RESUMEN
Advancements in radiative cooling technology have shown significant progress in recent years. However, the limited mechanical properties of most radiative coolers greatly hinder their practical applications, particularly in the context of human cooling fabrics. In this study, we present the fabrication of facile and stretchable radiative coolers with exceptional cooling performance by utilizing the design of porous radiative coolers as guidelines for developing promising elastomer coolers. Subsequently, we employ a simple electrospinning method to fabricate these coolers, resulting in impressive solar reflectivity (â¼96.1%) and infrared emissivity (over 95%). During the summer, these coolers demonstrate a maximum temperature drop of â¼9.6 °C. Additionally, the developed coolers exhibit superior hydrophobicity and mechanical properties, with a high strain capacity exceeding 700% and a stress tolerance of over 30 MPa, highlighting their potential for application in automobile textiles and cooling fabrics. Furthermore, we evaluate the radiative cooling performance of stretchable coolers using global-scale modeling, revealing their significant cooling potential across various regions worldwide.
RESUMEN
The effect of hydrostatic pressure and cation type on chloride ion transport in marine underwater concrete cannot be ignored. The study of the chloride ion transport behavior of concrete under the effect of hydrostatic pressure and cation type coupling can provide a basis for durability design and the protection of marine concrete. In this work, the chloride ion transport behavior of marine concrete in four common chloride salt solutions under different hydrostatic pressures is studied by a hydrostatic pressure test device developed by the authors. The results show that hydrostatic pressure and its action time significantly influence the chloride ion transport behavior in marine concrete; the higher the hydrostatic pressure of concrete, the faster the chloride ion transport rate. The longer the time, the more chloride ions accumulated in the same position, and the farther the chloride ion transport distance. Cation type has a certain influence on the transport process of chloride ions. Under the same test conditions, the chloride ion transport rate in a divalent cation solution is about 5% higher than that in a monovalent cation solution. The results also show that the chloride ion binding capacity under hydrostatic pressure is only 10~20% of that under natural diffusion. Using the test results, a predictive model of a chloride ion apparent transport coefficient based on the hydrostatic pressure and hydrostatic pressure action time corrected by a cation type influence coefficient is established.
RESUMEN
Previous studies show that B vitamins and homocysteine (Hcy) may be associated with mental disorders, but the accurate causal relationship remains unclear. This study aimed to elucidate the potential causal relationship of serum B vitamins and Hcy levels with five common mental disorders through a two-sample Mendelian randomization (MR) study. In this MR analysis, 50 single-nucleotide polymorphisms (SNPs)-13 related to folate, 17 to vitamin B6, 8 to vitamin B12 and 12 to Hcy-were obtained from a large-scale Genome-Wide Association Studies (GWAS) database and employed as instrumental variables (IVs). The MR analyses were conducted using the inverse variance weighted (IVW), weighted median (WM), MR-Egger methods and sensitivity analyses were further performed to test the robustness. This MR study found a suggestive causal relationships between serum vitamin B12 levels and the risk of anxiety disorders (odds ratio (OR): 1.34, 95% confidence interval (CI): 1.01-1.78, p = 0.046) and bipolar affective disorders (OR: 1.85, 95% CI: 1.16-2.96, p = 0.010). However, folate, vitamin B6 and Hcy levels may not be causally associated with the risk of mental disorders. In conclusion, this study reveals that elevated serum vitamin B12 levels might suggestively increase the risk of anxiety and bipolar affective disorders, even though horizontal pleiotropy cannot be completely eliminated. The potential implications of our results warrant validation in larger GWAS based on diverse populations.
Asunto(s)
Estudio de Asociación del Genoma Completo , Homocisteína , Análisis de la Aleatorización Mendeliana , Trastornos Mentales , Polimorfismo de Nucleótido Simple , Vitamina B 12 , Complejo Vitamínico B , Humanos , Homocisteína/sangre , Complejo Vitamínico B/sangre , Trastornos Mentales/sangre , Trastornos Mentales/genética , Vitamina B 12/sangre , Ácido Fólico/sangre , Factores de RiesgoRESUMEN
Agricultural carbon footprint (CF) evaluation plays an important role in climate change mitigation and national food security. Many studies have been conducted worldwide to evaluate the CF of rapeseed and its byproducts; however, only a few of these studies have considered finer-scale spatial-temporal heterogeneity. Considering the advantages of using detailed crop information extracted by remote sensing (RS) techniques, we attempted to integrate RS into life cycle assessments to improve rapeseed CF evaluation. A case study was conducted from 2021 to 2023 in one of the most important grain- and rapeseed-producing areas in Southwest China, namely, the Chengdu Plain, covering an area of 18,810.00 km2. The results of our study suggest that: (1) the proposed approach is applicable for high-resolution (10 m ∗ 10 m) rapeseed distribution mapping; (2) the farm-based CFs of rapeseed in the studied region range from 3333.08 to 4572.82 kgCO2-eq ha-1, while the product-based CFs (PCFs) vary from 1316.23 to 2443.95 kgCO2-eq t-1. Nitrogen fertilizer processing and its application are identified as the dominant contributors to upstream and downstream greenhouse emissions (GHGs), respectively; (3) the significant role of soil properties and soil organic carbon in influencing crop PCFs indicates good GHG offsets. The method used in the current study has strong adaptability and universality in different areas with various climatic conditions and can provide a solid basis for policymakers to formulate differentiated agricultural carbon reduction policies.
RESUMEN
1,3,5-Trimethylenebenzene (1,3,5-TMB), a 3-fold-symmetric triradical with a high-spin ground state, is an attractive platform for investigating the unique spin properties of π-conjugated triangular triradicals. Here, we report the on-surface synthesis of N-heterocyclic carbene (NHC)-derived 1,3,5-TMB (N-TMB) via surface-assisted C-C and C-N coupling reactions on Au(111). The chemical and electronic structures of N-TMB on the Au(111) surface are revealed with atomic precision using scanning tunneling microscopy and noncontact atomic force microscopy, combined with density functional theory (DFT) calculations. It is demonstrated that there is substantial charge transfer between N-TMB and the substrate, resulting in a positively charged N-TMB on Au(111). DFT calculations at the UB3LYP/def2-TZVP level of theory and multireference method, e.g., CASSCF/NEVPT2, indicate that N-TMB possesses a doublet ground state with reduced Cs symmetry in the gas phase, contrasting the quartet ground state of 1,3,5-TMB with D3h symmetry, and exhibits a doublet-quartet energy gap of -0.80 eV. The incorporation of NHC structures and the extended π-conjugation promote the spin-orbital overlaps in N-TMB, leading to Jahn-Teller distortion and the formation of a robust doublet state. Our results not only demonstrate the fabrication of polyradicals based on NHC but also shed light on the effect of NHC and π-conjugation on the electronic structure and spin coupling, which opens up new possibilities for precisely regulating the spin-spin exchange coupling of organic polyradicals.
RESUMEN
Background: Reliable predictors for rehabilitation outcomes in patients with congenital sensorineural hearing loss (CSNHL) after cochlear implantation (CI) are lacking. The purchase of this study was to develop a nomogram based on clinical characteristics and neuroimaging features to predict the outcome in children with CSNHL after CI. Methods: Children with CSNHL prior to CI surgery and children with normal hearing were enrolled into the study. Clinical data, high resolution computed tomography (HRCT) for ototemporal bone, conventional brain MRI for structural analysis and brain resting-state fMRI (rs-fMRI) for the power spectrum assessment were assessed. A nomogram combining both clinical and imaging data was constructed using multivariate logistic regression analysis. Model performance was evaluated and validated using bootstrap resampling. Results: The final cohort consisted of 72 children with CSNHL (41 children with poor outcome and 31 children with good outcome) and 32 healthy controls. The white matter lesion from structural assessment and six power spectrum parameters from rs-fMRI, including Power4, Power13, Power14, Power19, Power23 and Power25 were used to build the nomogram. The area under the receiver operating characteristic (ROC) curve of the nomogram obtained using the bootstrapping method was 0.812 (95 % CI = 0.772-0.836). The calibration curve showed no statistical difference between the predicted value and the actual value, indicating a robust performance of the nomogram. The clinical decision analysis curve showed a high clinical value of this model. Conclusions: The nomogram constructed with clinical data, and neuroimaging features encompassing ototemporal bone measurements, white matter lesion values from structural brain MRI and power spectrum data from rs-fMRI showed a robust performance in predicting outcome of hearing rehabilitation in children with CSNHL after CI.
RESUMEN
Cross-coupling reactions represent an indispensable tool in chemical synthesis. An intriguing challenge in this field is to achieve selective cross-coupling between two precursors with similar reactivity or, to the limit, the identical molecules. Here we report an unexpected dehydrobrominative cross-coupling between 1,3,5-tris(2-bromophenyl)benzene molecules on silver surfaces. Using scanning tunneling microscopy, we examine the reaction process at the single-molecular level, quantify the selectivity of the dehydrobrominative cross-coupling, and reveal the modulation of selectivity by substrate lattice-related catalytic activity or molecular assembly effect. Theoretical calculations indicate that the dehydrobrominative cross-coupling proceeds via regioselective C-H bond activation of debrominated TBPB and subsequent highly selective C-C coupling of the radical-based intermediates. The reaction kinetics plays an important role in the selectivity for the cross-coupling. This work not only expands the toolbox for chemical synthesis but also provides important mechanistic insights into the selectivity of coupling reactions on the surface.
RESUMEN
Herbivorous insects have evolved metabolic strategies to survive the challenges posed by plant secondary metabolites (SMs). This study reports an exploration of SMs present in pears, which serve as a defense against invasive Cydia pomonella and native Grapholita molesta and their counter-defense response. The feeding preferences of fruit borers are influenced by the softening of two pear varieties as they ripen. The content of SMs, such as quercetin and rutin, increases due to feeding by fruit borers. Notably, quercetin levels only increase after C. pomonella feeding. The consumption of SMs affects the growth of fruit borer population differently, potentially due to the activation of P450 genes by SMs. These two fruit borers are equipped with specific P450 enzymes that specialize in metabolizing quercetin and rutin, enabling them to adapt to these SMs in their host fruits. These findings provide valuable insights into the coevolution of plants and herbivorous insects.
RESUMEN
PURPOSE: Primary central nervous system post-transplantation lymphoproliferative disorder (PCNS-PTLD) is a rare but serious complication of hematopoietic stem cell transplantation (HSCT) in patients with severe ß-thalassemia. This study aimed to assess the clinical presentation, pathological characteristics, neuroimaging findings, and treatment strategies in patients with ß-thalassemia who developed PCNS-PTLD and to compare a case series from our transplant center to reported cases from literature. METHODS: We retrospectively reviewed our hospital database and identified four cases of pathologically confirmed PCNS-PTLD without a history of systemic PTLD in patients with severe ß-thalassemia after HSCT. We also performed a relevant literature review on PCNS-PTLD. RESULTS: The median time from transplantation to diagnosis of PCNS-PTLD was 5.5 months. Intracerebral lesions were usually multiple involving both supratentorial and infratentorial regions with homogeneous or rim enhancement. All patients had pathologically confirmed PCNS-PTLD with three patients having diffuse large B-cell lymphoma and the fourth patient having plasmacytic hyperplasia. There was low response to treatment with a median survival of 83 days. CONCLUSION: PCNS-PTLD should be considered in the differential diagnosis of patients with ß-thalassemia who had an intracranial lesion on neuroimaging after HSCT. CRITICAL RELEVANCE STATEMENT: This case series with a comprehensive review of neuroimaging and clinical characteristics of children with primary central nervous system post-transplantation lymphoproliferative disorder should advance our understanding and improve management of this rare yet severe complication following transplant for ß-thalassemia. KEY POINTS: ⢠We assessed clinical presentation, treatment strategies, and neuroimaging characteristics of PCNS-PTLD in patients with ß-thalassemia after transplantation. ⢠Patients with ß-thalassemia may have post-transplantation lymphoproliferative disorder presenting as brain lesions on neuroimaging. ⢠Neuroimaging findings of the brain lesions are helpful for prompt diagnosis and proper management.
RESUMEN
TANK-binding kinase 1 (TBK1) is a serine/threonine protein that plays a crucial role in various biological processes like immunity, autophagy, cell survival, and proliferation. The level and kinase activity of the TBK1 protein is regulated through post-translational modifications (PTMs). TBK1 mainly mediates the activation of IRF3/7 and NF-κB signaling pathways while also participating in the regulation of cellular activities such as autophagy, mitochondrial metabolism, and cell proliferation. TBK1 regulates immune, metabolic, inflammatory, and tumor occurrence and development within the body through these cellular activities. TBK1 kinase has emerged as a promising therapeutic target for tumor immunity. However, its molecular mechanism of action remains largely unknown. The identification of selective TBK1 small molecule inhibitors can serve as valuable tools for investigating the biological function of TBK1 protein and also as potential drug candidates for tumor immunotherapy. The current research progress indicates that some TBK1 inhibitors (compounds 15,16 and 21) exhibit certain antitumor effects in vitro culture systems. Here, we summarize the mechanism of action of TBK1 in tumors in recent years and the progress of small molecule inhibitors of TBK1.
Asunto(s)
Antineoplásicos , Neoplasias , Inhibidores de Proteínas Quinasas , Proteínas Serina-Treonina Quinasas , Humanos , Proteínas Serina-Treonina Quinasas/antagonistas & inhibidores , Proteínas Serina-Treonina Quinasas/metabolismo , Neoplasias/tratamiento farmacológico , Neoplasias/metabolismo , Neoplasias/patología , Inhibidores de Proteínas Quinasas/farmacología , Inhibidores de Proteínas Quinasas/química , Inhibidores de Proteínas Quinasas/uso terapéutico , Antineoplásicos/farmacología , Antineoplásicos/química , Antineoplásicos/uso terapéutico , Animales , Terapia Molecular DirigidaRESUMEN
BACKGROUND: The sterile insect technique (SIT) has proven to be an effective approach in managing the population of major invasive pests. Our previous studies showed that irradiation of Cydia pomonella males at a dosage of 366 Gy X-rays resulted in complete sterility. However, the mating competitiveness of sterilized males is significantly compromised, which can be attributed to a decline in their ability to fly. RESULTS: In this study, we examined the flight patterns of both male and female adults of C. pomonella. The results revealed significant variations in the average flight speed of both genders at different stages of maturity, with females displaying longer flight duration and covering greater distances. Effect of irradiation on the flight performance of 3-day-old male moths was further evaluated, as they demonstrated the longest flight distance. The findings indicated a significant decrease in flight distance, duration, and average speed, due to wing deformities caused by irradiation, which also limited the dispersal distance of moths in orchards, as indicated by the mark-and-recapture assay. Reverse-transcription quantitative polymerase chain reaction analysis revealed a down-regulation of flight-related genes such as Flightin, myosin heavy chain, and Distal-less following radiation exposure. CONCLUSION: These findings demonstrate that X-ray irradiation at a radiation dose of 366 Gy has a detrimental effect on the flight ability of male C. pomonella adults. These insights not only contribute to a better understanding of how radiation sterilization diminishes the mating competitiveness of male moths, but also aid in the development and improvement of SIT practices for the effective control of C. pomonella. © 2023 Society of Chemical Industry.
Asunto(s)
Infertilidad , Mariposas Nocturnas , Animales , Femenino , Masculino , Rayos XRESUMEN
The advantageous characteristics of invasive pests, particularly their ability to reproduce and adapt to the environment, have been observed. However, it remains unclear what specific inherent superiority enables fruit pests to successfully invade and dominate in interactions with other species. In this study, we report that Cydia pomonella (Linnaeus), a notorious invasive pest of pome fruits and walnuts globally, employs unique reproductive strategies in response to quercetin, a plant compound in host fruits. By monitoring adult dynamics and fruit infestation rates, we observed a competitive relationship between C. pomonella and the native species Grapholita molesta (Busck). C. pomonella was able to occupy vacant niches to ensure its population growth. We also found that quercetin had different effects on the reproductive capacity and population growth of C. pomonella and G. molesta. While quercetin stimulated the fecundity and population growth of G. molesta, it inhibited C. pomonella. However, C. pomonella was able to rapidly increase its population after exposure to quercetin by adopting an 'accelerated burst' of oviposition strategy, with each individual making a greater reproductive contribution compared to the control. We further demonstrated that the effect of quercetin on oviposition is regulated by the juvenile hormone (JH) signaling pathway in C. pomonella, allowing it to prioritize survival. The enhanced reproductive fitness of G. molesta in response to quercetin is attributed to the regulation of JH titers and key genes such as Met and Kr-h1, which in turn up-regulate reproduction-related genes Vg and VgR. In contrast, C. pomonella is inhibited. These findings shed light on the mechanisms interspecific competition and help to improve our understanding of the global spread of C. pomonella, which can be attributed to its inherent superiority in terms of reproductive strategy.
Asunto(s)
Mariposas Nocturnas , Animales , Femenino , Quercetina/farmacología , Hormonas Juveniles/farmacología , Oviposición , Frutas , Transducción de SeñalRESUMEN
While previous studies have reported G protein-coupled receptor (GPCR)-mediated insecticide resistance in various arthropods, the understanding of GPCR-associated resistance mechanisms in Cydia pomonella remains limited. In this study, a total of 95 CpGPCR genes categorized into four families were identified in C. pomonella. Results revealed high expression levels of the majority of the CpGPCRs during the first larval stage and in the head of C. pomonella. Exposure to lambda-cyhalothrin significantly increased the expression of 15 CpGPCRs, including CpGPCR70, which is highly expressed in all larval stages and shows the highest expression in the midgut. RNA interference (RNAi) demonstrated that downregulation of CpGPCR70 leads to reduced expression of key resistance-related genes and a decreased tolerance of larvae to lambda-cyhalothrin. These findings indicate that CpGPCR70 plays a crucial role in regulating the expression of detoxifying genes involved in lambda-cyhalothrin resistance, offering valuable insights for the development of more effective pest control strategies.
Asunto(s)
Insecticidas , Mariposas Nocturnas , Piretrinas , Humanos , Animales , Piretrinas/farmacología , Piretrinas/metabolismo , Mariposas Nocturnas/metabolismo , Nitrilos/farmacología , Nitrilos/metabolismo , Larva , Insecticidas/farmacología , Insecticidas/metabolismoRESUMEN
There is growing epidemiologic evidence of an inverse association between cancer and AD. In addition, both cell survival and death are regulated by the same signaling pathways, and their abnormal regulation may be implicated in the occurrence and development of cancer and AD. Research shows that there may be a common molecular mechanism between cancer and AD. This review will discuss the role of GSK3, DAPK1, PP2A, P53 and CB2R in the pathogenesis of cancer and AD and describe the current research status of drug development based on these targets.
RESUMEN
Tomato (Solanum lycopersicum L.) is an important fruit and vegetable crop with high economic value due to its rich vitamins (Friedman. 2002). Over the past five years, due to tomato brown rugose fruit virus (ToBRFV) infection, the tomato production in many countries and regions in Asia, America and Europe have experienced declines in yield and quality (Salem et al. 2023). ToBRFV is a positive-sense single-stranded RNA virus of the genus Tobamovirus in the family Virgaviridae (Salem et al. 2016). In the field, ToBRFV mainly infects solanaceous crops, including tomato and pepper (Zhang et al. 2022). Symptoms on ToBRFV-infected tomato plants mainly include foliar mottle, vein necrosis, and brown mottled rugose fruit (Alfaro-Fernández et al. 2020, Hamborg et al. 2022, Ma et al. 2021). In April 2023, about 150 tomato plants showing leaf curl, brown patch, and rugose surface on fruits were found in a greenhouse grown with about 500 tomato plants in Huludao City, Liaoning province, China. Two leaves and eight fruits from each of 10 symptomatic tomato plants were sampled and subjected to dot enzyme-linked immunosorbent assay (Dot-ELISA) with an antibody against ToBRFV (LV BAO, Chengdu, China); and all samples tested positive. Sap inoculations were prepared from 0.1 g of ToBRFV-positive tomato leaves via homogenization with 0.01 mol·L-1 PBS (phosphate buffered saline, pH 7.2), which were then inoculated mechanically onto 10 tomato cv. Moneymaker and 10 Nicotiana benthamiana plants at four- to six-leaf stage, respectively. At 10 days post inoculation (dpi), the leaf curl symptoms of all tomato plants were shown, which were consistent with those on greenhouse-infected plants. At 5 dpi, the upper leaves of all N. benthamiana plants showed yellowing and curling symptoms. The results of Dot-ELISA assays revealed that these mechanically inoculated plants were positive for ToBRFV. Total RNAs of inoculated and greenhouse-collected samples were extracted using TRIzolTM reagent and analyzed by reverse-transcription (RT)-PCR with specific primers ToBRFV-FD (5' GTCCCGATGTCTGTAAGGCTTGC) and ToBRFV-RD (5' GCAGGTGCAGAGGACCATTGTAA) for ToBRFV detection, respectively. The results showed that a 680-bp fragment was obtained in all tested samples. Then, primers ToBRFV-F1 (5' GTGTATTTTTTACAACATATACC) and ToBRFV-R1 (5' AACCATTGACTCAGAACTC), ToBRFV-F2 (5' TAGCCAAGAATCACGCATG) and ToBRFV-R2 (5' AGCAGCAATAATCACCGTA), ToBRFV-F3 (GAAAGAGTGGGGACGTTACAACATTCATCGGTAAT) and ToBRFV-R3 (TGGGCCCCTACCGGGGGTTCCGGGGGAATTCGAAT) were used to amplify the full-length sequence of ToBRFV using field-collected samples. The methods of primer design are shown in supplemental file 1. The sequence obtained by Sanger sequencing showed 99.86% nucleotide (nt) identity with ToBRFV-SD isolate (accession no. MT018320.1) from Shandong province, China. The full-length sequence of ToBRFV was uploaded to GenBank database with the accession number OR437354. To our knowledge, this is the first report of ToBRFV infecting tomato in Northeast China.
RESUMEN
BACKGROUND: The use of radiation therapy (RT) in hepatocellular carcinoma (HCC) remains a matter for debate. Recently published research indicate that advanced RT techniques may improve survival in patients with HCC. This study aimed to evaluate this hypothesis in a large-scale retrospective cohort. The effect of alpha-fetoprotein (AFP) was taken into account because of its important role in the prognosis of HCC. METHODS: The Surveillance, Epidemiology, and End Results (SEER) database was queried for adults patients diagnosed 2010-2019 with HCC (≥ 18 years). The study population was divided into four groups: Non-radiation & AFP-positive (reference), Non-radiation & AF-negative, Radiation & AFP-positive, Radiation & AFP-negative. Distant metastasis (DM) was used as a stratification factor. Differences in 5-year overall survival (OS) of the four groups were assessed using the Kaplan-Meier method. Univariate and multivariable Cox proportional hazards model were used to estimate unadjusted and adjusted hazard ratios (HR). RESULTS: A total of 34,656 patients were eligible for this analysis, including 21,084 (60.8%), 8,449 (24.4%), 3,810 (11.0%) and 1,313 (3.8%) in the Non-radiation & AFP-positive, Non-radiation & AF-negative, Radiation & AFP-positive and Radiation & AFP-negative groups, respectively. Median OSs of the four groups were 3, 4, 5 and 11 months in the DM cohort, and 12, 28, 15, and 28 months in the Non-DM cohort. Patients in the Radiation & AFP - group had the best OS and patients in the Non-radiation & AFP + group had the worst OS (adjusted HR [95% confidence interval (CI)]: 0.497 [0.399-0.619] in the DM cohort, and 0.405 [0.372-0.441] in the Non-DM cohort). Radiation & AFP + also showed improved survival compared with the reference group (adjusted HR [95%CI]: 0.725 [0.657-0.801] in the DM cohort, and 0.630 [0.600-0.661] in the Non-DM cohort). CONCLUSIONS: This population-based cohort study confirmed a significant improvement in overall survival with radiation therapy in HCC. AFP-negative patients benefit the most from RT. Superior OS of radiation therapy and AFP-negative status persisted even in patients with complex metastasis patterns. Our data suggest that radiation may provide an alternative modality for unresectable HCC.
RESUMEN
The codling moth, Cydia pomonella (L.), is an invasive agricultural pest of pome fruits and walnuts in China that threatens the apple industry in the Loess Plateau and Bohai Bay; it has developed resistance to many insecticides. Sterile insect technique (SIT) combined with area-wide integrated pest management (AW-IPM) can reduce the risk of resistance to insecticides and effectively control some insect pest species. Our previous laboratory experiment found that irradiation with 366 Gy of X-ray caused the males of the codling moth to become sterile. However, the sterility and adaptability of males after being irradiated with 366 Gy X-ray in the field are still unclear. In this study, we investigated the effect of X-ray irradiation on the fitness of male adults that emerged from pupae irradiated with 366 Gy to explore their adaptability and mating competitiveness, and to examine the effect of releasing sterile male insects in orchards in northeast China on the fruit infestation rate of the Nanguo pear. The results showed that 366 Gy of X-ray irradiation significantly reduced the mating competitiveness of males and the hatching rate of the eggs laid by females pairing with sterile males. Meanwhile, the lifespan of the sterile male moths was significantly shorter than that of the normal ones in the field. A pilot test showed that the release twice of sterile male moths in the orchards had no significant effect on the fruit infestation rate. Our field experiments provide a scientific basis for the further optimization of the SIT technology program for controlling C. pomonella.
RESUMEN
Aryl hydrocarbon receptor (AhR) enhances insect resistance to insecticides by regulating the detoxification network. Our previous studies have confirmed that overexpressions of cytochrome P450 monooxygenases (P450s) and glutathione S-transferases (GSTs) are involved in lambda-cyhalothrin resistance in Cydia pomonella. Here, we report that CpAhR regulates the expression of GST and P450 genes, thus conferring resistance. Expression patterns indicated that the expression of CpAhR was highly induced by lambda-cyhalothrin exposure and upregulated in a lambda-cyhalothrin-resistant population. RNA interference (RNAi) of CpAhR decreases the expression of key resistance-related genes (CpGSTe3, CpCYP9A121, and CpCYP9A122) and the activity of the GST enzyme, reducing the tolerance to lambda-cyhalothrin. Furthermore, ß-naphthoflavone, a novel agonist of AhR, was first proven to be effective in increasing CpAhR expression and larval tolerance to lambda-cyhalothrin. These results demonstrate that CpAhR regulates the expression of key detoxifying genes and GST activity, resulting in the development of resistance to lambda-cyhalothrin in C. pomonella.
Asunto(s)
Insecticidas , Mariposas Nocturnas , Piretrinas , Animales , Receptores de Hidrocarburo de Aril/genética , Piretrinas/farmacología , Piretrinas/metabolismo , Insecticidas/farmacología , Insecticidas/metabolismo , Mariposas Nocturnas/metabolismo , Nitrilos/farmacología , Nitrilos/metabolismo , Transferasas , Glutatión , Resistencia a los Insecticidas/genéticaRESUMEN
The codling moth Cydia pomonella (Lepidoptera: Tortricidae) is a major invasive pest of pome fruits and walnuts worldwide. Lambda-cyhalothrin (LCT) and abamectin (AM) have been frequently used in C. pomonella control, but control of this pest is very difficult because shortly after hatching, larvae of this insect bore tunnels and hide inside host plant fruit. In this study, a simulated field spray bioassay method was developed against neonate larvae of C. pomonella and concentration-response bioassays were conducted to evaluate the susceptibility of the neonate larvae to LCT and AM. Exposure of neonate larvae to sublethal concentration (LC30) of LCT or AM significantly reduced the survival rate of larvae (4th and 5th instars), lowered the mean weight of larvae and pupae, and decreased the daily maximal number of eggs laid and the total number of eggs laid (fecundity) per female. The sublethal effects, including reduced body mass, mean fecundity and net reproductive rate, extended mean generation time, and shortened oviposition period, were also found in transgenerational offspring. Furthermore, the transgenerational maternal effects were more obvious for AM than LCT, in comparison to the control. Additionally, the estimated population size was decreased by exposure to LC30 of LCT and AM, and the observed reduction of fecundity and population size within and across generations was likely the result of the downregulation of the reproduction-related vitellogenin gene (CpVg) after exposure to LC30 of LCT and AM. These results provide a better understanding of the overall effects of LCT and AM on C. pomonella and the transgenerational effects which should be taken into consideration when using insecticides in order to control C. pomonella.
Asunto(s)
Insecticidas , Mariposas Nocturnas , Piretrinas , Animales , Femenino , Piretrinas/toxicidad , Larva , Insecticidas/toxicidad , ReproducciónRESUMEN
Background: Spleen deficiency diarrhea (SDD) is a common Traditional Chinese Medicine (TCM) gastrointestinal condition, the causes of which include dysfunction of the intestinal barrier and microbiota. Rice water-fried Atractylodis Rhizoma (RAR) is a commonly used drug to treat this condition, but its mechanism remains unclear. This study explored the related mechanisms of ethanolic extract of rice water-fried Atractylodis Rhizoma (EAR) in the treatment of SDD by examining changes in the intestinal microbiota. Method: Wistar rats were randomly divided into 4 groups including the control, model, EAR low, and high-dose groups, 6 rats in each group. All rats, except the control group, were induced to develop SDD by a bitter-cold purgation method with rhubarb. The therapeutic effect of EAR on SDD was evaluated by pathological sections, inflammatory indicators (TNF-α, IL-1ß, and IL-10), gastrointestinal-related indicators (GAS, DAO, D-lactate, VIP, and SIgA), and intestinal flora (bacteria and fungi) analysis. Results: The results showed that the developed SDD rat model (model group) showed weight loss, decreased food intake, and increased fecal moisture content. Compared with those of the control group, the levels of TNF-α, IL-1ß, DAO, D-lactate, and VIP in the model group were significantly increased, but the levels of IL-10, GAS and SIgA were significantly decreased (p < 0.05). However, the indicators were significantly improved after EAR treatment, indicating that EAR maintained the balance of pro- and anti-inflammatory cytokines and reduced gastric emptying, thereby protecting intestinal barrier function, alleviating intestinal mucosal injury, and relieving SDD by regulating the release of neurotransmitters. EAR was also shown to prevent infection by promoting the accumulation of noninflammatory immunoglobulin SIgA and improving intestinal mucosal immunity to inhibit the adhesion of bacteria, viruses, and other pathogens. Intestinal microbiome analysis showed that the intestinal bacteria and fungi of SDD model rats changed greatly compared with the control group, resulting in intestinal microecological imbalance. The reversal in the composition of the flora after EAR treatment was mainly characterized by a large enrichment of beneficial bacteria represented by Lactobacillus and a decrease in the abundance of potentially pathogenic fungi represented by Aspergillus. Thus, it was speculated that EAR primarily functions to alleviate SDD by increasing the abundance of beneficial bacteria and reducing the abundance of potentially pathogenic fungi. Conclusion: The strong therapeutic effect of EAR on SDD suggests that it is a promising treatment for this condition.