RESUMEN
Studies of the domestic cat have contributed to many scientific advances, including the present understanding of the mammalian cerebral cortex. A practical capability for cat transgenesis is needed to realize the distinctive potential of research on this neurobehaviorally complex, accessible species for advancing human and feline health. For example, humans and cats are afflicted with pandemic AIDS lentiviruses that are susceptible to species-specific restriction factors. Here we introduced genes encoding such a factor, rhesus macaque TRIMCyp, and eGFP, into the cat germline. The method establishes gamete-targeted transgenesis for the first time in a carnivore. We observed uniformly transgenic outcomes, widespread expression, no mosaicism and no F1 silencing. TRIMCyp transgenic cat lymphocytes resisted feline immunodeficiency virus replication. This capability to experimentally manipulate the genome of an AIDS-susceptible species can be used to test the potential of restriction factors for HIV gene therapy and to build models of other infectious and noninfectious diseases.
Asunto(s)
Animales Modificados Genéticamente , Gatos/genética , Gatos/virología , Técnicas de Transferencia de Gen , Virus de la Inmunodeficiencia Felina/genética , Animales , Modelos Animales de Enfermedad , Femenino , Linfocitos/inmunología , Masculino , Replicación ViralRESUMEN
By combining RNAi technology with SCNT method, we attempted to produce transgenic calves with knocked down bPRNP for technological assessments. The respective utilities of type II (tRNA) and type III (hU6) Pol III promoters in mediating plasmid vector-based RNAi for the production of a bPRNP-knockdown calf were compared. Plasmid harboring DNA for siRNA expression was introduced stably into the genome of primary cultured bovine cells. By inserting the transgenic cell into an enucleated bovine egg, SCNT embryos were produced. The ability for SCNT embryos to develop to blastocysts was higher in hU6 based vector groups (44-53%) than in a tRNA group (32%). In all, 30 hU6-embryos and 12 tRNA-embryos were transferred to 11 recipients. Only tRNA-embryos were able to impregnate recipients (6 out of 11 transfers), resulting in four aborted fetuses, one stillbirth, and one live-born calf. The expression of EGFP, a marker, was detected in all six. The bPRNP transcript levels in the nervous tissues (brain, cerebellum, spinal bulb, and spinal cord) from the calf, which was killed 20 days after birth, were reduced to 35% of those of the control calf on average, as determined by qRT-PCR. The PrPC levels, as estimated by western blot were reduced to 86% on average in the nervous tissues. These findings suggest that SCNT technology remains immature, that the tRNA promoter is useful, and that RNAi can significantly reduce PRNP mRNA levels, but insufficient reduction of PrPC levels exists in cattle under these conditions.
Asunto(s)
Técnicas de Silenciamiento del Gen , Vectores Genéticos/genética , Técnicas de Transferencia Nuclear , Priones/genética , Regiones Promotoras Genéticas/genética , Interferencia de ARN , ARN de Transferencia/genética , Animales , Animales Modificados Genéticamente , Bovinos , Núcleo Celular/genética , Núcleo Celular/metabolismo , Plásmidos/genética , Priones/metabolismo , ARN Nuclear Pequeño/genética , ARN de Transferencia/metabolismoRESUMEN
BACKGROUND: Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. RESULTS: Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. CONCLUSION: Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.
Asunto(s)
Biotecnología/métodos , Marcación de Gen/métodos , Priones/genética , Interferencia de ARN/fisiología , Animales , Bovinos , Células HeLa , Humanos , Proteínas PriónicasRESUMEN
In this study the efficacy of the combination of glycerol (GLY) and ethylene glycol (EG) as cryoprotectants in a vitrification method developed for direct embryo transfer was evaluated by in vitro development of in vitro fertilized (IVF) and somatic cell nuclear transfer (SCNT) embryos after vitrification. The IVF and SCNT blastocysts were vitrified in either 40% GLY, 30% GLY + 10% EG, or 20% GLY + 20% EG using French straws. After warming, the straws were held vertically for 1 min without shaking and were then placed horizontally for 5 min to dilute the cryoprotectants. After washing, the vitrified-warmed embryos were cultured in vitro for 72 h. There were no differences among the vitrification solutions with respect to the rates of vitrified-warmed IVF and SCNT embryos surviving and developing to the hatched blastocyst stage. However, the rates of development to the hatched blastocyst stage of the SCNT embryos vitrified with 40% GLY tended to be higher than those vitrified with 30% GLY + 10% EG or 20% GLY + 20% EG (26% vs. 7-8%, respectively). The development rates to the hatched blastocyst stage of the IVF and SCNT embryos vitrified with solution containing EG were significantly lower (P<0.05) than those of non-vitrified embryos. These results suggest that use of the combination of GLY and EG as cryoprotectants had no beneficial effect on the viability of embryos after in-straw dilution. However, this method is so simple that it can be used for practical direct transfer of vitrified embryos in the field.
Asunto(s)
Bovinos , Clonación de Organismos/veterinaria , Criopreservación/métodos , Crioprotectores/farmacología , Glicol de Etileno/farmacología , Fertilización In Vitro/veterinaria , Glicerol/farmacología , Animales , Blastocisto , Femenino , Técnicas de Dilución del Indicador , TemperaturaRESUMEN
The present study was conducted to investigate effects of antioxidants during maturation culture of recipient oocytes and/or culture of gene-transfected donor cells on the meiotic competence of recipient oocytes, and the developmental competence and quality of the reconstructed embryos after nuclear transfer (NT) in cattle. Gene-transfected donor cells had negative effects on the proportions of blastocyst formation, total cell numbers, and DNA fragmentation indices of reconstructed embryos. Supplementation of either vitamin E (alpha-tocopherol: 100 microM) or vitamin C (ascorbic acid: 100 microM) during maturation culture significantly enhanced the cytoplasmic maturation of oocytes and subsequent development of embryos reconstructed with the oocytes and gene-transfected donor cells, but did not have synergistic effects. The supplementation of vitamin E during maturation culture of recipient oocytes increased the proportions of fusion and blastocyst formation of gene-transfected NT embryos, in which the proportions were similar to those of nontransfected NT embryos. When the gene-transfected donor cells that had been cultured with 0, 50, or 100 microM of vitamin E were transferred into recipient oocytes matured with vitamin E (100 microM), 50 microM of vitamin E increased the proportion of blastocyst formation and reduced the index of DNA fragmentation of blastocysts. In conclusion, gene-transfected donor cells have negatively influenced the NT outcome. Supplementation of vitamin E during both recipient oocyte maturation and donor cell culture enhanced the blastocyst formation and efficiently blocked DNA damage in transgenic NT embryos.
Asunto(s)
Ácido Ascórbico/farmacología , Bovinos/genética , Clonación de Organismos/métodos , Oocitos/efectos de los fármacos , Vitamina A/farmacología , Animales , Animales Modificados Genéticamente , Antioxidantes/farmacología , Células Cultivadas , Combinación de Medicamentos , Técnicas de Cultivo de Embriones/métodos , Femenino , Glutatión/análisis , Técnicas de Transferencia Nuclear , Oocitos/químicaRESUMEN
The present study was conducted to determine the effect of electric field strength on the rate of membrane fusion between the somatic cell and cytoplast and on subsequent in vitro development of reconstructed embryos. Additionally, the in vitro developmental competence of cat oocytes artificially activated after 44 h of maturation culture was examined. An efficient fusion rate (64.2%) was obtained by applying a single pulse of 1.5 kV/cm for 50 micros, and the fusion rate remained almost constant at the higher field intensity (59.8 and 54.9% at 1.7 and 2.0 kV/cm, respectively). Although the cleavage rate of fused embryos increased with an increase of the electric field strength, there were no differences among the groups with respect to the proportion of development to the morula and blastocyst stages. In the additional experiment, oocytes at the metaphase II stage after culture for 44 h were activated by the combination of calcium ionophore (CaI) with cycloheximide (CHX). Some (11.8%) of activated oocytes developed to the blastocyst stage. Results from this study indicated that electric field strength affects the rates of fusion and cleavage but has no significant effects on the development to the blastocyst stage of reconstructed embryos. Prolonged maturation culture of cat oocytes (up to 44 h) decreased their ability to develop to the blastocyst stage.
Asunto(s)
Gatos/embriología , Electricidad , Desarrollo Embrionario/fisiología , Técnicas de Transferencia Nuclear , Oocitos/fisiología , Animales , Blastocisto/fisiología , División Celular , Cicloheximida/farmacología , Técnicas de Cultivo de Embriones/métodos , Técnicas de Cultivo de Embriones/veterinaria , Desarrollo Embrionario/efectos de los fármacos , Femenino , Ionóforos/farmacología , Mórula/fisiología , Oocitos/citologíaRESUMEN
The aim of this study was to evaluate the effectiveness and toxicity of single and double application of the brilliant cresyl blue (BCB) test on the selection of porcine oocytes as an indirect measure of oocyte growth for in vitro fertilization (IVF) and nuclear transfer. In the first experiment, oocytes were exposed to BCB before and after maturation culture and classified according to their cytoplasmic coloration: blue coloration and colorless. The classified oocytes were fertilized with spermatozoa and then cultured for 7 days. The percentages of maturation to metaphase II in blue oocytes at the start of maturation culture were higher than those of colorless oocytes (68.7-70.1% versus 0.8-3.6%, P < 0.05). However, double application of BCB test before and after maturation culture had a toxic effect on fertilization and embryonic development. No significant differences in the blastocyst formation were found between blue oocytes without double application of BCB test and control oocytes without any application of BCB test, whereas the total cell number per blastocyst from the blue oocytes was higher than that from the control oocytes (48.0 versus 34.2, P < 0.05). In the second experiment, oocytes were exposed to the BCB test before or after maturation culture, and then the matured oocytes were activated to evaluate the ability of parthenogenetic development. The proportion of blastocyst formation of blue oocytes classified after maturation culture was lower than that of blue oocytes classified before maturation culture (10.0% versus 27.0%, P < 0.05). Therefore, double application of the BCB test before and after maturation culture impaired fertilization and embryonic development, whereas a single application before maturation culture was efficient to select oocytes for IVF and nuclear transfer.
Asunto(s)
Oocitos/efectos de los fármacos , Oocitos/fisiología , Oxazinas/toxicidad , Porcinos , Recolección de Tejidos y Órganos/veterinaria , Animales , Blastocisto/efectos de los fármacos , Blastocisto/fisiología , Colorantes/toxicidad , Relación Dosis-Respuesta a Droga , Femenino , Fertilización In Vitro/veterinaria , Maduración Sexual , Recolección de Tejidos y Órganos/métodosRESUMEN
The objective was to determine the effects of supplementing hexoses in oocyte maturation and embryo culture medium on in vitro maturation (IVM) and in vitro fertilization (IVF) of porcine oocytes and in vitro development of in vitro produced (IVP) porcine embryos. In the first experiment, oocytes were matured in vitro in modified North Carolina State University (NCSU)-37 medium, supplemented with hexoses (glucose, fructose or galactose) at various concentrations: 0 (control), 2.5, 5.5 and 10 mM. Supplementing the maturation medium with either glucose or fructose (5.5 mM) increased the percentages of oocytes that matured to metaphase II (79.4 and 70.2%, respectively), as compared with the control group (P < 0.05). However, supplementing galactose had no effects on meiotic maturation and fertilization. In the second experiment, cleaved embryos were collected 3 days after IVF of oocytes matured in the maturation medium supplemented with 5.5 mM of glucose; they were cultured for an additional 4 days in modified NCSU-37 medium, supplemented with 5.5mM of glucose, fructose or galactose. The incidence of blastocyst formation was higher (P < 0.05) in the glucose and fructose groups (18.6 and 18.2%, respectively) than in the galactose group and non-supplemented control group (12.9 and 9.2%). Moreover, fructose supplementation increased the total cell number/blastocyst (48.0 versus 37.6) and reduced the index of DNA-fragmented nucleus in the blastocysts (7.6% versus 11.8%), as compared with glucose supplementation (P < 0.05). In conclusion, fructose was a practical alternative to glucose for supporting IVM of porcine oocytes and fructose was superior to glucose for producing high-quality porcine embryos in vitro.
Asunto(s)
Técnicas de Cultivo/veterinaria , Desarrollo Embrionario/efectos de los fármacos , Hexosas/farmacología , Oocitos/efectos de los fármacos , Porcinos/fisiología , Animales , Medios de Cultivo , Técnicas de Cultivo/métodos , Femenino , Fertilización In Vitro/efectos de los fármacos , Fertilización In Vitro/veterinaria , Fructosa/farmacología , Galactosa/farmacología , Glucosa/farmacología , Masculino , Oocitos/crecimiento & desarrollo , Porcinos/embriologíaRESUMEN
The objectives of this study were to determine the effects of cycloheximide (CHX) and beta-mercaptoethanol (beta-ME) during storage of in vitro-produced (IVP) bovine blastocysts for 72 h at 4 degrees C on their survival, hatching capacity and DNA damage. In Experiment 1, when blastocysts were stored in a medium supplemented with 25, 50 or 100 microg/mL of CHX, or 25, 50 or 100 microM of beta-ME, the blastocysts stored with 25 microg/mL of CHX had a significantly higher survival rate than that of the blastocysts stored without CHX (79.5% versus 54.2%). In contrast, beta-ME had no apparent effects on the survival and hatching capacity of stored embryos. In Experiment 2, to investigate synergistic effects of CHX and beta-ME during storage of blastocysts on their developmental parameters and DNA damage, they were stored in the medium with CHX (25 microg/mL) and beta-ME (50 microM). The combination of CHX and beta-ME had no significant effects on the survival of blastocysts. The proportion (6.8%) of DNA-fragmented cells in the blastocysts stored with CHX was similar to that (5.4%) in the non-stored blastocysts (positive control) and significantly lower than that (9.7%) in the blastocysts stored without CHX and beta-ME (negative control). However, there were no significant differences among the proportions of dead cells of blastocysts in the storage groups. Therefore, the supplementation of CHX in the storage medium had a beneficial effect on the proportions of survival and DNA-fragmented cells in the stored embryos, whereas the beta-ME alone or in combination with CHX had no positive effects on either of these proportions.
Asunto(s)
Bovinos/embriología , Cicloheximida/administración & dosificación , Daño del ADN/efectos de los fármacos , Embrión de Mamíferos/efectos de los fármacos , Embrión de Mamíferos/fisiología , Mercaptoetanol/administración & dosificación , Animales , Blastocisto/fisiología , Fragmentación del ADN , Sinergismo Farmacológico , Embrión de Mamíferos/citología , Femenino , Etiquetado Corte-Fin in Situ , Temperatura , Conservación de Tejido/métodos , Conservación de Tejido/veterinariaRESUMEN
The ability to cryopreserve in vitro-produced feline embryos was investigated. To improve the survival rate of cryopreserved embryos, first the developmental ability of in vitro fertilized feline zygotes (after removal of intracellular lipids) was determined, followed by the post-thaw survival of cryopreserved blastocysts derived from delipidated zygotes. More than 67% of the delipidated zygotes cleaved and 36% of them developed to the morula stage. The developmental ability of delipidated zygotes to the blastocyst stage (26%) was similar to that of sham-operated (30.5%) or control embryos (31.3%). Although the survival rate of delipidated blastocysts (81.8%) after freezing and thawing tended to be higher than that of control embryos without delipidation (60.6%), rates were not significantly different between the both groups. In conclusion, in vitro-produced feline blastocysts were successfully frozen, removal of the cytoplasmic lipid content in feline zygotes did not impair their in vitro developmental competence (up to the blastocyst stage), and reduction of cytoplasmic lipids by aspiration had no apparent effects on the survival of in vitro-derived blastocysts after cryopreservation.
Asunto(s)
Blastocisto/fisiología , Gatos/embriología , Criopreservación/veterinaria , Lípidos/fisiología , Cigoto/fisiología , Animales , Células Cultivadas , Criopreservación/normas , Femenino , Fertilización In Vitro/veterinaria , Masculino , Mórula/citología , Técnicas de Cultivo de Órganos/veterinaria , Análisis de Supervivencia , Cigoto/química , Cigoto/crecimiento & desarrolloRESUMEN
It has been suggested that the maturational stage of oocytes at time of insemination influences the sex ratio of resulting embryos. However, there are very few reports concerning the relationship between the maturation culture period of oocytes and the sex ratio of resulting embryos. The objective of this study was to investigate the effects of in vitro maturation culture period for bovine oocytes on the sex ratio of in vitro produced blastocysts using a novel technique of loop-mediated isothermal amplification (LAMP). Cumulus-oocyte complexes were collected from the ovaries of slaughtered cows, and then matured in vitro for various periods (16, 22, 28, and 34 h). After maturation culture for each period, the oocytes were inseminated with frozen-thawed spermatozoa, and then cultured in vitro. Blastocysts were harvested on Day 7 after insemination, and the sex of the embryos was examined using the LAMP method. The rates of oocytes matured to the metaphase II stage were significantly lower (P < 0.05) in the 16-h maturation group than in the other groups. The proportion of blastocyst formation after insemination was significantly higher (P < 0.05) in the 22-h maturation group than in the other groups. The proportion of male blastocysts increased with the increase in maturation culture period. The proportion of male blastocysts derived from oocytes matured for 34 h was significantly higher (P < 0.05) than from oocytes matured for 16 and 22 h. These results indicate that the sex ratio of in vitro fertilized embryos is apparently influenced by the maturation culture period of the oocytes.
Asunto(s)
Técnicas de Cultivo de Embriones/veterinaria , Oocitos/crecimiento & desarrollo , Razón de Masculinidad , Animales , Bovinos , Técnicas de Cultivo de Embriones/métodos , Embrión de Mamíferos , Fertilización In Vitro/veterinaria , Análisis para Determinación del Sexo/métodos , Análisis para Determinación del Sexo/veterinaria , Factores de TiempoRESUMEN
This study was conducted to improve parthenogenetic development in vitro of feline oocytes following a combined activation treatment of electrical stimulation and cycloheximide. In vitro matured (IVM) oocytes were stimulated electrically by a DC electrical pulse of 2 kV/cm for 50 micros. The stimulated oocytes were then incubated in MK-1 medium with or without cycloheximide and subsequently cultured in vitro for 6 days. No significant differences were observed between the two groups with respect to the proportions of cleavage, development to the morula stage, and the cell number of blastocysts. However, exposure of electrically stimulated oocytes to cycloheximide significantly increased the rate of development of the stimulated oocytes into the blastocyst stage compared with oocytes stimulated by electrical stimulation alone (31.0% vs 6.7%). The results from the present study suggested that a single electrical stimulation was insufficient to activate the IVM cat oocytes at 24 h of maturation and that exposure to cycloheximide following electrical stimulation improved the efficacy of the parthenogenetic development of domestic cat oocytes.
Asunto(s)
Cicloheximida/farmacología , Oocitos/efectos de los fármacos , Oocitos/fisiología , Partenogénesis/efectos de los fármacos , Inhibidores de la Síntesis de la Proteína/farmacología , Animales , Blastocisto/citología , Gatos , Células Cultivadas , Estimulación Eléctrica , Femenino , Técnicas In Vitro , Técnicas de Transferencia Nuclear , Oocitos/citología , Partenogénesis/fisiologíaRESUMEN
Interspecies nuclear transfer (NT) could be an alternative to replicate animals when supply of recipient oocytes is limited or in vitro embryo production systems are incomplete. In the present study, embryonic development was assessed following interspecies NT of donor cumulus cells derived from yak and dog into the recipient ooplasm of domestic cow. The percentages of fusion and subsequent embryo development to the eight-cell stage of interspecies NT embryos were comparable to those of intraspecies NT embryos (cow-cow NT embryos). The percentage of development to blastocysts was significantly lower (p < 0.05) in yak-cow NT embryos than that in cow-cow NT embryos (10.9% vs. 39.8%). In dog-cow NT embryos, only one embryo (0.4%) developed to the blastocyst stage. These results indicate that interspecies NT embryos possess equally developmental competence to the eight-cell stage as intraspecies NT embryos, but the development to blastocysts is very low when dog somatic cells are used as the donor nuclei.
Asunto(s)
Clonación de Organismos , Embrión de Mamíferos , Animales , Bovinos , Perros , Especificidad de la EspecieRESUMEN
The present study was conducted to investigate the effects of storage time and temperature of porcine ovaries on the quality and nuclear maturation in vitro of oocytes obtained from stored ovaries and their subsequent development after in vitro fertilization. The ovaries were stored in physiological saline for 0, 3, 6, 9 and 12 h at various temperatures (4, 15, 25 and 35 C). The pH of follicular fluid obtained from the ovaries, DNA fragmentation of the oocyte nucleus and meiotic competence of oocytes were examined. Some oocytes from ovaries stored at 15, 25 and 35 C for 6 h were fertilized in vitro, and then cultured for 7 days to examine the ability of embryos to develop to the blastocyst stage. When the ovaries were stored at 35 C, the pH of follicular fluid decreased and the proportions of oocytes with DNA fragmented nuclei increased as the storage time was prolonged, and the storage of ovaries for 6, 9 and 12 h resulted in lower maturation rates of oocytes. When the ovaries were stored at 4, 15, 25 and 35 C for 6 h, the storage at higher temperatures (> or =15 C) decreased the pH of follicular fluid and induced nucleic DNA fragmentation in higher proportions of oocytes. None of the oocytes from ovaries stored at 4 C reached metaphase II. The storage of ovaries at 15 C reduced the rates of in vitro fertilized oocytes and subsequent embryo development, but there were no significant differences in the rates of fertilization and blastocyst formation between oocytes from ovaries stored at 25 C and 35 C. Our findings indicate that the storage of ovaries at 25-35 C for 6 h is effective for maintaining the developmental competence of porcine oocytes even though the development rates were lower than those of ovaries stored at 35 C for 3 h.
Asunto(s)
Técnicas de Cultivo , Fragmentación del ADN , Oocitos/metabolismo , Ovario/metabolismo , Manejo de Especímenes/métodos , Animales , Blastocisto/metabolismo , Núcleo Celular/metabolismo , Daño del ADN , Desarrollo Embrionario , Femenino , Fertilización In Vitro , Concentración de Iones de Hidrógeno , Etiquetado Corte-Fin in Situ , Masculino , Folículo Ovárico/metabolismo , Ovario/patología , Espermatozoides/metabolismo , Porcinos , Temperatura , Factores de TiempoRESUMEN
The present study was conducted to examine the effect of oxygen tension during in vitro culture (IVC) of porcine oocytes/embryos on their development and quality using two different culture systems. Porcine cumulus oocyte complexes (COCs) were matured (IVM) and fertilized (IVF) in vitro, and subsequently cultured for 6 days in a simple and economical portable incubator or a standard CO(2) incubator. While the same temperature (38.5 degrees C) and CO(2) concentration (5%) were used in the both systems, the portable incubator was operated in a negative air pressure (- 300 mmHg) to create an O(2) level at 8-10% (low O(2) concentration), or in a positive air pressure (high O(2) concentration). To compare the two culture systems, IVM and IVF of COCs and subsequent IVC of in vitro produced (IVP) embryos were carried out in the portable incubator with a low O(2) concentration (Group I) or in the standard incubator with a high O(2) concentration (Group II). To assess the effect of O(2) concentration on IVC of IVP embryos, some oocytes that had been cultured in the standard incubator for IVM and IVF were subsequently cultured in the portable incubator with a low O(2) concentration (Group III) or a high O(2) concentration (Group IV). The occurrence of DNA fragmentation in the blastocysts produced under different culture conditions was examined by TUNEL staining to assess embryo quality. The rates of oocytes that reached MII and were penetrated by spermatozoa following IVF did not differ between the two incubation systems. In contrast, the proportions of development to blastocysts and the mean cell number of blastocysts in Group I were higher than those in Group II and Group IV. The index of DNA-fragmented nucleus in the blastocysts of Group I was significantly lower than that in the blastocysts of Group II. Therefore, low oxygen tension during IVM, IVF and IVC enhanced the subsequent development of IVP embryos to the blastocyst stage and improved their quality.
Asunto(s)
Embrión de Mamíferos/fisiología , Desarrollo Embrionario , Fertilización In Vitro/veterinaria , Oxígeno/administración & dosificación , Porcinos/embriología , Animales , Blastocisto/química , Blastocisto/fisiología , Fragmentación del ADN , Femenino , Etiquetado Corte-Fin in Situ , Técnicas de Cultivo de Tejidos/instrumentaciónRESUMEN
The present study was conducted to investigate the effects of the attachment of cumulus cells to oocytes and coculture with cumulus cells during maturation culture on the nuclear status and DNA fragmentation of porcine denuded oocytes (DOs). In the first experiment, cumulus cells were removed from cumulus-oocyte complexes (COCs) at 0, 8, 16, 24 or 32 h after the onset of maturation culture and the DOs were then cultured in their original droplets until 42 h of culture was reached. In the second experiment, all COCs were denuded before the onset of culture and the DOs were cocultured with their removed cumulus cells. The DOs were transferred into fresh medium at 0, 8, 16, 24 or 32 h after the onset of coculture with cumulus cells and then cultured until 42 h of culture was reached. After culture, DNA fragmentation and the nuclear status of oocytes were examined using the terminal deoxyribonucleotidyl transferase-mediated dUTP-digoxigenin nick end-labelling (TUNEL) method. When the DOs were returned to the same droplets after removal of the cumulus cells, the removal of the cumulus cells after 16 h of culture significantly decreased the proportion of oocytes remaining at the germinal vesicle (GV) stage. However, coculture treatment of DOs in the presence of their removed cumulus cells had no significant effects on the GV breakdown (GVBD) of oocytes. There were no significant differences in the proportion maturing to MII oocytes among the groups following removal of cumulus cells after the onset of maturation culture; however, DOs cocultured with cumulus cells until the end of maturation culture exhibited an increased maturation rate compared with DOs cocultured for 8 and 16 h. The total proportion of TUNEL-positive oocytes of oocytes remaining at the GV stage was higher than that of oocytes reaching other stages, irrespective of the removal of cumulus cells and coculture treatments. However, coculture for more than 16 h decreased the total proportion of TUNEL-positive oocytes. Our results indicate that the attachment of cumulus cells to oocytes may have a critical role for oocytes undergoing GVBD and that coculture with cumulus cells promotes the ability of oocytes to complete maturation. Moreover, coculture with cumulus cells may assist the oocyte to avoid undergoing DNA fragmentation.