RESUMEN
Carbon tetrachloride (CCl4) is a potent chemical compound that can induce liver cells necrosis. The purpose of this study was to evaluate the hepatic toxicity of CCl4 exposure in Macaca fascicularis to explore the liver toxicity mechanism using a proteomic approach. One animal (no.F6) was intoxicated by oral gavage with 15â¯% CCl4 solution (10â¯mL/kg, dissolved in edible peanut oil), and was sacrificed at 48â¯h after CCl4 administration. Another blank control animal (no.F4) was sacrificed at the same time. The liver cells of the blank control animal showed normal hepatocyte morphology. However, the hepatocytes at 48â¯h time point after CCl4 administration showed necrosis and vacuolation histopathologically. The animal No.F7â¼F12 and no.M7â¼M12 were administrated by gavage with 15â¯% CCl4 solution (10â¯mL/kg, dissolved in edible peanut oil). Blood samples were collected before gavage administration, and served as the 0â¯h blank control samples. Then, blood samples were collected at 2â¯h, 48â¯h, 72â¯h and 168â¯h after CCl4 exposure, and served as the test samples. Routine biochemistry and immunical parameters were performed using biochemistry analyzer for all serum. Then the serum from male and female animals at 0â¯h, 2â¯h, 48â¯h, and 72â¯h was mixed, respectively. The peripheral serum proteins at 0â¯h, 2â¯h, 48â¯h, and 72â¯h were extracted, then the proteins were enzymatically hydrolyzed and the peptides were isotopic labeled by isobaric tags for relative and absolute quantification (iTRAQ). Finally, the UniProt Protein Sequence Library of Macaca fascicularis was queried to identify and compare the differential proteins between different time points. The results showed that, as traditional biomarkers of liver injury, alanine aminotransferases (ALT) and aspartate aminotransferases (AST) showed a typical time-effect curve. Compared with 0â¯h, there were totally 55, 323, and 158 differential proteins (P value <0.05, Ratio fold >1.5, FDR<0.05) at 2â¯h, 48â¯h and 72â¯h, respectively. GO enrichment analysis of differentially expressed proteins only at 48â¯h involved 3 cellular components (P adjust value <0.05), and differential proteins at other time points had no significant enrichment. Furthermore, KEGG enrichment analysis showed that the toxicity effect of CCl4 at different time points after administration was mediated through 22 pathways such as biosynthesis of antibiotics, carbon metabolism, biosynthesis of amino acids, peroxisome, cysteine and methionine metabolism, arginine biosynthesis, and complement and coagulation cascades (P adjust value <0.05). Among them, the counts of signaling pathway involved biosynthesis of antibiotics, carbon metabolism and biosynthesis of amino acids were more than 10 and the three pathways may play a greater role in toxicity progress after administration of CCl4. PPI network analysis showed that there were 3, 52, and 13 nodes in the interaction of differential proteins at 2â¯h, 48â¯h, and 72â¯h, respectively. In conclusion, many differential proteins in peripheral blood were detected after CCl4 administration, and the GO and KEGG enrichment analysis showed the toxicological mechanisms of CCl4-induced liver injury and potential protection reaction mechanism for CCl4 detoxication may be related with multi biological processes, signaling pathway and targets.
RESUMEN
OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.