated cotyledons; it did not spread to the upper true leaves. In situ hybridization showed that the ALSV was confined to part of the cotyledon tissues and it did not invade the phloem tissue, when inoculated at the expanded cotyledon stage. However, when total RNAs from ALSV-infected C. quinoa leaves were inoculated into the cotyledons immediately after germination (folded cotyledon stage) using particle bombardment, ALSV efficiently caused systemic infection. Systemic infection of pumpkin seedlings occurred only when the cotyledons were inoculated within a few days after germination. No systemic infection was observed in the seedlings 4 days after germination. In the grafting test, ALSV was not transmitted from the infected rootstocks to the healthy scions of pumpkins. An efficient virus-induced gene silencing system for pumpkins was established, in which infection with ALSV vectors harboring the phytoene desaturase or sulfur gene fragments resulted in a uniform phenotype in the true leaves of pumpkin seedlings.

Asunto(s)

RESUMEN

BACKGROUND: Lupins are promising protein crops with an increasing amount of genomic and transcriptomic resources. The new resources facilitate the in silico identification of candidate genes controlling important agronomic traits. However, a major bottleneck for lupin research and crop improvement is the in planta characterization of gene function. Here, we present an efficient protocol for virus-induced gene silencing (VIGS) to down-regulate endogenous genes in narrow-leafed lupin (NLL) using the apple latent spherical virus (ALSV). RESULTS: We identified ALSV as an appropriate VIGS vector able to infect NLL without causing a discernible phenotype. We created improved ALSV vectors to allow for efficient cloning of gene fragments into the viral genome and for easier viral propagation via agroinfiltration of Nicotiana benthamiana. Using this system, we silenced the visual marker gene phytoene desaturase (PDS), which resulted in systemic, homogenous silencing as indicated by bleaching of newly produced tissues. Furthermore, by silencing lysine decarboxylase (LaLDC)-a gene likely to be involved in toxic alkaloid biosynthesis-we demonstrate the applicability of our VIGS method to silence a target gene alone or alongside PDS in a 'PDS co-silencing' approach. The co-silencing approach allows the visual identification of tissues where silencing is actively occurring, which eases tissue harvesting and downstream analysis, and is useful where the trait under study is not affected by PDS silencing. Silencing LaLDC resulted in a ~ 61% or ~ 67% decrease in transcript level, depending on whether LaLDC was silenced alone or alongside PDS. Overall, the silencing of LaLDC resulted in reduced alkaloid levels, providing direct evidence of its involvement in alkaloid biosynthesis in NLL. CONCLUSIONS: We provide a rapid and efficient VIGS method for validating gene function in NLL. This will accelerate the research and improvement of this underutilized crop.

RESUMEN

Quinoa (Chenopodium quinoa), native to the Andean region of South America, has been recognized as a potentially important crop in terms of global food and nutrition security since it can thrive in harsh environments and has an excellent nutritional profile. Even though challenges of analyzing the complex and heterogeneous allotetraploid genome of quinoa have recently been overcome, with the whole genome-sequencing of quinoa and the creation of genotyped inbred lines, the lack of technology to analyze gene function in planta is a major limiting factor in quinoa research. Here, we demonstrate that two virus-mediated transient expression techniques, virus-induced gene silencing (VIGS) and virus-mediated overexpression (VOX), can be used in quinoa. We show that apple latent spherical virus (ALSV) can induce gene silencing of quinoa phytoene desaturase (CqPDS1) in a broad range of quinoa inbred lines derived from the northern and southern highland and lowland sub-populations. In addition, we show that ALSV can be used as a VOX vector in roots. Our data also indicate that silencing a quinoa 3,4-dihydroxyphenylalanine 4,5-dioxygenase gene (CqDODA1) or a cytochrome P450 enzyme gene (CqCYP76AD1) inhibits betalain production and that knockdown of a reduced-height gene homolog (CqRHT1) causes an overgrowth phenotype in quinoa. Moreover, we show that ALSV can be transmitted to the progeny of quinoa plants. Thus, our findings enable functional genomics in quinoa, ushering in a new era of quinoa research.

RESUMEN

Coccinia grandis is an interesting model system to understand dioecy in Cucurbitaceae family. Recent transcriptomics and proteomics studies carried out to understand the sex expression in C. grandis have resulted in identification of many candidate sex-biased genes. In absence of an efficient genetic transformation protocol for C. grandis, virus-induced gene silencing (VIGS) would be a powerful tool to enable gene functional analysis. In current study, we explored the apple latent spherical virus (ALSV) for gene knockdown in C. grandis. The viral infection was achieved through mechanical inoculation of ALSV-infected Chenopodium quinoa leaf extract onto the cotyledons of C. grandis. ALSV-VIGS mediated knockdown of CgPDS gene was successfully achieved in C. grandis by mechanical inoculation method resulting in characteristic photobleaching. Subsequently, we developed agroinfiltration compatible vectors for direct infection of C. grandis and shortened the time-frame by skipping viral propagation in C. quinoa. Typical yellow-leaf phenotype was observed in C. grandis plants agroinfiltrated with ALSV-CgSU constructs, indicating robust silencing of CgSU gene. In addition, we improved the infection efficiency of ALSV by co-infiltration of P19 viral silencing suppressor. These results suggest that ALSV-VIGS is suitable for characterization of gene function in dioecious C. grandis and it can help us understand the mechanism of sex expression.

Asunto(s)

RESUMEN

Apple latent spherical virus (ALSV) was successfully used in promoting flowering (virus-induced flowering, VIF) in apple and pear seedlings. In this paper, we report the use of ALSV vectors for VIF in seedlings and in vitro cultures of grapevine. After adjusting experimental conditions for biolistic inoculation of virus RNA, ALSV efficiently infected not only progeny seedlings of Vitis spp. 'Koshu,' but also in vitro cultures of V. vinifera 'Neo Muscat' without inducing viral symptoms. The grapevine seedlings and in vitro cultures inoculated with an ALSV vector expressing the 'florigen' gene (Arabidopsis Flowering locus T, AtFT) started to set floral buds 20-30 days after inoculation. This VIF technology was successfully used to promote flowering and produce grapes with viable seeds in in vitro cultures of F1 hybrids from crosses between V. ficifolia and V. vinifera and made it possible to analyze the quality of fruits within a year after germination. High-temperature (37 °C) treatment of ALSV-infected grapevine disabled virus movement to newly growing tissue to obtain ALSV-free shoots. Thus, the VIF using ALSV vectors can be used to shorten the generation time of grapevine seedlings and accelerate breeding of grapevines with desired traits.

Asunto(s)

RESUMEN

Apple latent spherical virus (ALSV) is a latent virus with wide host range of plant species. In the present study, we prepared ALSV vectors expressing RNA silencing suppressors (RSSs) from eight plant viruses: P19 of carnation Italian ring spot virus (tombusvirus), 2b of peanut stunt virus (cucumovirus), NSs of tomato spotted wilt virus (tospovirus), HC-Pro of bean yellow mosaic virus (potyvirus), γb of barley stripe mosaic virus (hordeivirus), P15 of peanut clump virus (pecluvirus), P1 of rice yellow mottle virus (sobemovirus), or P21 of beet yellows virus (closterovirus). These vectors were inoculated to Nicotiana benthamiana to investigate the effects of RSSs on the virulence and accumulation of ALSV. Among the vectors, ALSV expressing NSs (ALSV-NSs) developed severe mosaic symptoms in newly developed leaves followed by plant death. Infection of ALSV-γb induced characteristic concentric ringspot symptoms on leaves, and plants infected with ALSV-HC-Pro showed mosaic and dwarf symptoms. Infection of the other five ALSV vectors did not show symptoms. ELISA and immunoblot assay indicated that virus titer increased in leaves infected with ALSV-NSs, γb, HC-Pro, or P19. RT-qPCR indicated that the amount of ALSV in plants infected with ALSV-NSs was increased by approximately 45 times compared with that of wtALSV without expression of any RSS. When ALSV-P19, NSs, or HC-Pro was inoculated to Cucumis sativus plants, none of these ALSV vectors induced symptoms, but accumulation of ALSV in plants infected with ALSV-NSs was increased, suggesting that functions of RSSs on virulence and accumulation of ALSV depend on host species.

Asunto(s)

RESUMEN

The apple latent spherical virus (ALSV), originally isolated from an apple tree in Japan, is a small spherical virus with a diameter of 25 nm and comprises a bisegmented, single-stranded RNA genome (RNA1 and RNA2) and three different capsid proteins (Vp25, Vp20, and Vp24). The virus can experimentally infect a broad range of plants including, not only model plants (Arabidopsis thaliana and Nicotiana species) but also economically important crops such as cucumber, soybean, tomato, fruit trees, and flowers. ALSV has been used as an effective plant virus vector for virus-induced gene silencing (VIGS) to assess gene functions because the virus infects most of the host plants without showing any symptoms and induces a uniform knockout phenotype in infected plants. Moreover, the VIGS persists throughout plant growth in infected plants. Here, we show that genetically engineered ALSV vectors (ALSV vaccines) containing a partial genome sequence of pathogenic viruses display a high degree of cross-protection against the challenge inoculation of the corresponding pathogenic viruses. Treatment effects can also be expected in virus-infected plants by subsequent inoculation with ALSV vaccine.

Asunto(s)

RESUMEN

BACKGROUND: Virus induced gene silencing (VIGS) is a powerful genomics tool for interrogating the function of plant genes. Unfortunately, VIGS vectors often produce disease symptoms that interfere with the silencing phenotypes of target genes, or are frequently ineffective in certain plant genotypes or tissue types. This is especially true in crop plants like soybean [Glycine max (L.) Merr]. To address these shortcomings, we modified the inoculation procedure of a VIGS vector based on Apple latent spherical virus (ALSV). The efficacy of this new procedure was assessed in 19 soybean genotypes using a soybean Phytoene desaturase (GmPDS1) gene as the VIGS target. Silencing of GmPDS1 was easily scored as photo-bleached leaves and/or stems. RESULTS: In this report, the ALSV VIGS vector was modified by mobilizing ALSV cDNAs into a binary vector compatible with Agrobacterium tumefaciens-mediated delivery, so that VIGS-triggering ALSV variants could be propagated in agro-infiltrated Nicotiana benthamiana leaves. Homogenate of these N. benthamiana leaves was then applied directly onto the unifoliate of young soybean seedlings to initiate systemic gene silencing. This rapid inoculation method bypassed the need for a particle bombardment apparatus. Among the 19 soybean genotypes evaluated with this new method, photo-bleaching indicative of GmPDS1 silencing was observed in nine, with two exhibiting photo-bleaching in 100% of the inoculated individuals. ALSV RNA was detected in pods, embryos, stems, leaves, and roots in symptomatic plants of four genotypes. CONCLUSIONS: This modified protocol allowed for inoculation of soybean plants via simple mechanical rubbing with the homogenate of N. benthamiana leaves agro-infiltrated with ALSV VIGS constructs. More importantly, inoculated plants showed no apparent virus disease symptoms which could otherwise interfere with VIGS phenotypes. This streamlined procedure expanded this functional genomics tool to nine soybean genotypes.

RESUMEN

MAIN CONCLUSION: The use of a VIGS approach to silence the newly characterized apple tree SQS isoforms points out the biological function of phytosterols in plastid pigmentation and leaf development. Triterpenoids are beneficial health compounds highly accumulated in apple; however, their metabolic regulation is poorly understood. Squalene synthase (SQS) is a key branch point enzyme involved in both phytosterol and triterpene biosynthesis. In this study, two SQS isoforms were identified in apple tree genome. Both isoforms are located at the endoplasmic reticulum surface and were demonstrated to be functional SQS enzymes using an in vitro activity assay. MdSQS1 and MdSQS2 display specificities in their expression profiles with respect to plant organs and environmental constraints. This indicates a possible preferential involvement of each isoform in phytosterol and/or triterpene metabolic pathways as further argued using RNAseq meta-transcriptomic analyses. Finally, a virus-induced gene silencing (VIGS) approach was used to silence MdSQS1 and MdSQS2. The concomitant down-regulation of both MdSQS isoforms strongly affected phytosterol synthesis without alteration in triterpene accumulation, since triterpene-specific oxidosqualene synthases were found to be up-regulated to compensate metabolic flux reduction. Phytosterol deficiencies in silenced plants clearly disturbed chloroplast pigmentation and led to abnormal development impacting leaf division rather than elongation or differentiation. In conclusion, beyond the characterization of two SQS isoforms in apple tree, this work brings clues for a specific involvement of each isoform in phytosterol and triterpene pathways and emphasizes the biological function of phytosterols in development and chloroplast integrity. Our report also opens the door to metabolism studies in Malus domestica using the apple latent spherical virus-based VIGS method.

Asunto(s)

RESUMEN

Information concerning to regulation of vegetative phase and floral initiation in herbaceous perennial plants has been limited to a few plant species. To know and compare flowering regulation in a wider range of plant species, we identified and characterized SHORT VEGETATIVE PHASE (SVP)-like genes (GtSVP-L1 and GtSVP-L2) from herbaceous perennial gentian (Gentiana triflora). Apple latent spherical virus (ALSV)-mediated silencing of the GtSVP-L1 in G. triflora seedlings resulted in early flowering and shortened vegetative phase by about one-third period of time, without vernalization. This indicated that GtSVP-L1 acts as a negative regulator of flowering and vegetative phase. Seasonal change in the expression of GtSVP was monitored in the overwinter buds (OWBs) of G. triflora. It was found that the levels of GtSVP-L1 mRNA in OWBs increased concomitantly with induction and/or maintenance of dormancy, then decreased toward release from dormancy, while that of GtSVP-L2 mRNA remained low and unchanged. These results implied that, in herbaceous perennial plants, SVP ortholog might concern to activity-dormancy control, as well as negative regulation in flowering. Practically, these results can be applicable to non-time-consuming technologies for breeding.

Asunto(s)

RESUMEN

Plant viral vectors are superior tools for genetic manipulation, allowing rapid induction or suppression of expression of a target gene in plants. This is a particularly effective technology for use in breeding fruit trees, which are difficult to manipulate using recombinant DNA technologies. We reported previously that if apple seed embryos (cotyledons) are infected with an Apple latent spherical virus (ALSV) vector (ALSV-AtFT/MdTFL1) concurrently expressing the Arabidopsis thaliana florigen (AtFT) gene and suppressing the expression of the apple MdTFL1-1 gene, the period prior to initial flowering (generally lasts 5-12 years) will be reduced to about 2 months. In this study, we examined whether or not ALSV vector technology can be used to promote flowering in pear, which undergoes a very long juvenile period (germination to flowering) similar to that of apple. The MdTFL1 sequence in ALSV-AtFT/MdTFL1 was replaced with a portion of the pear PcTFL1-1 gene. The resulting virus (ALSV-AtFT/PcTFL1) and ALSV-AtFT/MdTFL1 were used individually for inoculation to pear cotyledons immediately after germination in two inoculation groups. Those inoculated with ALSV-AtFT/MdTFL1 and ALSV-AtFT/PcTFL1 then initiated flower bud formation starting one to 3 months after inoculation, and subsequently exhibited continuous flowering and fruition by pollination. Conversely, Japanese pear exhibited extremely low systemic infection rates when inoculated with ALSV-AtFT/MdTFL1, and failed to exhibit any induction of flowering. We also developed a simple method for eliminating ALSV vectors from infected plants. An evaluation of the method for eliminating the ALSV vectors from infected apple and pear seedlings revealed that a 4-week high-temperature (37°C) incubation of ALSV-infected apples and pears disabled the movement of ALSV to new growing tissues. This demonstrates that only high-temperature treatment can easily eliminate ALSV from infected fruit trees. A method combining the promotion of flowering in apple and pear by ALSV vector with an ALSV elimination technique is expected to see future application as a new plant breeding technique that can significantly shorten the breeding periods of apple and pear.

RESUMEN

Overwinter survival has to be under critical regulation in the lifecycle of herbaceous perennial plants. Gentians (Gentiana L.) maintain their perennial life style through producing dormant and freezing-tolerant overwinter buds (OWBs) to overcome cold winter. However, the mechanism acting on such an overwinter survival and the genes/proteins contributing to it have been poorly understood. Previously, we identified an OWB-enriched protein W14/15, a member of a group of α/ß hydrolase fold superfamily that is implicated in regulation of hormonal action in plants. The W14/15 gene has more than ten variant types in Gentiana species. However, roles of the W14/15 gene in OWB survival and functional difference among those variants have been unclear. In the present study, we examined whether the W14/15 gene variants are involved in the mechanism acting on overwinter survival, by crossing experiments using cultivars carrying different W14/15 variant alleles and virus-induced gene silencing experiments. We found that particular types of the W14/15 variants (W15a types) contributed toward obtaining high ability of overwinter survival, while other types (W14b types) did not, or even interfered with the former type gene. This study demonstrates two findings; first, contribution of esterase genes to winter hardiness, and second, paired set or paired partner among the allelic variants determines the ability of overwinter survival.

Asunto(s)

RESUMEN

Apple latent spherical virus (ALSV) is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation) system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS) is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the cauliflower mosaic virus 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation zero plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A) was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.

RESUMEN

Apple latent spherical virus (ALSV) has small isometric particles that are comprised of two single-stranded RNA species (RNA1 and RNA2) and three capsid proteins (Vp25, Vp20, and Vp24). We constructed ALSV vectors for presenting foreign peptides on the surface of virus particles. In these vectors, peptides can be fused to either of two C-terminal regions of Vp20 (amino acid positions between G171 and P172 or between P172 and L173) or the C-terminus (T192) of Vp24. An ALSV vector presenting the epitope sequences of the coat protein (CP) of zucchini yellow mosaic virus (ZYMV) could systemically infect host plants and was specifically recognized by antiserum against ZYMV by ELISA, immunoelectron microscopy, and immunoblotting. RT-PCR showed that the epitope sequences up to 20 amino acids were stably maintained in the chimeric ALSV for more than 10 serial passages and at least six months. Purified chimeric ALSV particles induced an immune response and the production of antibodies against ZYMV-CP in rabbits. The ALSV vector was also used for expression of an epitope from VP1 of foot-and-mouth disease virus.

Asunto(s)

RESUMEN

Fruit trees have a long juvenile phase. For example, the juvenile phase of apple (Malus × domestica) generally lasts for 5-12 years and is a serious constraint for genetic analysis and for creating new apple cultivars through cross-breeding. If modification of the genes involved in the transition from the juvenile phase to the adult phase can enable apple to complete its life cycle within 1 year, as seen in herbaceous plants, a significant enhancement in apple breeding will be realized. Here, we report a novel technology that simultaneously promotes expression of Arabidopsis FLOWERING LOCUS T gene (AtFT) and silencing of apple TERMINAL FLOWER 1 gene (MdTFL1-1) using an Apple latent spherical virus (ALSV) vector (ALSV-AtFT/MdTFL1) to accelerate flowering time and life cycle in apple seedlings. When apple cotyledons were inoculated with ALSV-AtFT/MdTFL1 immediately after germination, more than 90% of infected seedlings started flowering within 1.5-3 months, and almost all early-flowering seedlings continuously produced flower buds on the lateral and axillary shoots. Cross-pollination between early-flowering apple plants produced fruits with seeds, indicating that ALSV-AtFT/MdTFL1 inoculation successfully reduced the time required for completion of the apple life cycle to 1 year or less. Apple latent spherical virus was not transmitted via seeds to successive progenies in most cases, and thus, this method will serve as a new breeding technique that does not pass genetic modification to the next generation.

Asunto(s)

RESUMEN

Apple latent spherical virus (ALSV) is characterized by its relatively broad host range, latency in most host plants, and ability to induce gene silencing in host plants. Herein, we focus on the above characteristic of ALSV and describe our development of ALSV vector vaccines against three tospoviruses, namely, Impatiens necrotic spot virus (INSV), Iris yellow spot virus (IYSV), and Tomato spotted wilt virus (TSWV). DNA fragments of 201 nt of three tospovirus S-RNAs (silencing suppressor (NSS) and nucleocapsid protein (N) coding regions for each tospovirus) were inserted into an ALSV-RNA2 vector to obtain six types of ALSV vector vaccines. Nicotiana benthamiana plants at the five-leaf stage were inoculated with each ALSV vector vaccine and challenged with the corresponding tospovirus species. Tospovirus-induced symptoms and tospovirus replication after challenge were significantly suppressed in plants preinoculated with all ALSV vector vaccines having the N region fragment, indicating that strong resistance was acquired after infection with ALSV vector vaccines. On the other hand, cross protection was not significant in plants preinoculated with ALSV vectors having the NSs region fragment. Similarly, inoculation with an ALSV-RNA1 vector having the N region fragment in the 3'-noncoding region, but not the NSs region fragment, induced cross protection, indicating that cross protection is via RNA silencing, not via the function of the protein derived from the N region fragment. Our approach, wherein ALSV vectors and selected target inserts are used, enables rapid establishment of ALSV vector vaccines against many pathogenic RNA viruses with known sequences.

Asunto(s)