RESUMEN

This report describes the occurrence of the rabies virus in two species of wild animals in the urban area of Montes Claros (MOC), Minas Gerais State, Brazil, in May 2023. The virus has been detected in frugivorous chiropterans (Artibeus sp) and marmosets (Callithrix penicillata). This is the first notified case of the rabies virus in the species C. penicillata in the urban area of MOC. Our findings show that the rabies virus is circulating in the urban area of MOC; therefore, permanent preventive measures must be adopted to avoid infection of other animals and humans.

Asunto(s)

RESUMEN

INTRODUCTION: Chagas disease is a severe parasitic illness that is prevalent in Latin America and often goes unaddressed. Early detection and treatment are critical in preventing the progression of the illness and its associated life-threatening complications. In recent years, machine learning algorithms have emerged as powerful tools for disease prediction and diagnosis. METHODS: In this study, we developed machine learning algorithms to predict the risk of Chagas disease based on five general factors: age, gender, history of living in a mud or wooden house, history of being bitten by a triatomine bug, and family history of Chagas disease. We analyzed data from the Retrovirus Epidemiology Donor Study (REDS) to train five popular machine learning algorithms. The sample comprised 2,006 patients, divided into 75% for training and 25% for testing algorithm performance. We evaluated the model performance using precision, recall, and AUC-ROC metrics. RESULTS: The Adaboost algorithm yielded an AUC-ROC of 0.772, a precision of 0.199, and a recall of 0.612. We simulated the decision boundary using various thresholds and observed that in this dataset a threshold of 0.45 resulted in a 100% recall. This finding suggests that employing such a threshold could potentially save 22.5% of the cost associated with mass testing of Chagas disease. CONCLUSION: Our findings highlight the potential of applying machine learning to improve the sensitivity and effectiveness of Chagas disease diagnosis and prevention. Furthermore, we emphasize the importance of integrating socio-demographic and environmental factors into neglected disease prediction models to enhance their performance.

Asunto(s)

RESUMEN

Triatomines are the vectors of Trypanosoma cruzi, the etiological agent of Chagas disease. The study aimed to evaluate the association between sociodemographic and environmental factors, and changes in land use and cover, with the occurrence and abundance of triatomines by census sectors in an endemic municipality of northern Minas Gerais, Brazil. The study was conducted in Montes Claros, located in the north of Minas Gerais, Brazil. The entomological data used in the study were collected by active surveillance in the rural area from 2015 to 2019 and by passive surveillance in the urban area from 2009 to 2019. Data on sociodemographic and environmental factors and changes in land use and land cover were obtained from the urban and rural census sectors. A total of 1404 triatomines, belonging to eight species, were captured in domiciles in the rural area (2015-2019) and 277 triatomines in domiciles in the urban area (2009-2019) of the municipality of Montes Claros. The variables the number of domiciles, household economic income, pavement, NDVI, deforestation, unchanged, and anthropic proved to be positively associated with the occurrence and/or number of triatomines in census sectors, within the models. The occurrence of triatomines in the domestic environment of the municipality of Montes Claros should be considered a public health problem, as it suggests a potential risk of establishment and transmission of T. cruzi to domestic animals, farm animals, and humans.

Asunto(s)

RESUMEN

ABSTRACT This report describes the occurrence of the rabies virus in two species of wild animals in the urban area of Montes Claros (MOC), Minas Gerais State, Brazil, in May 2023. The virus has been detected in frugivorous chiropterans (Artibeus sp) and marmosets (Callithrix penicillata). This is the first notified case of the rabies virus in the species C. penicillata in the urban area of MOC. Our findings show that the rabies virus is circulating in the urban area of MOC; therefore, permanent preventive measures must be adopted to avoid infection of other animals and humans.

RESUMEN

Chagas disease (CD) is a neglected disease caused by the protozoan Trypanosoma cruzi. It has high morbidity and mortality rates and mainly affects socially vulnerable populations. This is a cross-sectional study, with retrospective and prospective data collection. Using questionnaires applied to environmental surveillance coordinators, we characterized the status of CD surveillance activities in municipalities endemic for the disease in Northern Minas Gerais State (MG) and Jequitinhonha Valley (Vale do Jequitinhonha). Moreover, we spatialized the vulnerability index for chronic CD in the study area. The population consisted of 22 environmental surveillance coordinators, active in 2020, from Northern MG and Jequitinhonha Valley, 21 municipalities included in the SaMi-Trop research project, and Montes Claros municipality. After applying the questionnaires to the coordinators, a descriptive analysis of the variables was performed. To characterize the active municipalities, the explanatory variables collected in the questionnaire were compared with the dichotomous variable. Bivariate descriptive analysis was performed. Finally, geoprocessing techniques were used to spatialize the data and prepare maps. Regarding the team of endemic combat agents (ECA), 90.9% reported the lack of a specific team for CD vector control actions. Of the 22 municipalities participating in this study, nine were active (41.1%). Only 25% (n=2) of active municipalities (9% of the municipalities studied) met the target of visiting 50% of households per year. Finally, 81.1% of the coordinators stated that in their municipality, they developed actions linked to primary health care (PHC). The implementation of CD surveillance activities weakened in the endemic region. Few municipalities have a surveillance team, with low regularity of active surveillance and noncompliance with the program's goal. The results suggest insufficient recording of activities in the information system, considering that there are municipalities that report performing the activities, but no production record was observed in the system.

Asunto(s)

RESUMEN

A wide variety of mammals, including domestic and wild species, have been considered potential hosts and reservoirs for Leishmania. Bats have longevity, dispersal capacity, and adaptability to synotropic environments, characteristics that may favor their role in maintaining the life cycle of parasites. Therefore, the objective of this study was to carry out a worldwide systematic review of the occurrence of Leishmania species in bats, as well as to identify associations between eating habits and the type of sample collected with the occurrence of the infection. Data were obtained from a bibliographic search for studies that used molecular methods to identify parasites, employing the keywords "bats" AND "Leishmania" and their synonyms. We found 68 original studies, of which 20 were included in this review. Most studies were conducted in Brazil (60 %) and only 10 % were conducted in Old World countries. In all, 48 bat species were recorded that hosted seven Leishmania species, resulting in 62 different host-parasite interactions, and the Leishmania infantum interaction with bat species presented higher frequency. There was no significant difference between Leishmania species richness, infection percentage, and type of sample analyzed, but in general, it is observed that the use of different biological samples seems to expand the possibility of parasite detection. The patterns observed here indicate that bats can become infected with a wide variety of Leishmania species and likely play an important role in maintaining the parasite's life cycle. Thus, we suggest that studies aimed at understanding the transmission cycle of leishmaniasis include the investigation of bats as potential hosts or reservoirs of Leishmania.

Asunto(s)

RESUMEN

This is an ecological study that investigated the influence of environmental, socioeconomic characteristics and changes in land use and cover on the occurrence of Tegumentary Leishmaniasis (TL) in the city of Montes Claros. The relationships between the number of cases of TL, which occurred between 2012 and 2019, in each census sector and the standardized covariates (Number of properties, altitude, Brazilian Deprivation Index, Normalized Difference Vegetation Index (NDVI), proportion of sector (PS) deforested, PS that underwent other anthropic alterations and unaltered PS) were evaluated with ecological Bayesian Models. Four multivariate models were constructed, with similar quality of adjustments, but Model 1 was the most parsimonious. Model 1 revealed that for each one-unit increase of standard deviation (SD) in the log of the number of properties, at the altitude and root of the deforested PS, corresponds to an increase of 44%, 34% and 24.5% in the number of cases of TL, respectively. The variable NDVI, included in models 3 and 4, was positively associated with the increase in the number of TL cases, being that for each one-unit increase in the NDVI was verified an increase of 21.3% and 20.2% respectively in the models. This study showed that the spatial distribution of TL cases in the city of Montes Claros occurs in a heterogeneous way and our findings support the hypothesis that socio-environmental characteristics and deforestation influence the occurrence of this disease in the studied area. Thus, these factors must be considered for the development of disease control strategies.

Asunto(s)

RESUMEN

ABSTRACT Chagas disease (CD) is a neglected disease caused by the protozoan Trypanosoma cruzi. It has high morbidity and mortality rates and mainly affects socially vulnerable populations. This is a cross-sectional study, with retrospective and prospective data collection. Using questionnaires applied to environmental surveillance coordinators, we characterized the status of CD surveillance activities in municipalities endemic for the disease in Northern Minas Gerais State (MG) and Jequitinhonha Valley (Vale do Jequitinhonha). Moreover, we spatialized the vulnerability index for chronic CD in the study area. The population consisted of 22 environmental surveillance coordinators, active in 2020, from Northern MG and Jequitinhonha Valley, 21 municipalities included in the SaMi-Trop research project, and Montes Claros municipality. After applying the questionnaires to the coordinators, a descriptive analysis of the variables was performed. To characterize the active municipalities, the explanatory variables collected in the questionnaire were compared with the dichotomous variable. Bivariate descriptive analysis was performed. Finally, geoprocessing techniques were used to spatialize the data and prepare maps. Regarding the team of endemic combat agents (ECA), 90.9% reported the lack of a specific team for CD vector control actions. Of the 22 municipalities participating in this study, nine were active (41.1%). Only 25% (n=2) of active municipalities (9% of the municipalities studied) met the target of visiting 50% of households per year. Finally, 81.1% of the coordinators stated that in their municipality, they developed actions linked to primary health care (PHC). The implementation of CD surveillance activities weakened in the endemic region. Few municipalities have a surveillance team, with low regularity of active surveillance and noncompliance with the program's goal. The results suggest insufficient recording of activities in the information system, considering that there are municipalities that report performing the activities, but no production record was observed in the system.

RESUMEN

This study aimed to assess the prevalence of non-use of health services in the last year by people with Chagas disease (CD) in an endemic area in Brazil and the contextual and individual factors associated with this non-use. This is a multilevel study that considered contextual and individual data. Contextual data were collected from official publicly accessible databases of the Brazilian government, at the municipal level. The individual data came from the first follow-up of a Brazilian cohort that assessed patients with CD in 21 municipalities in endemic area for the disease. The sample consisted of 1,160 individuals with CD. The dependent variable "use of health services in the last year" was categorized as yes vs. no. The analysis was performed using Poisson regression with robust variance. The prevalence of non-use of health services in the last year was 23.5% (IC95%: 21.1-25.9). The contextual factor "larger population" (PR: 1.6; 95% CI = 1.2-2.0) and individual factors related to the lower severity of the disease as a functional class without limitations (PR: 1.6; 95% CI = 1.2-2.1) and unaltered N-terminal pro b-type natriuretic peptide levels (PR: 2.2; 95% CI = 1.3-3.6) increased the prevalence of non-use of the health service in the last year by people with CD. The results of this study showed that individual determinants are not isolated protagonists of the non-use of health services in the last year by people with CD, which reinforces the need for public policies that consider the contextual determinants of the use of health services by populations affected by the disease.

Asunto(s)

RESUMEN

Chagas disease (CD) is recognized by the World Health Organization as one of the thirteen most neglected tropical diseases in the world. Self-perceived health is considered a better predictor of mortality than objective measures of health status, and the context in which one lives influences this predictor. This study aimed to evaluate the prevalence and individual and contextual factors associated with poor self-rated health among CD patients from an endemic region in Brazil. It is a multilevel cross-sectional study. The individual data come from a cross-section of a cohort study named SaMi-Trop. Contextual data was collected from publicly accessible institutional information systems and platforms. The dependent variable was self-perceived health. The analysis was performed using multilevel binary logistic regression. The study included 1,513 patients with CD, where 335 (22.1%) had Poor self-rated health. This study revealed the influence of the organization/offer of the Brazilian public health service and of individual characteristics on the self-perceived health of patients with CD.

Asunto(s)

RESUMEN

This study aimed to determine the occurrence of Leishmania infection in bats in urban and wild areas in an endemic municipality for visceral and cutaneous leishmaniasis in Minas Gerais, Brazil. Between April 2014 to April 2015, 247 bats were captured and classified into 26 species belonging to Phyllostomidae (90.7%), Vespertilionidae (8.1%) and Molossidae (1.2%) families. Blood samples from 247 bats were collected and submitted to nested-PCR, targeting the variable V7-V8 region of the SSU rRNA gene, followed by sequencing of the PCR product. The overall infection rate of Leishmania spp. in bats was 4.4%. Of the eleven bats infected, ten were frugivorous bats: Artibeus planirostris (8/11), Artibeus lituratus (1/11) and Artibeus cinereus (1/11) and one a nectarivorous bat (Glossophaga soricina). None of the individuals exhibited macroscopic alterations in the skin, spleen or liver. Phylogenetic analysis separated Leishmania species in clades corresponding to the subgenera Viannia, Leishmania, and Mundinia, and supported that the isolates characterized in the present study clustered closely with Leishmania (Viannia) sp., Leishmania (Leishmania) infantum and Leishmania (Leishmania) amazonensis. Here we report for the first time the bat Artibeus cinereus as a host of Leishmania (Leishmania) amazonensis. In the study we found that the mean abundance of bats did not differ in wild habitats and urban areas and that bat-parasite interactions were similarly distributed in the two environments. On the other hand, further studies should be conducted in more recent times to verify whether there have been changes in these parameters.

Asunto(s)

RESUMEN

The north of the Brazilian state of Minas Gerais is classified as an area of high risk of vectorial transmission of Chagas disease (CD) or of reestablishing transmission in the home, but the Chagas disease control programme is disjointed. The study evaluated the occurrence, natural infection and the spatial distribution of species of triatomines associated with climatic variations in the urban area of Montes Claros, a municipality endemic to CD in the north of Minas Gerais, Brazil. Triatomine data were obtained from passive entomological surveillance actions of the Chagas Disease Control Program (Programa de Controle de Doença de Chagas-PCDCh), registered by the Zoonosis Control Center (Centro de Controle de Zoonoses-CCZ) from 2009 to 2019. A total of 277 triatomines belonging to eight species were collected, and of these, 203 insects were examined. It was found that 46.2% of triatomines were captured inside the home and 8.3% around the home. The natural infection rate was 6.9%; 14 specimens showed natural infection by Trypanosoma cruzi (12 females and 2 males), and of these, 13 were found in the home and one in an uninformed location. The number of triatomine records collected was significantly higher in the month of September (p = .01), and there was an inverse correlation between the number of triatomines and the relative humidity of the air (p < .001). It was verified that the highest triatomine densities are located in transition areas between urban infrastructure (32.12%) and pasture (25.72%). The diversity of species of triatomines infected with T. cruzi in residential units in urban areas in the municipality of Montes Claros is worrying, as it suggests a potential risk of transmission of the parasite to domestic animals and humans.

Asunto(s)

RESUMEN

Abstract Chagas disease (CD) is recognized by the World Health Organization as one of the thirteen most neglected tropical diseases in the world. Self-perceived health is considered a better predictor of mortality than objective measures of health status, and the context in which one lives influences this predictor. This study aimed to evaluate the prevalence and individual and contextual factors associated with poor self-rated health among CD patients from an endemic region in Brazil. It is a multilevel cross-sectional study. The individual data come from a cross-section of a cohort study named SaMi-Trop. Contextual data was collected from publicly accessible institutional information systems and platforms. The dependent variable was self-perceived health. The analysis was performed using multilevel binary logistic regression. The study included 1,513 patients with CD, where 335 (22.1%) had Poor self-rated health. This study revealed the influence of the organization/offer of the Brazilian public health service and of individual characteristics on the self-perceived health of patients with CD.

Resumo A Doença de Chagas (DC) é reconhecida pela Organização Mundial da Saúde como uma das treze doenças tropicais mais negligenciadas do mundo. A autopercepção de saúde é considerada um melhor preditor de mortalidade do que medidas objetivas do estado de saúde, e o contexto em que se vive influencia esse preditor. O objetivo deste estudo foi avaliar a prevalência e os fatores individuais e contextuais associados à pior autopercepção em saúde de pacientes com DC de uma região endêmica do Brasil. É um estudo transversal multinível. Os dados individuais vêm de um corte transversal de um estudo de coorte denominado SaMi-Trop. Os dados contextuais foram coletados a partir de plataformas e sistemas de informações institucionais acessíveis ao público. A variável dependente foi a autopercepção de saúde. A análise foi realizada por meio de regressão logística binária multinível. Participaram do estudo 1.513 pacientes com DC, sendo 335 (22,1%) com pior autopercepção de saúde. Este estudo revelou a influência da organização/oferta do serviço público de saúde brasileiro e de características individuais na autopercepção de saúde de pacientes com DC.

RESUMEN

Chagas disease (CD) is still a neglected disease. Infected individuals are diagnosed late, being treated in worse clinical conditions. Thus, this study aimed to analyze the prevalence and the factors associated with new confirmed cases of CD identified by serological screening in an endemic region of Minas Gerais State, Brazil. This is an analytical cross-sectional study with data from a project of the Research Center in Tropical Medicine of Sao Paulo- Minas Gerais (SaMi-Trop) conducted in two municipalities. Data collection included a questionnaire with closed questions, a venous blood collection and an ELISA serological test for CD. A total of 2,038 individuals with no previous diagnosis of CD participated in the study. The result of the serological test for CD was adopted as the dependent variable. The independent variables addressed personal issues, health conditions and lifetime housing. A descriptive analysis of individual variables was performed. Subsequently, a bivariate analysis was performed using the Pearson's chi-square test. Households sheltering individuals positive for CD were georeferenced, and the analysis of spatial distribution was performed using the quartic function to estimate the density of the nucleus. Among the participants, 188 (9.2 %) were positive for CD. The profile of participants with CD was associated with place of residence, age, relative/family member with CD and living conditions. It is noteworthy that there are still patients with CD who are unaware of their diagnosis in both, rural and urban areas.

Asunto(s)

RESUMEN

The understanding on the role of bats in the ecology of zoonotic diseases, especially its relevance as a carrier of pathogens, is important for the determination of preventive measures considering the One Health context. The present study aimed to investigate the presence of Brucella spp., Leptospira spp. and Salmonella spp. in blood (n = 163), liver (n = 35) and spleen (n = 62) samples from bats captured in Montes Claros, Minas Gerais, Brazil. Only Salmonella spp. was found in a blood sample of an insectivorous female bat of the species Lasiurus blossevilli, evidencing the capacity of this animal species to host this pathogen. In conclusion, our results in bats from Montes Claros indicate that they do not act as hosts for Brucella spp. and Leptospira spp., although being potential carriers of Salmonella spp. in a low prevalence.

Asunto(s)

RESUMEN

COVID-19 was first reported in Wuhan, China, in December 2019. It is widely accepted that the world will not return to its prepandemic normality until safe and effective vaccines are available and a global vaccination program has been successfully implemented. Antisense RNAs are single-stranded RNAs that occur naturally or are synthetic and enable hybridizing and protein-blocking translation. Therefore, the main objective of this study was to identify target markers in the RNA of the severe acute respiratory syndrome coronavirus, or SARS-CoV-2, with a length between 21 and 28 bases that could enable the development of vaccines and therapies based on antisense RNA. We used a search algorithm in C language to compare 3159 complete nucleotide sequences from SARS-CoV-2 downloaded from the repository of the National Center for Biotechnology Information. The objective was to verify whether any common sequences were present in all 3159 strains of SARS-CoV-2. In the first of three datasets (SARS-CoV-2), the algorithm found two sequences each of 21 nucleotides (Sequence 1: CTACTGAAGCCTTTGAAAAAA; Sequence 2: TGTGGTTATACCTACTAAAAA). In the second dataset (SARS-CoV) and third dataset (MERS-CoV), no sequences of size N between 21 and 28 were found. Sequence 1 and Sequence 2 were input into BLAST® ≫ blastn and recognized by the platform. The gene identified by the sequences found by the algorithm was the ORF1ab region of SARS-CoV-2. Considerable progress in antisense RNA research has been made in recent years, and great achievements in the application of antisense RNA have been observed. However, many mechanisms of antisense RNA are not yet understood. Thus, more time and money must be invested into the development of therapies for gene regulation mediated by antisense RNA to treat COVID-19 as no effective therapy for this disease has yet been found.

Asunto(s)

RESUMEN

American Tegumentary Leishmaniasis (ATL) is endemic in the municipality of Montes Claros, Minas Gerais State. The use of geotechnology such as spatial statistics and remote sensing has contributed to a better understanding of the eco-epidemiology of diseases, and consequently a better definition of control strategies. This study aimed to analyze the spatial distribution of probable sites of cases of ATL infection (2007-2011) in the municipality of Montes Claros and to identify related socio-environmental factors. Data on ATL cases notification were obtained from the Municipal Health Department of Montes Claros. The annual incidence of ATL in the municipality was calculated and the probable sites of infection were georeferenced. Crude Rate and the Local Empirical Bayesian Rate were calculated with census sectors considered as the unit of analysis. The Normalized Difference Vegetation Index (NDVI) was calculated from LANDSAT 5 TM images. The spatial association between the crude rate of ATL and the NDVI of the census tracts was evaluated using the Local Bivariate of Moran I. The socio-environmental aspects of household structures were assessed based on a structured questionnaire. The incidence of ATL in the evaluated period ranged from 6.2 to 16.6 cases/100,000 inhabitants. The highest rates of ATL occurrence were found in the census sectors located in the rural area and in the peripheral census sectors in the city. Through the Empirical Bayes Smoothed Rate map, it was found that in the peripheral areas of the city, the rates of ATL occurrence were lower than in the rural area and their values decreased as they approach the city center. Local Bivariate of Moran I showed a positive correlation between NDVI and crude ATL rates, with significant high-high clusters observed in the rural area and in the census sectors in the Western peripheral area of the city that have experienced an urban expansion concomitant to the period investigated. In most homes of people affected by the disease, there were domestic animals and organic matter in the peridomicile. In addition, a high percentage of individuals affected by ATL reported the presence of rodents circulating near their homes. In conclusion, it is possible that the disorderly expansion process in the city of Montes Claros favored the establishment of the ATL periurban and urban transmission cycle. These regions deserve special attention from health surveillance to combat this zoonosis.

Asunto(s)

RESUMEN

The COVID-19 pandemic caused by the infection with the novel Coronavirus SARS-CoV-2, revealed individual and global vulnerabilities, in which we highlight the social, economic, and political aspects and the health systems' organization in the countries. Brazil remains with a high transmission rate and presents a centripetal distribution as observed through a more sustained growth in the number of municipalities affected, outlining a profile of invasion of poor communities. Several vulnerabilities overlap with precarious housing conditions, lack of basic sanitation, malnutrition, and endemicity for neglected chronic diseases such as visceral leishmaniasis (VL). COVID-19 and VL evidently do not share clinical features, but exactly because of the distinct immunopathogenesis between the diseases, patients with VL may present a vulnerability in the immune system against antiviral responses. Considering that VL susceptibility seems to be related to an inefficient and polarized immune response, it is likely that in endemic areas, the overlap of social weaknesses added to individual vulnerability by immune polarization may aggravate the COVID-19 condition. In this sense, we reinforce that possible relationships between endemic neglected diseases such as VL and pandemic SARS-CoV-2 infection need to be further considered and investigated.

Asunto(s)

RESUMEN

Mosquitoes (Diptera: Culicidae) are one of the most important disease vector species in the world. Many species have a high degree of anthropophilia and are often found in human habitations. In the present study, we have inventoried the nocturnal mosquito assemblage in intra-, peri-, and extradomicile environments in four municipalities in Pará, Brazil. At each municipality, a residence was selected and the mosquitoes were sampled using the protected human attraction capture and Shannon trap methods in April (rainy season) and August 2018 (dry season). We have collected a total of 696 mosquito specimens belonging to 8 genera and 17 species. The most abundant species were Mansonia (Mansonoides) titillans (Walker) (366/696, 52.6%), Anopheles (Nyssorhynchus) albitarsis Lynch-Arribálzaga (97/696, 13.9%), and Culex (Culex) quinquefasciatus Say (93/696, 13.4%). Mosquito richness, abundance, and composition did not differ between intra-, peri-, and extradomicile environments suggesting limited habitat segregation among the different species. However, mosquito species richness and mosquito species abundance were significantly higher during the rainy season than during the dry season, suggesting increased mosquito activity during the rainy season. We detected several important vector species of human diseases including Aedes (Stegomyia) aegypti (Linnaeus), Anopheles (Nyssorhynchus) darlingi Root, Haemagogus (Conopostegus) leucocelaenus (Dyar and Shannon), Coquillettidia (Coquillettidia) venezuelensis (Theobald), and Culex (Culex) quinquefasciatus which are the main transmitters of dengue, malaria, yellow fever, mayaro, and oropouche fever, respectively. As inventories of disease-carrying mosquitoes in the region are very scarce, mainly in residential environments, our results suggest high potential for mosquito-borne disease transmission in Pará State.

Asunto(s)

RESUMEN

Bats (Order: Chiroptera) harbor a high diversity of emerging pathogens presumably because their ability to fly and social behavior favor the maintenance, evolution, and dissemination of these pathogens. Until 2012, there was only one report of the presence of Hantavirus in bats. Historically, it was thought that these viruses were harbored primarily by rodent and insectivore small mammals. Recently, new species of hantaviruses have been identified in bats from Africa and Asia continents expanding the potential reservoirs and range of these viruses. To assess the potential of Neotropical bats as hosts for hantaviruses and its transmission dynamics in nature, we tested 53 bats for active hantaviral infection from specimens collected in Southeastern Brazil. Part of the hantaviral S segment was amplified from the frugivorous Carollia perspicillata and the common vampire bat Desmodus rotundus. DNA sequencing showed high similarity with the genome of Araraquara orthohantavirus (ARQV), which belongs to one of the more lethal hantavirus clades (Andes orthohantavirus). ARQV-like infection was detected in the blood, urine, and organs of D. rotundus. Therefore, we describe a systemic infection in Neotropical bats by a human pathogenic Hantavirus. We also propose here a schematic transmission dynamics of hantavirus in the study region. Our results give insights to new, under-appreciated questions that need to be addressed in future studies to clarify hantavirus transmission in nature and avoid hantavirus outbreaks.

Asunto(s)