RESUMEN
Olmesartán es un potente antagonista de los receptores de la angiotensina II utilizado habitualmente en el tratamiento de la hipertensión arterial. Durante la última década se han descrito varios casos de enteropatía tipo esprúe asociados al uso de este fármaco, con afectación clínica severa que precisan hospitalización, pero afortunadamente con remisión completa tras la retirada del mismo. Se presenta el caso de una mujer de 82 años pluripatológica, con un síndrome diarreico crónico que derivó en una pérdida de 20kg de peso en los últimos tres meses. Para su hipertensión seguía doble terapia: olmesartán 40mg y lercanidipino 10mg/día. Basado en los hallazgos de la paciente presentada, se realiza una búsqueda bibliográfica de todos los casos publicados en revistas indexadas españolas (PubMed) y se comparan, intentando establecer un perfil de sospecha que promueva la suspensión de olmesartán y acelere las pruebas complementarias necesarias para descartar otros diagnósticos.(AU)
Olmesartan is a potent angiotensin II receptor antagonist commonly used in the treatment of high blood pressure. During the last decade, several cases of sprue-like enteropathy have been described associated with the use of this drug - with severe clinical involvement that requires hospitalization - but fortunately with complete remission after its discontinuation. We present the case of a multi-pathological 82-year-old woman with a chronic diarrhoeal syndrome that resulted in a weight loss of 20kg over the last three months. She was prescribed dual therapy for her hypertension: olmesartan 40mg, torasemide 10mg, and lercanidipine 10mg/day. Based on the findings of the patient presented, we conducted a literature search of all the cases published in Spanish indexed journals (PubMed) and compared them, attempting to establish a suspicion profile that would result in the suspension of olmesartan and accelerate the complementary tests necessary to rule out other diagnoses.(AU)
Asunto(s)
Humanos , Femenino , Anciano de 80 o más Años , Olmesartán Medoxomilo/efectos adversos , Olmesartán Medoxomilo/análisis , Hipertensión , Diarrea , Mujeres , Anciano de 80 o más AñosRESUMEN
Olmesartan is a potent angiotensin II receptor antagonist commonly used in the treatment of high blood pressure. During the last decade, several cases of sprue-like enteropathy have been described associated with the use of this drug - with severe clinical involvement that requires hospitalization - but fortunately with complete remission after its discontinuation. We present the case of a multi-pathological 82-year-old woman with a chronic diarrhoeal syndrome that resulted in a weight loss of 20kg over the last three months. She was prescribed dual therapy for her hypertension: olmesartan 40mg, torasemide 10mg, and lercanidipine 10mg/day. Based on the findings of the patient presented, we conducted a literature search of all the cases published in Spanish indexed journals (PubMed) and compared them, attempting to establish a suspicion profile that would result in the suspension of olmesartan and accelerate the complementary tests necessary to rule out other diagnoses.
Asunto(s)
Enfermedad Celíaca , Hipertensión , Anciano de 80 o más Años , Diarrea/patología , Femenino , Humanos , Hipertensión/tratamiento farmacológico , Imidazoles/efectos adversos , Tetrazoles/efectos adversosRESUMEN
Sleeping sickness is a fatal disease caused by the protozoan parasite Trypanosoma brucei (Tb). Inosine-5'-monophosphate dehydrogenase (IMPDH) has been proposed as a potential drug target, since it maintains the balance between guanylate deoxynucleotide and ribonucleotide levels that is pivotal for the parasite. Here we report the structure of TbIMPDH at room temperature utilizing free-electron laser radiation on crystals grown in living insect cells. The 2.80 Å resolution structure reveals the presence of ATP and GMP at the canonical sites of the Bateman domains, the latter in a so far unknown coordination mode. Consistent with previously reported IMPDH complexes harboring guanosine nucleotides at the second canonical site, TbIMPDH forms a compact oligomer structure, supporting a nucleotide-controlled conformational switch that allosterically modulates the catalytic activity. The oligomeric TbIMPDH structure we present here reveals the potential of in cellulo crystallization to identify genuine allosteric co-factors from a natural reservoir of specific compounds.
Asunto(s)
Coenzimas/química , Cristalización , IMP Deshidrogenasa/química , Trypanosoma brucei brucei/enzimología , Secuencia de Aminoácidos , Animales , Sitios de Unión , Dominio Catalítico , Clonación Molecular , Guanosina Monofosfato , Modelos Moleculares , Conformación Proteica , Células Sf9 , Trypanosoma brucei brucei/genéticaAsunto(s)
Agammaglobulinemia/genética , Enfermedades Genéticas Ligadas al Cromosoma X/genética , Absceso Piógeno Hepático/inmunología , Mutación , Infecciones Oportunistas/inmunología , Proteínas Tirosina Quinasas/genética , Infecciones por Pseudomonas/inmunología , Pseudomonas aeruginosa/inmunología , Agammaglobulinemia Tirosina Quinasa , Agammaglobulinemia/diagnóstico , Agammaglobulinemia/tratamiento farmacológico , Agammaglobulinemia/inmunología , Antibacterianos/uso terapéutico , Antifúngicos/uso terapéutico , Candidiasis/tratamiento farmacológico , Candidiasis/inmunología , Candidiasis/microbiología , Análisis Mutacional de ADN , Enfermedades Genéticas Ligadas al Cromosoma X/diagnóstico , Enfermedades Genéticas Ligadas al Cromosoma X/tratamiento farmacológico , Enfermedades Genéticas Ligadas al Cromosoma X/inmunología , Predisposición Genética a la Enfermedad , Humanos , Huésped Inmunocomprometido , Inmunoglobulinas Intravenosas/uso terapéutico , Lactante , Absceso Piógeno Hepático/diagnóstico , Absceso Piógeno Hepático/tratamiento farmacológico , Absceso Piógeno Hepático/microbiología , Masculino , Infecciones Oportunistas/diagnóstico , Infecciones Oportunistas/tratamiento farmacológico , Infecciones Oportunistas/microbiología , Fenotipo , Infecciones por Pseudomonas/diagnóstico , Infecciones por Pseudomonas/tratamiento farmacológico , Infecciones por Pseudomonas/microbiología , Pseudomonas aeruginosa/efectos de los fármacos , Resultado del TratamientoRESUMEN
Phytophthora decline of riparian alder (Alnus spp.) has been reported in several European countries (2). Death of common alder (Alnus glutinosa) due to Phytophthora alni has also been reported in Spain (4). During several surveys of alder trees in September 2012, typical dieback symptoms, including sparse small yellowish foliage and the presence of rusty exudates on the bark at the collar and lower stem were observed in A. glutinosa growing on the banks of the river Tera (Langa de Duero, Soria, 41°36'34â³ N, 3°25'10â³ W, elevation 851 m) and the river Tormes (La Maya, Salamanca, 40°41'42â³ N, 5°35'36â³ W, elevation 833 m). Bark samples plus cambium were taken from the active lesions at collar region, cut into small pieces, dried on filter paper, and plated on V8-PARPH agar (2). The samples were incubated for 4 days at 20°C in the dark before obtaining the Phytophthora isolates. Colonies developed on V8 juice agar (V8A) had limited aerial mycelium at the center and displayed radiate and slightly chrysanthemum-like growth pattern. Mycelial growth was optimal at 25°C (radial growth rate, 8.2 mm d-1), whereas no growth was observed at 32°C. Isolates were homothallic with paragynous antheridia, smooth-walled spherical (very rarely elongated) oogonia (22.8 to 30.6 µm diam.) and both plerotic and aplerotic golden brown oospores (21.3 to 28.5 µm diam.). In non-sterile soil extracts, the isolates produced abundant sporangia (31.5 to 57.2 × 21.3 to 38.4 µm; length:breadth ratio 1.2 to 1.6) borne terminally on unbranched or sympodial sporagiophores, occasionally attached laterally to the sporangiophores. Sporagia were non-caducous, semipapillate, mainly ovoid and obpyriform, obovoid to limoniform but sometimes distorted with two apices. On the basis of the morpho-physiological features, the isolates resembled P. plurivora (formerly identified as P. citricola) (3). To confirm this, genomic DNA was extracted and subjected to PCR. The internal transcribed spacer (ITS) region of the rDNA was amplified using the ITS-6 (5' GAAGGTGAAGTCGTAACAAGG 3') and ITS-4 (5' TCCTCCGCTTATTGATATGC 3') primers before sequencing (Secugen, Madrid, Spain). The sequences were deposited in the EMBL/GenBank database (Accession Nos. KF413074 and KF413075). In order to perform the pathogenicity test, 10 A. glutinosa seedlings (2 years old) per isolate were inoculated by using the under-bark inoculation technique (1) and 10 control seedlings were inoculated with V8A. Seedlings were incubated in a growth chamber at 22.5°C with a 14-h photoperiod. Three months after inoculation, all inoculated plants wilted and died, whereas the control plants showed no disease symptoms. To fulfill Koch's postulates, the pathogen was re-isolated from the necrotic lesions developed around inoculation points, thus confirming its pathogenicity. P. plurivora has been found to be present in rhizosphere soil beneath Alnus spp. and to cause aerial canker and collar rot on alder trees in Austria, Germany, and Romania (2,3). Further studies and surveys are essential to determine the distribution, extent of damage, and potential interactions with other alder pathogens (e.g., P. alni). To our knowledge, this is the first record of P. plurivora affecting A. glutinosa in Spain. References: (1) T. Jung et al. Eur. J. For. Pathol. 26:253, 1996. (2) T. Jung and M. Blaschke. Plant Pathol. 53:197, 2004. (3) T. Jung and T. I. Burgess. Persoonia 22:95, 2009. (4) A. Solla et al. Plant Pathol. 59:798, 2010.
RESUMEN
Introducción: La incidencia de las reacciones adversas a medicamentos en pediatría se ha establecido recientemente en 15,1 reacciones por 1.000 niños. Representa un 2% de las admisiones de un hospital pediátrico, similares a las del paciente adulto, y de ellas solo un pequeño porcentaje (menos del 8%) cursan con afectación hepática, que puede ir desde un ligero aumento de las transaminasas hasta una hepatitis fulminante. El objetivo de este estudio ha sido determinar la importancia (frecuencia, formas de presentación, gravedad y cronificación) de la hepatotoxicidad por fármacos o remedios naturales en la población pediátrica. Pacientes y método: Se han incluido a todos los pacientes pediátricos, neonatos y niños en los que se ha sospechado una reacción hepatotóxica, remitidos de 8 hospitales españoles participantes. Para el análisis de la causalidad de cada caso se aplica la escala de Council for International Organizations of Medical. Sciences (CIOMS). Resultados y conclusiones: Se estudian un total de 36 reacciones hepatotóxicas en 33 niños. Los grupos farmacológicos involucrados con mayor frecuencia fueron los antitinfecciosos (71%). Amoxicilina-clavulánico fue el fármaco individual responsable del mayor número de casos (31,4%). Se concluye que el registro de hepatopatías asociadas a medicamentos ha demostrado ser un instrumento útil para la creación de una red activa de especialistas motivados en la detección y comunicación de incidencias de hepatopatía tóxica, aumentando las garantías de certeza diagnóstica(AU)
Introduction: The incidence of adverse drug reactions in children has recently been established at 15.1 reactions per 1000 children. This represents 2% of admissions to a paediatric hospital, and is similar to adult patients. Only a small percentage (less than 8%) may have liver involvement, which can range from a slight increase in transaminases to fulminant hepatitis. The aim of this study was to determine the importance (frequency, types of presentation, severity and chronicity) of hepatotoxicity by drugs or natural remedies in the paediatric population. Patients and method: All paediatric patients, neonates and children who had suspected hepatotoxic reactions notified by the eight participating Spanish hospitals. The Council for International Organizations of Medical Sciences (CIOMS) scale was used for the analysis of causality in each case. Results and conclusions: We studied a total of 36 hepatotoxic reactions in 33 children. The drug classes most frequently involved were antimicrobials (71%). Amoxicillin-clavulanate was the individual drug responsible for the greatest number of cases (31.4%). We conclude that the registration of drugs associated with liver disease has proved a useful tool for creating an active network of motivated specialists in detecting and reporting incidents of toxic liver disease, ensuring increasing diagnostic accuracy(AU)
Asunto(s)
Humanos , Masculino , Femenino , Niño , Enfermedad Hepática Inducida por Sustancias y Drogas/diagnóstico , Antiinfecciosos/efectos adversos , /epidemiología , Factores de Riesgo , Estudios ProspectivosRESUMEN
INTRODUCTION: The incidence of adverse drug reactions in children has recently been established at 15.1 reactions per 1000 children. This represents 2% of admissions to a paediatric hospital, and is similar to adult patients. Only a small percentage (less than 8%) may have liver involvement, which can range from a slight increase in transaminases to fulminant hepatitis. The aim of this study was to determine the importance (frequency, types of presentation, severity and chronicity) of hepatotoxicity by drugs or natural remedies in the paediatric population. PATIENTS AND METHOD: All paediatric patients, neonates and children who had suspected hepatotoxic reactions notified by the eight participating Spanish hospitals. The Council for International Organizations of Medical Sciences (CIOMS) scale was used for the analysis of causality in each case. RESULTS AND CONCLUSIONS: We studied a total of 36 hepatotoxic reactions in 33 children. The drug classes most frequently involved were antimicrobials (71%). Amoxicillin-clavulanate was the individual drug responsible for the greatest number of cases (31.4%). We conclude that the registration of drugs associated with liver disease has proved a useful tool for creating an active network of motivated specialists in detecting and reporting incidents of toxic liver disease, ensuring increasing diagnostic accuracy.
Asunto(s)
Productos Biológicos/efectos adversos , Enfermedad Hepática Inducida por Sustancias y Drogas/etiología , Medicamentos bajo Prescripción/efectos adversos , Adolescente , Enfermedad Hepática Inducida por Sustancias y Drogas/diagnóstico , Enfermedad Hepática Inducida por Sustancias y Drogas/epidemiología , Niño , Preescolar , Femenino , Humanos , Lactante , Masculino , Preparaciones Farmacéuticas , Estudios Prospectivos , RegistrosAsunto(s)
Humanos , Masculino , Femenino , Triaje/métodos , Triaje , Cuidados Críticos/legislación & jurisprudencia , Cuidados Críticos/métodos , Cuidados Críticos/organización & administración , 34661/métodos , Reubicación Posdesastre , Triaje/organización & administración , Triaje/provisión & distribución , Triaje/tendencias , 35158RESUMEN
The basidiomycete Heterobasidion annosum (Fr.) Bref. (=Fomes annosus (Fr.) Cooke), one of the most important pathogens in coniferous forests in Europe, Asia, and North America, causes root and butt rot. H. annosum was first recorded on Pinus pinaster Ait. (commonly known as Maritime pine) in France and Great Britain in 1961 (4) and Portugal in 1986 (2). P. pinaster is the most widespread conifer in Spain, with more than 700,000 and 600,000 ha in pure and mixed stands, respectively. Over the last few years, P. pinaster decline was observed in several stands in the center of the Iberian Peninsula. Unusual crown transparency, small needles, foliage discoloration, and early tree death are characteristic decline symptoms associated with the high mortality rate on this species. In June of 2010, 11 trees (40 to 60 years old) with a different degree of decline were felled in two zones (42°2'41â³N, 3°18'14â³W, elevation 1,096 m and 41°55'40â³N, 3°12'3â³W, elevation 1,128 m) and cut into sections (stump height, breast height, and near the top). Wood slices were removed from each section and taken to the laboratory. Samples were placed in moist chambers with optimal conditions of humidity and temperature to enhance pathogen growth. After 20 days of incubation in darkness at 25°C, H. annosum (anamorph Spiniger meineckellum [A. Olson] Stalpers) occurred on most of these slices. Conidiophores with subglobose to pyriform conidia (5.8 × 4.2 µm) were observed with a compound microscope. The fungus was isolated to extract DNA by disruption of the mycelium followed by washes with phenol/chloroform/isoamyl alcohol solution (25:24:1). DNA was precipitated with 20% polyethylene glycol solution. PCR was carried out according to the instructions of the manufacturer of Dynazyme II DNA polymerase (Finnzymes Ltd, Espoo, Finland) with ITS primers, 1F (5'-CTTGGTCATTTAGAGGAAGTAA-3') and 4 (5'-TCCTCCGCTTATTGATATGC-3'). After DNA purification, samples were sequenced (SECUGEN, Madrid, Spain) and aligned and corrected with Geneious Pro 5.3 to obtain the consensus sequences. Resulting DNA sequences of two isolates were deposited in GenBank (Nos. FR850494 and FR850495), and compared with a Blastn search at GenBank showing 100% identity and 100% coverage with H. annosum sensu stricto, former ISG-P (intersterility group of pines). For pathogenicity tests, 10 seedlings (2 year old) were inoculated with autoclaved P. pinaster wood chips colonized by H. annosum, and 10 control seedlings were inoculated with noncolonized wood chips. Inoculums were prepared by growing H. annosum on 4-mm-diameter wood chips placed on potato dextrose agar media for 3 weeks. The wood chips were put inside an oblique incision made at 6 cm above the soil line and wrapped with Parafilm. After 8 weeks in a growth chamber at 22.5°C with a 14-h photoperiod, the inoculated seedlings showed typical symptoms and 3 seedlings of 10 were dead. H. annosum was previously recorded on P. sylvestris in central Spain (1), causing needle drop, swelling at the stump height, and presence of dead trees by circular areas. This pathogen was also reported on P. nigra in northeastern Spain, associated with defoliation and mortality (3). To our knowledge, this is the first record of H. annosum on P. pinaster in Spain. References: (1) J. Benito-Martínez. An. Jardín Bot. Madrid 3:23, 1943. (2) N. Neves et al. EPPO Bull. 16:505, 1986. (3) J. Oliva et al. Bol. Sanidad Vegetal. Plagas. 34:415, 2008. (4) P. Spaulding. US Dep. Agric. Agric. Handb. 197:100, 1961.
RESUMEN
Objetivo. Analizar el papel de la biopsia con aguja gruesa de adenopatías axilares con sospecha ecográfica de metástasis en pacientes con cáncer de mama, y la correlación radiopatológica. Material y métodos. Estudio retrospectivo de 74 pacientes diagnosticadas de cáncer de mama, a las que se realizó biopsia con aguja gruesa ecoguiada de adenopatías axilares con características ecográficas indicativas de metástasis. Consideramos hallazgos ecográficos sospechosos de metástasis: engrosamiento cortical, alteración de la grasa hiliar y/o flujo vascular cortical no hiliar. Las pacientes con biopsia axilar negativa se incluyeron en el protocolo de biopsia de ganglio centinela. Resultados. La biopsia con aguja gruesa confirmó metástasis ganglionar en 47 (63,5%) pacientes. Las 27 pacientes (36,5%) con biopsia negativa se incluyeron en el protocolo de biopsia de ganglio centinela y 3 (11%) presentaron ganglio centinela positivo, realizándose linfadenectomía axilar. De las 50 adenopatías con metástasis, 44 (88%) presentaron engrosamiento cortical, 20 (40%) alteración de la grasa hiliar y 29 (58%) flujo vascular cortical no hiliar. En todas las adenopatías con engrosamiento cortical y flujo vascular cortical no hiliar la biopsia fue positiva, indicando un valor predictivo positivo del 100% en esta serie. Conclusiones. La biopsia con aguja gruesa ecoguiada de adenopatías axilares con sospecha ecográfica de metástasis por cáncer de mama es un procedimiento con alta efectividad diagnóstica y baja morbilidad. La presencia de engrosamiento cortical y flujo vascular cortical no hiliar en la misma adenopatía mostró un valor predictivo positivo del 100% en esta serie (AU)
Objective. To analyze the role of core needle biopsy of axillary lymph nodes with suspected metastases from breast cancer and to correlate the imaging and histologic findings. Material and methods. We retrospectively studied 74 patients diagnosed with breast cancer who underwent ultrasound-guided core needle biopsy of axillary lymph nodes with characteristics suggestive of metastases on ultrasonography. The following ultrasonographic findings were considered suspicious for metastases: cortical thickening and changes in the hilar fat and/or non-hilar cortical vascular flow. Patients with negative findings after axillary biopsy underwent sentinel node biopsy. Results. Core needle biopsy confirmed lymph node metastases in 47 (63.5%) patients. The 27 patients (36.5%) with negative findings after lymph node biopsy underwent sentinel node biopsy; 3 (11%) of these had a positive sentinel lymph node and underwent axillary lymph node resection. Of the 50 lymph nodes with metastases, 44 (88%) had cortical thickening, 20 (40%) had changes in the hilar fat, and 29 (58%) had non-hilar cortical vascular flow. All biopsies of lymph nodes with both cortical thickening and non-hilar cortical vascular flow were positive, yielding a 100% positive predictive value in this series. Conclusions. Ultrasound-guided core needle biopsy of axillary lymph nodes that are suspicious for metastases from breast cancer at ultrasonography is a highly effective procedure that has low morbidity. Findings of cortical thickening and non-hilar cortical vascular flow in the same lymph node yield a positive predictive value of 100% in this series (AU)
Asunto(s)
Humanos , Femenino , Adulto , Persona de Mediana Edad , Anciano , Anciano de 80 o más Años , Neoplasias de la Mama , Biopsia con Aguja , Mamografía/métodos , Ultrasonografía Mamaria/tendencias , Axila/patología , Axila , Estudios Retrospectivos , Valor Predictivo de las PruebasRESUMEN
OBJECTIVE: To analyze the role of core needle biopsy of axillary lymph nodes with suspected metastases from breast cancer and to correlate the imaging and histologic findings. MATERIAL AND METHODS: We retrospectively studied 74 patients diagnosed with breast cancer who underwent ultrasound-guided core needle biopsy of axillary lymph nodes with characteristics suggestive of metastases on ultrasonography. The following ultrasonographic findings were considered suspicious for metastases: cortical thickening and changes in the hilar fat and/or non-hilar cortical vascular flow. Patients with negative findings after axillary biopsy underwent sentinel node biopsy. RESULTS: Core needle biopsy confirmed lymph node metastases in 47 (63.5%) patients. The 27 patients (36.5%) with negative findings after lymph node biopsy underwent sentinel node biopsy; 3 (11%) of these had a positive sentinel lymph node and underwent axillary lymph node resection. Of the 50 lymph nodes with metastases, 44 (88%) had cortical thickening, 20 (40%) had changes in the hilar fat, and 29 (58%) had non-hilar cortical vascular flow. All biopsies of lymph nodes with both cortical thickening and non-hilar cortical vascular flow were positive, yielding a 100% positive predictive value in this series. CONCLUSIONS: Ultrasound-guided core needle biopsy of axillary lymph nodes that are suspicious for metastases from breast cancer at ultrasonography is a highly effective procedure that has low morbidity. Findings of cortical thickening and non-hilar cortical vascular flow in the same lymph node yield a positive predictive value of 100% in this series.
Asunto(s)
Biopsia con Aguja/métodos , Neoplasias de la Mama/diagnóstico por imagen , Neoplasias de la Mama/patología , Carcinoma/diagnóstico por imagen , Carcinoma/patología , Ganglios Linfáticos/patología , Cuidados Preoperatorios/métodos , Biopsia del Ganglio Linfático Centinela/métodos , Ultrasonografía Intervencional , Adulto , Anciano , Anciano de 80 o más Años , Axila , Neoplasias de la Mama/cirugía , Carcinoma/cirugía , Femenino , Humanos , Metástasis Linfática , Persona de Mediana Edad , Estadificación de Neoplasias , Estudios RetrospectivosRESUMEN
Se pretende con esta práctica iniciar al alumno de Farmacia que cursa la asignatura de GeologíaAplicada, en las técnicas más novedosas de cristalización de macromoléculas biológicas. ¿Por qué leconviene al alumno realizar esta práctica? Porque la determinación de las estructuras de lasmacromoléculas biológicas y de otras muchas sustancias de interés sanitario, se realiza en laactualidad principalmente por difracción de Rayos X (DRX) y el primer paso de esta técnica escristalizarlas, lo que es realmente difícil de realizar. Para ello empleamos los dispositivos GCB(Granada Crystallization Box) desarrollados y patentados por uno de los autores, que sirven pararealizar estos experimentos de forma fácil y económica. Durante el curso 2009-2010 se han realizadopor primera vez este tipo de prácticas en la Facultad de Farmacia de Granada con un rotundo éxito yqueremos extrapolar nuestra experiencia a todas las Facultades de Farmacia que participen en estecongreso. Se le enseña al alumno la importancia que tiene la Biocristalografía para conocer lasestructuras cristalinas de antibióticos, hormonas, proteínas y principios activos de medicamentos.Muchos Premios Nóbel de Química y Medicina que han hecho avanzar disciplinas como la BiologíaMolecular y Estructural son cristalógrafos. La Biocristalografía es, por tanto, una ciencia básica parala investigación puntera, apoyo imprescindible para muchas asignaturas troncales. Una Facultad queno contemple estos estudios como obligatorios está descuidando la formación de sus alumnos(AU)
The aim of this practice on Biocrystallography is to introduce pharmacy students learning GeologyApplied to Pharmacy, in the latest techniques of crystallization of biological macromolecules(especially proteins). Students should improve this practice because the determination of the structuresof biological macromolecules and other substances of interest in Pharmacy, are now carried out by Xraydiffraction. A first step in this technique is crystallization of these molecules, and this matter isreally difficult. We use a GCB devices (Granada Crystallization Box) developed and patented by oneof the authors, to perform such experiments easily and inexpensively. This practice was firstperformed in the period 2009-2010 obtaining a great success and we want to extrapolate ourexperience to all pharmacy schools participating in this conference. We teach the students theimportance of Biocrystallography to know the structures of antibiotics, hormones, proteins and activeingredients of drugs. Many Nobel Laureates in Chemistry and Medicine, with have advanceddisciplines such as Molecular and Structural Biology, are crystallographers. The Biocrystallography istherefore a basic discipline to conduct first class research and is also a support for many otherimportant subjects. A Faculty that has not granted obligatorily such studies neglects the education oftheir students(AU)
Asunto(s)
Humanos , Masculino , Femenino , Adulto , Prácticas Clínicas/métodos , Cristalización/métodos , Estudiantes de Farmacia , Educación en Farmacia/métodos , Geología/educación , Biología Molecular/educación , Cristalografía/métodos , CristalografíaRESUMEN
El estudio de las materias primas farmacéuticas y cosméticas de origen mineral, sus propiedades,métodos de investigación específicos, normas de obligado cumplimiento para el uso y otros nuevosámbitos y aplicaciones de carácter sanitario que se han ido abriendo con el desarrollo de la Ciencia yla Técnica durante las últimas décadas, ha sido una asignatura de obligada impartición en los estudiosde Farmacia hasta la implantación del Nuevo Grado auspiciado por la puesta en práctica del PlanBolonia.En esta Comunicación se relata la historia de la asignatura, sus diferentes denominaciones y profesoresque ha tenido; se analizan en detalle sus contenidos científicos actuales y sus retos futuros: Todo elloen el marco del papel jugado hasta el presente en la Facultad de Farmacia en la formación delfarmacéutico, y para componer una base científica y argumental, que permita analizar objetivamente lasituación actual y las perspectivas futuras(AU)
The study of pharmaceutical and cosmetic mineral raw materials, their properties, their specificresearch methods, regulating norms and test for their use, and other new applications for the humanhealth that have been opened during the last decades owing to the development of Science andTechnology, has been a obligatory subject of teaching in the Pharmacy studies of the GranadaUniversity until the implantation of the new studies of Grade promoted by the Bologna Process.This communication relates the history of the subject "Applied Geology to Pharmacy", their differentdenominations and Professors who have had, analyzes in detail the current scientific content and itsfuture lines of research and challenges. All these discussions in the context of the role that has playeduntil today in the Faculty of Pharmacy as in the training of pharmaceutics. And to compose a scientificbasis and line of thinking, which allows to objectively analyze the current situation and future of thesubject "Applied Geology to Pharmacy"(AU)
Asunto(s)
Humanos , Masculino , Femenino , Adulto , Geología/educación , Educación en Farmacia/métodos , Industria Cosmética , Tecnología de Cosméticos , Educación en Farmacia/organización & administración , Educación en Farmacia/tendencias , Ciencias del Suelo/métodos , Conocimientos, Actitudes y Práctica en Salud , Cristalografía/métodosRESUMEN
The intensive care units must be prepared for a possible disaster, whether internal or external, in case it becomes necessary to evacuate the in-patients. They must have an Emergency and Self-protection Plan that includes the patient evacuation criteria and this must be known by all the personnel who work in the service. For that reason, the patients must be triaged, based on their attention priorities, according to their survival possibilities. Having an evacuation, known by all the personnel and updated by means of the performance of periodic drills, should be included as a quality indicator that must be met, since this would achieve better attention to the patient in case of a disaster situation requiring the evacuation of the ICU.
Asunto(s)
Urgencias Médicas , Unidades de Cuidados Intensivos/normas , Indicadores de Calidad de la Atención de SaludRESUMEN
Las unidades de cuidados intensivos deben estar preparadas para un eventual desastre, bien sea de índole interno o externo, donde sea necesario evacuar a los pacientes ingresados. Deben disponer de un Plan de Emergencia y Autoprotección donde estén recogidos los criterios de evacuación de los pacientes, que debe conocer todo el personal que trabaja en el servicio. Para esto, habrá que hacer un triaje a los pacientes basándose en las prioridades de atención y según las posibilidades de supervivencia. El disponer de un plan de evacuación, conocido por todo el personal y actualizado mediante la realización de simulacros periódicos, debería incluirse como un indicador de calidad que se debería cumplir, ya que con esto se conseguiría una mejor atención al paciente en caso de presentarse una situación de desastre donde hubiere que evacuar la unidad de cuidados intensivos (AU)
The intensive care units must be prepared for a possible disaster, whether internal or external, in case it becomes necessary to evacuate the in-patients. They must have an Emergency and Self-protection Plan that includes the patient evacuation criteria and this must be known by all the personnel who work in the service. For that reason, the patients must be triaged, based on their attention priorities, according to their survival possibilities. Having an evacuation, known by all the personnel and updated by means of the performance of periodic drills, should be included as a quality indicator that must be met, since this would achieve better attention to the patient in case of a disaster situation requiring the evacuation of the ICU (AU)