RESUMEN

Tomatoes (Solanum lycopersicum L.), as a significant solanaceous crop, have attracted global research interest focused on elucidating its plant virus incidence, epidemiology, and pathogenicity, especially in field production (Li et al. 2021; Rivarez et al. 2023). Tobacco vein banding mosaic virus (TVBMV) is classified in the genus Potyvirus. Since its discovery, TVBMV has been documented to infect tobacco, potato, jimsonweed, wild eggplant under nature conditions (Wang et al. 2017). Also, TVBMV could be transmitted to tomatoes by aphids (Myzus persicae) in laboratory conditions (Bi et al. 2020). However, to date, there is no sequence representing TVBMV infecting tomato deposited in NCBI nucleotide database. In August 2023, about 30% of tomato planted in an open field showing typical viral disease symptoms (chlorosis, yellowing, mosaic, curling, and mottling) in Dali, Yunnan, China. To identify the potential pathogen, about 9 symptomatic leave from different plants were collected, pooled and sent for high-throughput sequencing. In summary, total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA). Subsequently, RNA sequencing libraries were constructed using the TruSeq RNA sample prep kit (Illumina, CA, USA), followed by RNA-Seq sequencing performed on an Illumina HiSeq4000 platform (LC Sciences, USA). A total of 71,368,934 raw reads (paired-end) of the length 150-bp were generated. After quality control, 69,746,872 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs (ranging from 186 nt to 15,573 nt) were searched against the NCBI non-redundant protein (NR) to detect potential viral pathogens using BLASTx with a cutoff e-value of 10-5. As a result, 2 viral contigs were assigned to 2 known viruses: TVBMV (Depth: 1960X, BLASTn similarity: 95.26%) and chilli veinal mottle virus (ChiVMV) (Depth: 3581X, BLASTn similarity: 98.22%). No other viruses and viroids were detected. The presence of TVBMV and ChiVMV were tested positive in all of the 9 samples originally collected. Notably, the detection primer for TVBMV identified in tomato (TVBMV-tomato) was designed from the newly assembled TVBMV genome (Forward: 5'- CTCGGTGAGGAAGGTGACATAAGT'; Reverse: 5'- CTTTCAACACCAGGGAATCTAGTG -3'). The nearly complete genome sequence of TVBMV-tomato was validated by overlapping RT-PCR and submitted to NCBI nucleotide database (accession: PP848192). To assess TVBMV-tomato infectivity, symptomatic tomato leaf sap was mechanically inoculated onto 4 healthy tomatoes, with healthy tomato leaf sap serving as a control. After 3 weeks, plants inoculated with symptomatic sap showed leaf curling and stunting, while control plants remained unaffected. All symptomatic samples tested positive for TVBMV via RT-PCR (4/4). For comparison, TVBMV could not be detected in the control sample. Sanger sequencing verified the expected 986 bp amplicon sequences. However, ChiVMV was also detected in all symptomatic tomato samples, which makes it possible that the symptoms after inoculation were the result of the synergism of TVBMV and ChiVMV. Phylogenetic analysis based on complete coding sequence revealed that TVBMV-tomato was most closely related to TVBMV identified from Solanum lyratum. To our knowledge, this work represents the first report of natural occurrence of TVBMV in agroecosystem in Yunnan, China.

RESUMEN

The average content of casein in yak milk is 40.2 g/L. Casein can be degraded by enzymatic digestion or food processing to produce abundant degradation peptides. International researchers have studied the degradation peptides of yak milk casein by using multiple techniques and methods, such as in vitro activity tests, cellular experiments, proteomics, bioinformatics, etc., and found that the degradation peptides have a wide range of functional activities that are beneficial to the human body, such as angiotensin-converting enzyme (ACE) inhibitory, antioxidant, anti-inflammatory, antidiabetic, antimicrobial, anticancer, and immunomodulatory activities, etc., and it has been proved that the types and strengths of functional activities are closely related to the structural characteristics of the peptides. This paper describes the characteristics of yak milk proteins, the functional activities, and mechanism of action of degraded peptides. Based on the types of functional activities of yak milk casein degradation peptides, we classified and elucidated the effects of structural factors, such as peptide molecular weight, peptide length, amino acid sequence, physicochemical properties, electrical charge, hydrophobicity, spatial conformation, chain length, and the type of enzyme on these activities. It reveals the great potential of yak milk casein degradation peptides as functional active peptide resources and as auxiliary treatments for diseases. It also provides important insights for analyzing yak casein degradation peptide activity and exploring high-value utilization.

Asunto(s)

Caseínas , Leche , Péptidos , Caseínas/química , Caseínas/metabolismo , Animales , Leche/química , Bovinos , Péptidos/química , Péptidos/farmacología , Péptidos/metabolismo , Humanos , Antioxidantes/química , Antioxidantes/farmacología , Secuencia de Aminoácidos , Inhibidores de la Enzima Convertidora de Angiotensina/química , Inhibidores de la Enzima Convertidora de Angiotensina/farmacología , Inhibidores de la Enzima Convertidora de Angiotensina/metabolismo , Proteolisis

RESUMEN

The objective of this study was to explore the effects and mechanisms of the combination of isobavachalcone (IBC) and doxorubicin (DOX) on the progression of anaplastic thyroid cancer (ATC). Cell viability of 8505C and CAL62 cells was observed by CCK-8 assay. Kits were used to detect the presence of reactive oxygen species (ROS), glutathione (GSH), malondialdehyde (MDA), and cellular iron. Protein expression of solute carrier family 7 member 11 (SLC7A11) and glutathione peroxidase 4 (GPX4) was detected using western blot, and CD31 was detected through immunofluorescence. Tumor xenograft models of 8505C cells were constructed to observe the effect of IBC and DOX on ATC growth in vivo. The co-administration of IBC and DOX exhibited a synergistic effect of suppressing the growth of 8505C and CAL62 cells. The concurrent use of IBC and DOX resulted in elevated iron, ROS, and MDA levels, while reducing GSH levels and protein expression of SLC7A11 and GPX4. However, the Fer-1 ferroptosis inhibitor effectively counteracted this effect. In vitro and in vivo, the inhibitory effect on ATC cell proliferation and tumor growth was significantly enhanced by the combination of IBC and DOX. The combination of IBC and DOX can inhibit the growth of ATC by activating ferroptosis, and might prove to be a potent chemotherapy protocol for addressing ATC.

Asunto(s)

Chalconas , Doxorrubicina , Sinergismo Farmacológico , Ferroptosis , Especies Reactivas de Oxígeno , Carcinoma Anaplásico de Tiroides , Neoplasias de la Tiroides , Ferroptosis/efectos de los fármacos , Doxorrubicina/farmacología , Carcinoma Anaplásico de Tiroides/tratamiento farmacológico , Carcinoma Anaplásico de Tiroides/patología , Carcinoma Anaplásico de Tiroides/metabolismo , Animales , Humanos , Chalconas/farmacología , Neoplasias de la Tiroides/tratamiento farmacológico , Neoplasias de la Tiroides/patología , Neoplasias de la Tiroides/metabolismo , Línea Celular Tumoral , Especies Reactivas de Oxígeno/metabolismo , Progresión de la Enfermedad , Ratones , Ensayos Antitumor por Modelo de Xenoinjerto , Proliferación Celular/efectos de los fármacos , Ratones Desnudos , Supervivencia Celular/efectos de los fármacos , Glutatión/metabolismo , Glutatión/efectos de los fármacos , Antibióticos Antineoplásicos/farmacología , Fosfolípido Hidroperóxido Glutatión Peroxidasa/metabolismo

RESUMEN

Potato virus H (PVH), belonging to the genus Carlavirus in the family Betaflexiviridae, was initially discovered in potato plants in Inner Mongolia, China (Li et al., 2013). Subsequently, it was documented to infect pepino, a perennial shrub of the Solanaceae family like potatoes (Abouelnasr et al., 2014). Tomato (Solanum lycopersicum L.), a major global crop, faces threats from various plant viruses. In an open field survey in Yunnan, China during July 2023, tomatoes (cultivar: Liangsi) showed typical virus symptoms: leaf yellowing, curling, mottling, and fruit with abnormal shape and color. Eleven symptomatic tomato samples were collected for high-throughput sequencing to identify the potential pathogen. RNA sequencing libraries were prepared using the TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA), followed by RNA-seq sequencing on an Illumina HiSeq4000 platform (LC Sciences, USA). Approximately 77,928,560 paired-end reads (150-bp each) were generated. After quality control, 75,808,296 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs, ranging from 198 nt to 15865 nt, were used as queries to search against the NCBI non-redundant protein sequence database (NR) or nucleotide sequence database (NT) to detect the potential pathogens using BLASTx and BLASTn program with a cutoff e-value of 10-5. As a consequence, certain contigs were assigned to 3 plant viruses, including PVH (the highest RdRp blastx identity to UAD82396.1: 97.8%), Capsicum chlorosis virus (CaCV, the highest RdRp blastx identity to APQ31267.1: 98.4%), and southern tomato virus (STV, the highest CP-RdRp fusion protein blastx identity to QOW17541.1: 99.74%). The presence of the identified 3 viruses was subsequently screened in the 11 tomato samples originally collected from the corresponding field. Notably, the specific detection primers for the PVH genome was designed from the newly assembled PVH genome (Forward primer: 5'- ATAGTTGTGCACTGTGTGCCTG-3'; Reverse primer: 5'-GCTTAAGGTTCTTAGCGTATTC-3'), targeting ~1.1kb. Consequently, PVH was detected in 3 out of 11 samples: 2 leaf samples and 1 fruit sample, with one leaf sample showing a single infection. The complete genome sequence of PVH in tomatoes (PVH-tomato) was successfully obtained by assembling nine overlapping regions spanning the entire PVH-tomato genome, following the RT-PCR and the 5' RACE and 3' RACE approaches, and deposited in NCBI nucleotide database with accession number OR397130.1Phylogenetic analysis based on the full genome sequences of PVH-tomato and other publicly available PVH isolates revealed that PVH-tomato was closely related to a PVH isolate found in potatoes in Yunnan (blastn similarity: 97.76%) (Fig. S1A). To test PVH-tomato infectivity and pathogenicity, four healthy Nicotiana benthamiana and four healthy tomato plants were mechanically inoculated with PVH-infected leaf sap; controls used sap from healthy plants. Three weeks post-inoculation, all N. benthamiana (4/4) and three tomato plants (3/4) were PVH-positive by RT-PCR. Symptoms were milder in N. benthamiana, and only two tomato plants (2/4) showed leaf curling. No PVH was detected in control samples (Figure S1B, S1C). Sanger sequencing confirmed the amplicons' expected length of 1093 bp. Previously, PVH was documented only in potato and pepino. This is the first report of tomatoes as natural PVH hosts and PVH infecting N. benthamiana under lab conditions.

RESUMEN

Gastrointestinal (GI) disorders are highly prevalent and severely diminish life quality. It is yet unknown which dietary pattern is optimal for the prevention of GI disorders. Among 141 450 participants from UK Biobank with a median follow-up of 15 years, we comprehensively assessed 13 dietary patterns in relation to 6 GI disorders. Multivariable Cox proportional hazards models demonstrated that adherence to healthy diets was associated with lower risk of GI disorders, with the strongest associations observed for the Dietary Approaches to Stop Hypertension (DASH) diet (HRQ4 vs. Q1 = 0.85, 95% CI: 0.81, 0.88), the Alternate Mediterranean Diet (AMED) (HRQ4 vs. Q1 = 0.85, 95% CI: 0.81, 0.88), and the Alternate Healthy Eating Index-2010 (AHEI-2010) (HRQ4 vs. Q1 = 0.86, 95% CI: 0.82, 0.89). AHEI-2010 (HRs ranging from 0.76 to 0.90) and DASH (HRs ranging from 0.75 to 0.88) showed inverse associations with every individual GI disorder. Furthermore, comorbidities decreased significantly in number with higher AMED and DASH diet scores (P for trend <0.001). Finally, the associations of AHEI-2010, AMED and DASH with GI disorders diminished most intensely after removing the component of fruits or whole grains. The combined intake of fruits and whole grains was inversely associated with the risk of overall GI disorders (HRT3 vs. T1 = 0.89, 95% CI: 0.86, 0.93). In conclusion, AHEI-2010 and DASH were the most recommended dietary patterns for the prevention of GI disorders. Fruits and whole grains are the most significant contributors to the protective effect.

Asunto(s)

Dieta Mediterránea , Enfermedades Gastrointestinales , Humanos , Masculino , Femenino , Persona de Mediana Edad , Estudios Prospectivos , Enfermedades Gastrointestinales/epidemiología , Enfermedades Gastrointestinales/prevención & control , Adulto , Anciano , Factores de Riesgo , Enfoques Dietéticos para Detener la Hipertensión , Modelos de Riesgos Proporcionales , Dieta Saludable , Reino Unido/epidemiología , Dieta , Patrones Dietéticos

RESUMEN

Gene therapy has shown significant potential in treating various diseases, particularly inherited blood disorders such as hemophilia, sickle cell disease, and thalassemia. Advances in understanding the regulatory network of disease-associated genes have led to the identification of additional therapeutic targets for treatment, especially for ß-hemoglobinopathies. Erythroid regulatory factor BCL11A offers the most promising therapeutic target for ß-hemoglobinopathies and reduction of its expression using the commercialized gene therapy product Casgevy was approved for use in the UK and USA in 2023. Notably, the emergence of innovative gene editing technologies has further broadened the gene therapy landscape, presenting new possibilities for treatment. Intensive studies indicate that base editing and prime editing, built upon CRISPR technology, enable precise single-base modification in hematopoietic stem cells for addressing inherited blood disorders ex vivo and in vivo. In this review, we present an overview of the current landscape of gene therapies, focusing on clinical research and gene therapy products for inherited blood disorders, evaluation of potential gene targets, and the gene editing tools employed in current gene therapy practices, which provides an insight for the establishment of safer and more effective gene therapy methods for a wider range of diseases in the future.

RESUMEN

The monitoring of currents in the abyssal ocean is an essential foundation of deep-sea research. The state-of-the-art current meter has limitations such as the requirement of a power supply for signal transduction, low pressure resistance, and a narrow measurement range. Here, we report a fully integrated, self-powered, highly sensitive deep-sea current measurement system in which the ultra-sensitive triboelectric nanogenerator harvests ocean current energy for the self-powered sensing of tiny current motions down to 0.02 m/s. Through an unconventional magnetic coupling structure, the system withstands immense hydrostatic pressure exceeding 45 MPa. A variable-spacing structure broadens the measuring range to 0.02-6.69 m/s, which is 67% wider than that of commercial alternatives. The system successfully operates at a depth of 4531 m in the South China Sea, demonstrating the record-deep operations of triboelectric nanogenerator-based sensors in deep-sea environments. Our results show promise for sustainable ocean current monitoring with higher spatiotemporal resolution.

RESUMEN

BACKGROUND: Although high ultraprocessed food (UPF) consumption has been linked with increased mortality risk in the general population, whether UPFs harm participants with a history of cancer remains unclear. OBJECTIVES: This study aimed to evaluate the association of UPF consumption with mortality among participants with a history of cancer. METHODS: Prospective cohort analysis was conducted on 13,640 participants with a history of cancer from the UK Biobank. UPFs were defined by the Nova classification. UPF consumption was calculated as the weight proportion of UPFs in the total food consumption. Cox proportional hazard models were used to assess the association between UPF consumption and mortality among participants with a history of cancer. RESULTS: The median UPF consumption was 29.25% (interquartile range [IQR]: 19.46%-40.62%) for males and 25.81% (IQR: 16.61%-36.35%) for females in the total diet among participants with a history of cancer. During a median follow-up of 10.77 years, 1611 deaths were documented. Multivariable-adjusted hazard ratios (95% confidence intervals) among participants in the highest quartile of UPF consumption relative to the lowest were 1.17 (1.02, 1.35) for all-cause mortality and 1.22 (1.03, 1.44) for cancer-related mortality. CONCLUSIONS: Higher UPF consumption after the diagnosis among participants with a history of cancer is associated with higher risk of mortality.

Asunto(s)

Manipulación de Alimentos , Neoplasias , Humanos , Masculino , Femenino , Neoplasias/mortalidad , Estudios Prospectivos , Persona de Mediana Edad , Anciano , Dieta , Adulto , Modelos de Riesgos Proporcionales , Factores de Riesgo , Reino Unido/epidemiología , Estudios de Cohortes

RESUMEN

OBJECTIVE: Lifestyle factors after cancer diagnosis could influence cancer survival. This study aimed to investigate the joint effects of smoking, physical activity, alcohol consumption, diet and sleep duration on all-cause, cancer and non-cancer mortality of cancer survivors in UK biobank. METHODS: The follow-up period concluded in December 2021, with post-diagnostic lifestyle factors assessed at baseline. A lifestyle score ranging from 0 to 5 was assigned based on adherence to the selected lifestyle factors. The study employed Cox regression models for hazard ratios (HRs) and Kaplan-Meier for survival rates, with stratified and sensitivity analyses to assess the robustness of our findings under various assumptions. RESULTS: During a median follow-up of 12.7 years, 5652 deaths were documented from 34,184 cancer survivors. Compared to scoring 0-1, the HRs (95% CIs) for all-cause mortality with lifestyle scores of 2, 3, 4, and 5 were 0.70 (95% CI: 0.64, 0.76), 0.57 (0.52, 0.62), 0.50 (0.45, 0.54) and 0.43 (0.38, 0.48), respectively. Specific cancer types, particularly digestive, breast, female reproductive, non-solid, and skin cancers, showed notable benefits from adherence to healthy lifestyle, with the HRs of 0.55 (0.39, 0.79), 0.54 (0.42, 0.70), 0.32 (0.19, 0.53), 0.58 (0.39, 0.86), and 0.36 (0.28, 0.46) for lifestyle score of 5, respectively. Stratified analyses indicated the association was particularly significant among those with normal/lower BMI and higher Townsend Deprivation Index (Pinteraction = 0.001 and < 0.001, respectively). CONCLUSIONS: Healthier lifestyles were significantly linked with reduced mortality among cancer survivors. These findings highlight the need for adherence to healthy lifestyle habits to improve survival.

Asunto(s)

Consumo de Bebidas Alcohólicas , Supervivientes de Cáncer , Ejercicio Físico , Estilo de Vida , Neoplasias , Humanos , Femenino , Masculino , Estudios Prospectivos , Persona de Mediana Edad , Supervivientes de Cáncer/estadística & datos numéricos , Neoplasias/mortalidad , Reino Unido/epidemiología , Consumo de Bebidas Alcohólicas/epidemiología , Anciano , Fumar/epidemiología , Dieta , Adulto , Modelos de Riesgos Proporcionales

RESUMEN

IMPORTANCE: Mixed data exist in the literature regarding the impact of obesity on midurethral sling (MUS) failure rates. OBJECTIVE: The aim of this study was to evaluate the impact of obesity and Hispanic ethnicity on MUS failure. STUDY DESIGN: This was a retrospective cohort study of females who underwent MUS surgery, alone or with concomitant prolapse repair, with at least 1 year of follow-up. Body mass index (BMI) classes were categorized as normal (<25 kg/m2), overweight (25-29.9 kg/m2), obese (30-39.9 kg/m2), and severe obesity (≥40 kg/m2). The primary outcome was MUS failure, defined as a composite of subjectively unchanged or worsened symptoms or need for additional procedures. Secondary outcomes included risk factors related to MUS failure and the effect of ethnicity on MUS failure rates. RESULTS: A total of 322 women were included for analysis. The mean age was 52.3 years. Increasing BMI was associated with higher MUS failure, with multivariate logistic regression showing a 5% increased risk for each 1 kg/m2 BMI increase. Failure rates were significantly different between normal BMI and severe obesity (16.7% vs 36.4%, P = 0.04). After adjusting for other variables, transobturator slings had a higher risk of failure compared with retropubic slings, whereas surgeon training and patient ethnicity did not affect failure rates. CONCLUSIONS: We found that increasing BMI was associated with higher MUS failures, with significantly higher failure rates in the severely obese population. Although MUS remains the standard of care for treatment of SUI, based on our findings, counseling should be individualized to the patient, taking into account each patient's unique characteristics.

RESUMEN

Establishing a rapid and accurate method for monitoring the freshness of aquatic products is of great importance. Hypoxanthine has been considered an essential indicator of aquatic products' freshness. Here, a novel smartphone colorimetric / inductively coupled plasma mass spectrometry (ICP-MS) / photothermal three-mode sensing strategy was established for monitoring hypoxanthine. Hypoxanthine can be catalyzed by xanthine oxidase to H2O2 and uric acid, which can simultaneously degrade MnO2 nanosheets (NSs) to Mn2+. After filter-assisted separation, the smartphone and ICP-MS were performed by monitoring the color of the membrane and the Mn2+ in the filtrate. Additionally, MnO2 NSs can facilitate the oxidation of dopamine to form polydopamine nanoparticles, which exhibit strong photothermal efficiency. The approach successfully monitored the deterioration of aquatic products under various storage conditions through portable thermometers and smartphones with low limits of detection (LODs), providing a potential application for in-situ evaluation of the freshness of aquatic products.

Asunto(s)

Técnicas Biosensibles , Hipoxantina , Óxidos , Hipoxantina/análisis , Técnicas Biosensibles/instrumentación , Técnicas Biosensibles/métodos , Óxidos/química , Animales , Compuestos de Manganeso/química , Almacenamiento de Alimentos , Contaminación de Alimentos/análisis , Alimentos Marinos/análisis , Límite de Detección , Colorimetría/métodos , Colorimetría/instrumentación , Espectrometría de Masas , Peróxido de Hidrógeno/química , Peróxido de Hidrógeno/análisis , Peces , Xantina Oxidasa/química , Xantina Oxidasa/metabolismo , Teléfono Inteligente , Indoles , Polímeros

RESUMEN

Isothermal nucleic acid amplification-based lateral flow testing (INAA-LFT) has emerged as a robust technique for on-site pathogen detection, providing a visible indication of pathogen nucleic acid amplification that rivals or even surpasses the sensitivity of real-time quantitative PCR. The isothermal nature of INAA-LFT ensures consistent conditions for nucleic acid amplification, establishing it as a crucial technology for rapid on-site pathogen detection. However, despite its considerable promise, the widespread application of isothermal INAA amplification-based lateral flow testing faces several challenges. This review provides an overview of the INAA-LFT procedure, highlighting its advancements in detecting plant viruses. Moreover, the review underscores the imperative of addressing the existing limitations and emphasizes ongoing research efforts dedicated to enhancing the applicability and performance of this technology in the realm of rapid on-site testing.

Asunto(s)

Técnicas de Amplificación de Ácido Nucleico , Enfermedades de las Plantas , Virus de Plantas , Técnicas de Amplificación de Ácido Nucleico/métodos , Virus de Plantas/genética , Virus de Plantas/aislamiento & purificación , Enfermedades de las Plantas/virología , Técnicas de Diagnóstico Molecular/métodos , Plantas/virología , Plantas/genética

RESUMEN

For decreasing the global cost of corrosion, it is essential to understand the intricate mechanisms of corrosion and enhance the corrosion resistance of materials. However, the ambiguity surrounding the dominant mechanism of calcium-magnesium aluminosilicate (CMAS) molten salt corrosion in extreme environments hinders the mix-and-matching of the key rare earth elements for increasing the resistance of monosilicates against corrosion of CMAS. Herein, an approach based on correlated electron microscopy techniques combined with density functional theory calculations is presented to elucidate the complex interplay of competing mechanisms that control the corrosion of CMAS of monosilicates. These findings reveal a competition between thermodynamics and kinetics that relies on the temperatures and corrosion processes. Innovative medium-entropy monosilicates with exceptional corrosion resistance even at 1500 °C are developed. This is achieved by precisely modulating the radii of rare earth ions in monosilicates to strike a delicate balance between the competition in thermodynamics and kinetics. After 50 and 100 h of corrosion, the thinnest reactive layers are measured to be only 28.8 and 35.4 µm, respectively.

RESUMEN

Yak whey protein concentrates (YWPCs) have good functional properties, but there is still a gap in the study of their peptides. In this study, peptides were obtained by enzymatic hydrolysis, and the bioactivity of each ultrafiltration fraction was evaluated using an optimal process. YWPCs were isolated and purified from yak milk as the raw material. Alkaline protease, trypsin, and papain were used to hydrolyze YWPCs. The protease with the highest degree of hydrolysis (DH) and peptide concentration was selected as the most suitable enzyme. The effects of pH, temperature, time, and the enzyme-to-substrate ratio (E/S) on the DH and peptide concentration were investigated, and response surface methodology was utilized to optimize the hydrolysis process. The hydrolysate was separated using ultrafiltration membranes with molecular weight cut-offs of 10 kDa, 5 kDa, 3 kDa, and 1 kDa. The bioactivity of each ultrafiltration component was analyzed, including the inhibition rates of α-amylase and xanthine oxidase (XOD) activities and the scavenging rates of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) cation radicals. The results indicated that alkaline protease was the best enzyme for hydrolyzing YWPCs. The peptide concentration in the YWPC hydrolysate was the highest (17.21 mg/mL) at a pH of 8 and a concentration of 7500 U/g, after 2.5 h at 62 °C. The enzymatic hydrolysate was ultrafiltered to yield four peptide fractions, of which the <1 kDa peptides exhibited the highest α-amylase inhibitory activity (22.06%), XOD inhibitory activity (17.15%), and ABTS cationic free radical scavenging rate (69.55%). This demonstrates the potential of YWPC hydrolyzed peptides for hypoglycemic, uric acid-lowering, and antioxidant applications, providing a theoretical basis for the high-value utilization of YWPCs.

Asunto(s)

Antioxidantes , Benzotiazoles , Depuradores de Radicales Libres , Ácidos Sulfónicos , Animales , Bovinos , Hidrólisis , Depuradores de Radicales Libres/química , Proteína de Suero de Leche , Antioxidantes/química , Péptidos/química , Papaína/metabolismo , alfa-Amilasas , Hidrolisados de Proteína/química

RESUMEN

OBJECTIVES: To investigate the effects of electroacupuncture (EA) on the miR-381, leucine-rich repeat C4 protein (LRRC4), and downstream stromal cell-derived factor-1 (SDF-1)/CXC chemokine receptor 4 (CXCR4) signaling pathway in rat model of ischemic stroke, and to explore the mechanism by which EA improves neurological damage following ischemic stroke. METHODS: Among 50 SPF male SD rats, 10 rats were randomly selected into a sham surgery group, and the remaining rats were used to establish the middle cerebral artery occlusion (MCAO) model. The 30 successfully modeled rats were randomly divided into a model group, an EA group, and an agonist group, with 10 rats in each group. The rats in the EA group received EA at "Baihui" (GV 20) and "Dazhui" (GV 14), with disperse-dense wave, a frequency of 2 Hz/10 Hz, and a current intensity of 1 mA, 30 min per session, once daily for a total of 14 days. The rats in the agonist group received miR-381 agonist injections into the lateral ventricle, with 10 µL per injection, every 7 days for a total of 2 injections. After intervention, ZeaLonga neurobehavioral deficit score was observed in each group. HE staining was performed to observe the morphological changes in the ischemic brain tissue of rats in each group. ELISA was used to measure the levels of tumor necrosis factor alpha (TNF-α), interleukin-6 (IL-6), and nerve growth factor (NGF) in serum. Western blot was employed to detect the protein expression of LRRC4, SDF-1, CXCR4, and extracellular regulated protein kinase 1 (ERK1) in the ischemic brain tissue. Real-time PCR was utilized to assess the expression of miR-381 and LRRC4, SDF-1, CXCR4, ERK1 mRNA in the ischemic brain tissue. RESULTS: After intervention, the brain tissue showed disordered cell arrangement, reduced quantity, and significant interstitial edema, with numerous vacuoles in the model group. The pathological changes mentioned above were alleviated in the brain tissue of rats in the EA group and the agonist group. Compared with the sham surgery group, the rats in the model group exhibited increased ZeaLonga neurobehavioral deficit scores, elevated levels of serum TNF-α and IL-6 (P<0.01), and decreased serum NGF level (P<0.01)；the protein expression of SDF-1, CXCR4 and ERK1 in ischemic brain tissue was reduced (P<0.01), while LRRC4 protein expression was increased (P<0.01)；the expression of miR-381, as well as SDF-1, CXCR4 and ERK1 mRNA in ischemic brain tissue was decreased (P<0.01), while LRRC4 mRNA expression was increased (P<0.01). Compared with the model group, the rats in the EA group and the agonist group showed decreased ZeaLonga neurobehavioral deficit scores and reduced levels of serum TNF-α and IL-6 (P<0.05, P<0.01), and increased serum NGF levels (P<0.05, P<0.01); the protein expression of SDF-1, CXCR4 and ERK1 in ischemic brain tissue was increased (P<0.01), while LRRC4 protein expression was decreased (P<0.01)；the expression of miR-381, as well as SDF-1, CXCR4 and ERK1 mRNA in ischemic brain tissue was increased (P<0.05, P<0.01), while LRRC4 mRNA expression was decreased (P<0.01). CONCLUSIONS: EA at "Baihui" (GV 20) and "Dazhui" (GV 14) may promote the repair of neurological damage following ischemic stroke by up-regulating miR-381 to selectively inhibit LRRC4 expression, thereby activating the SDF-1/CXCR4 signaling pathway.

Asunto(s)

Isquemia Encefálica , Electroacupuntura , Accidente Cerebrovascular Isquémico , MicroARNs , Ratas , Masculino , Animales , Isquemia Encefálica/genética , Isquemia Encefálica/terapia , Isquemia Encefálica/metabolismo , Ratas Sprague-Dawley , Receptores CXCR4/genética , Receptores CXCR4/metabolismo , Factor de Necrosis Tumoral alfa/genética , Interleucina-6 , Factor de Crecimiento Nervioso , Transducción de Señal , MicroARNs/genética , ARN Mensajero

RESUMEN

The objective of this study was to explore the effects and mechanisms of the combination of isobavachalcone (IBC) and doxorubicin (DOX) on the progression of anaplastic thyroid cancer (ATC). Cell viability of 8505C and CAL62 cells was observed by CCK-8 assay. Kits were used to detect the presence of reactive oxygen species (ROS), glutathione (GSH), malondialdehyde (MDA), and cellular iron. Protein expression of solute carrier family 7 member 11 (SLC7A11) and glutathione peroxidase 4 (GPX4) was detected using western blot, and CD31 was detected through immunofluorescence. Tumor xenograft models of 8505C cells were constructed to observe the effect of IBC and DOX on ATC growth in vivo. The co-administration of IBC and DOX exhibited a synergistic effect of suppressing the growth of 8505C and CAL62 cells. The concurrent use of IBC and DOX resulted in elevated iron, ROS, and MDA levels, while reducing GSH levels and protein expression of SLC7A11 and GPX4. However, the Fer-1 ferroptosis inhibitor effectively counteracted this effect. In vitro and in vivo, the inhibitory effect on ATC cell proliferation and tumor growth was significantly enhanced by the combination of IBC and DOX. The combination of IBC and DOX can inhibit the growth of ATC by activating ferroptosis, and might prove to be a potent chemotherapy protocol for addressing ATC.

RESUMEN

This study examined how silicon and zinc fertilizers affect the quality and aroma of Nanjing 46. We applied nine different fertilizer treatments, one involving soil topdressing at the top fourth leaf-age stage and one involving foliar spraying during the booting stage of the silicon and zinc fertilizers. We tested the effects of the nine treatments on grain quality and aroma. Silicon and zinc fertilizers significantly affected the brown rice rate, milled rice rate, head rice rate, amylose content, gel consistency, RVA characteristic value, taste value, and aroma but did not affect the chalky grain rate, chalkiness, protein content, rice appearance, hardness, stickiness, balance, peak time, or pasting temperature. Silicon fertilizer decreased the rate of brown rice and milled rice, whereas zinc fertilizer increased the rate of brown rice and milled rice. Silicon and zinc fertilizers improved the head rice rate. Compared to silicon fertilizer, the impact of zinc fertilizer on increasing the head rice rate was more pronounced. Although the effects of silicon and zinc fertilizers on the amylose content and RVA characteristic value varied depending on the treatment, their application could lower the amylose content, increase gel consistency, improve breakdown viscosity, decrease setback viscosity, increase aroma, and improve the taste value of rice.

RESUMEN

G-quadruplexes (G4s) are non-canonical four-stranded structures and are emerging as novel genetic regulatory elements. However, a comprehensive genomic annotation of endogenous G4s (eG4s) and systematic characterization of their regulatory network are still lacking, posing major challenges for eG4 research. Here, we present EndoQuad (https://EndoQuad.chenzxlab.cn/) to address these pressing issues by integrating high-throughput experimental data. First, based on high-quality genome-wide eG4s mapping datasets (human: 1181; mouse: 24; chicken: 2) generated by G4 ChIP-seq/CUT&Tag, we generate a reference set of genome-wide eG4s. Our multi-omics analyses show that most eG4s are identified in one or a few cell types. The eG4s with higher occurrences across samples are more structurally stable, evolutionarily conserved, enriched in promoter regions, mark highly expressed genes and associate with complex regulatory programs, demonstrating higher confidence level for further experiments. Finally, we integrate millions of functional genomic variants and prioritize eG4s with regulatory functions in disease and cancer contexts. These efforts have culminated in the comprehensive and interactive database of experimentally validated DNA eG4s. As such, EndoQuad enables users to easily access, download and repurpose these data for their own research. EndoQuad will become a one-stop resource for eG4 research and lay the foundation for future functional studies.

Asunto(s)

Bases de Datos Genéticas , G-Cuádruplex , Secuencias Reguladoras de Ácidos Nucleicos , Animales , Humanos , Ratones , Genoma , Genómica

RESUMEN

INTRODUCTION: Given the increase in ultra-processed food (UPF) consumption, their potential health effects have aroused concern. Whether UPF consumption is associated with cancer and cardiovascular disease mortality is debatable. This study evaluates the association of UPF consumption with mortality. METHODS: A total of 108,714 U.S. adults from the Prostate, Lung, Colorectal and Ovarian Cancer Screening Trial (1993-2001), 208,051 UK adults from UK Biobank (2006-2010), and 41,070 U.S. adults from National Health and Nutrition Examination Survey (1999-2018) were included. Dietary data were collected by dietary questionnaire and classified using the NOVA classification. UPF consumption was expressed as the weight proportion of UPFs in total foods consumed. Cox proportional hazard models were used to calculate hazard ratios and 95% CIs. Mediation analysis was used to evaluate whether multiple metabolic pathways mediated the associations in UK Biobank. Analyses were performed in 2022-2023. RESULTS: Combined analyses of the three cohorts showed that those with the highest quartile of UPF consumption had higher risks of all-cause mortality (hazard ratio, 1.16; 95% CI, 1.11-1.20) and cardiovascular disease mortality (hazard ratio, 1.17; 95% CI, 1.06-1.28) compared to the lowest quartile of UPF consumption. UPF consumption was not associated with cancer mortality risk. Biomarkers of liver function have the greatest mediating effects on all-cause mortality (20.3%), and biomarkers of inflammation have the greatest mediating effects on cardiovascular disease mortality (29.2%). CONCLUSIONS: Higher UPF consumption was associated with increased all-cause and cardiovascular disease mortality risk, with multiple metabolic pathways playing mediating roles.

Asunto(s)

Enfermedades Cardiovasculares , Neoplasias , Adulto , Humanos , Masculino , Biomarcadores , Estudios de Cohortes , Dieta , Comida Rápida/efectos adversos , Manipulación de Alimentos , Alimentos Procesados , Encuestas Nutricionales , Reino Unido/epidemiología , Femenino , Ensayos Clínicos como Asunto

RESUMEN

The cancer burden in China is increasing. We aimed to assess the time trends in the prevalence of 16 modifiable risk factors involved in lifestyle, diet, infection, and air pollution between 1997 and 2025 based on the China Health and Nutrition Survey, the Global Burden of Disease website, and publically available studies. The population attributable fraction (PAF) and its 95% uncertainty interval (UI) from 2007 to 2035 were calculated to quantify the attributable cancer burden in major 12 anatomic sites using the comparative risk assessment method, considering a 10-year lag effect. As a result, 1,559,476 cancer cases (PAF = 54.1%, 95% UI: 36.8%-65.8%) from the 12 anatomic sites were attributable to these modifiable risk factors in 2007, with lung, liver, and gastric cancer raging the top three. It was predicted that by 2035, the attributable cancer cases would reach 1,680,098 (PAF = 44.2%, 95% UI: 29.1%-55.5%), with the top three of lung, liver, and colorectal cancer. Smoking, physical inactivity, insufficient fruit consumption, HBV infection, and Helicobacter pylori infection were the most attributable risk factors in 2007, contributing to 480,352, 233,684, 215,009, 214,455, and 187,305 associated cancer cases, respectively. In 2035, the leading factors for cancer would be smoking, physical inactivity, insufficient fruit intake, HPV infection, and HBV infection, resulting in 427,445, 424,327, 185,144, 156,535, and 154,368 cancer cases, respectively. Intervention strategies should be swiftly established and dynamically altered in response to risk factors like smoking, physical inactivity, poor fruit intake, and infectious factors that may cause a high cancer burden in the Chinese population.

Asunto(s)

Infecciones por Helicobacter , Helicobacter pylori , Neoplasias , Humanos , Factores de Riesgo , Fumar/efectos adversos , Fumar/epidemiología , Neoplasias/epidemiología , Neoplasias/etiología