Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 4 de 4
Filtrar
Más filtros











Intervalo de año de publicación
1.
Heliyon ; 9(7): e18031, 2023 Jul.
Artículo en Inglés | MEDLINE | ID: mdl-37539316

RESUMEN

Local anesthetics are frequently used by dentists to relieve localized discomfort of the patient and improve treatment conditions. The risk of paresthesia after local anesthesia is frequently encountered in dental clinics. The neurotoxicity of local anesthetics is a disregarded factor in paresthesia. The review summarizes the types of common local anesthetics, incidence and influencing factors of paresthesia after local anesthesia, and systematically describes the neurotoxicity mechanisms of dental local anesthetic. Innovative strategies may be developed to lessen the neurotoxicity and prevent paresthesia following local anesthesia with the support of a substantial understanding of paresthesia and neurotoxicity.

2.
Biochem Pharmacol ; 215: 115692, 2023 09.
Artículo en Inglés | MEDLINE | ID: mdl-37481133

RESUMEN

Perineural invasion (PNI) is the process through which tumors invade and interact with nerves. The dynamic changes in the nerves caused by PNI may induce disturbing symptoms. PNI-related cancer pain in neuro-rich tumors has attracted much attention because the occurrence of tumor-induced pain is closely related to the invasion of nerves in the tumor microenvironment. PNI-related pain might indicate the occurrence of PNI, guide the improvement of treatment strategies, and predict the unresectability of tumors and the necessity of palliative care. Although many studies have investigated PNI, its relationship with tumor-induced pain and its common mechanisms have not been summarized thoroughly. Therefore, in this review, we evaluated the relationship between PNI and cancer-associated pain. We showed that PNI is a major cause of cancer-related pain and that this pain can predict the occurrence of PNI. We also elucidated the cellular and molecular mechanisms of PNI-induced pain. Finally, we analyzed the possible targets for alleviating PNI-related pain or combined antitumor and pain management. Our findings might provide new perspectives for improving the treatment of patients with malignant tumors.


Asunto(s)
Dolor en Cáncer , Neoplasias , Humanos , Dolor en Cáncer/etiología , Dolor/etiología , Microambiente Tumoral , Neoplasias/complicaciones
3.
Biochem Pharmacol ; 200: 115039, 2022 06.
Artículo en Inglés | MEDLINE | ID: mdl-35436465

RESUMEN

Podophyllotoxin (PPT) has attracted researchers' attention because of its ability to treat various ailments. A series of podophyllotoxin derivatives (PPTs) have been synthesized as candidate drugs to improve the pharmacological characteristics of PPT. Nowadays, an increasing number of reviews have summarized structure-optimization, anticancer application, and single nano delivery of PPT and PPTs. In this review, we focus on the multidirectional pharmacological properties of PPT and PPTs, with an emphasis on the crosstalk with anticancer, anti-inflammatory, immunosuppression, and antivirals. Besides, the newly uncovered mechanisms governing PPT and PPTs in anticancer property including non-apoptotic regulated cell death are discussed. Moreover, their co-delivery nanocarriers with other antitumor drugs or biological agents that have the potential to achieve increased targeting efficacy are included. We hope that a better comprehension of this subject will help to provide a reference for improving the druggability and expanding the clinical application of podophyllotoxin and its derivatives.


Asunto(s)
Antineoplásicos , Podofilotoxina , Antineoplásicos/farmacología , Antineoplásicos/uso terapéutico , Podofilotoxina/farmacología , Podofilotoxina/uso terapéutico
4.
Chinese Journal of Biotechnology ; (12): 131-135, 2003.
Artículo en Chino | WPRIM (Pacífico Occidental) | ID: wpr-270126

RESUMEN

Vascular-resided bacterial and fungal diseases have caused a great deal of yield loss and quality reduction in crop production world-wide. For genetic engineering of crops resistant to these diseases, it is disirable to have a strong and vascular-specific promoter. This article reviews the progress in identification of vascular-specific promoters and its function. To date, roughly twenty vascular-specific promoters have been documented. The cis-elements and motifs have been studied in detail for the promoters of bean phenylalanine ammonia lyase (PAL2), bean glycine-rich protein (grp 1.8) and Arabidopsis profilin2 (pfn2) in particular.The motif of vs-1 (CATGCTCCGTTGGATGTGGAAGACAGCA) found in grp 1.8 promoter was a cis-element that specificically bind to a transcription activation factor VSF-1 protein (one of the bZIP proteins). Mutation of vs-1 prevented it from binding to VSF-1 that resulted in abolishing the vascular-specific expresson of gus gene. Motifs of AC-I and AC-II found in PAL2 promoter were also found to be essential for vascular-specific expression. In our laboratory we have dissected pfn2 promoter into three domains (A, B, C) through 5'-deletion analysis. In this promoter we have identified two core sequences of ACGT that is commonly found in the binding sites of bZIP protein, the most abundent transcription factor existed in plants. In additon, the pfn2 promoter also contains an AC- I like sequence (CCACCTAC) that is similar to the AC- I motif (CCCACCTACC) found in PAL2 promoter. These promoters and cis-elements may have a wide range of potential applications to the genetic improvement of crops resistant to vascular diseases.


Asunto(s)
Regulación de la Expresión Génica de las Plantas , Genética , Fisiología , Fenilanina Amoníaco-Liasa , Genética , Proteínas de Plantas , Genética , Regiones Promotoras Genéticas , Genética , Secuencias Reguladoras de Ácidos Nucleicos , Genética
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA