Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 87
Filtrar
1.
Am J Pathol ; 2024 Aug 19.
Artículo en Inglés | MEDLINE | ID: mdl-39168366

RESUMEN

Obstructive sleep apnea syndrome (OSAS) is associated with the development and progression of metabolic dysfunction-associated steatotic liver disease (MASLD). Tripartite motif containing 24 (TRIM24) deficiency was reported to cause hepatic lipid accumulation and hepatitis. However, the expression, function, and mechanism of TRIM24 in OSAS and MASLD remain unclear. OSAS and MASLD mouse model was established by intermittent hypoxia (IH) and high-fat diet. IH- and 1% free fatty acid-induced mouse liver cells served as an in vitro model. TRIM24 and HIF-1α were up-regulated under the IH condition. HIF-1α enhanced the transcriptional activity of TRIM24. Overexpression of TRIM24 reduced hepatic lipid accumulation, decreased serum levels of total cholesterol, triglyceride, and low-density lipoprotein cholesterol, and increased serum levels of high-density lipoprotein cholesterol in OSAS and MASLD mice. Additionally, overexpression of TRIM24 alleviated inflammation and oxidative stress, and modulated aberrant lipid metabolism. Mechanically, TRIM24 up-regulated the expression of ORM2, a key regulator of hepatic lipogenesis, by binding to H3K27ac and recruiting retinoic acid receptor-α to ORM2 promoter. The cell rescue model verified that ORM2 mediated the hepatoprotective effects of TRIM24. Our evidence reveals the important role of TRIM24 as an epigenetic coregulator of transcription in OSAS and MASLD, providing additional insights into understanding the pathogenesis and preventing the development of OSAS and MASLD.

2.
J Mol Model ; 30(9): 304, 2024 Aug 09.
Artículo en Inglés | MEDLINE | ID: mdl-39120824

RESUMEN

CONTEXT: Energy-containing materials such as explosives have attracted considerable interest recently. In the field of high-energy materials, tetrazine and its derivatives can largely meet the requirements of high nitrogen content and oxygen balance. Nitrogen-rich energetic salts are important research subjects. Nitrogen-rich salt of 3,6-dinitramino-1,2,4,5-tetrazine is a high-energy nitrogen-rich material, but there are few related studies. This paper systematically studies the crystal structure and electronic, vibrational, and thermodynamic properties of (NH4)2(DNAT). The lattice parameters of (NH4)2(DNAT) are observed to align well with the experimental values. The properties of electrons are analyzed by band structure and density of states (DOS). The phonon dispersion curves indicate that the compound is dynamically stable. The vibrational modes of bonds and chemical groups are described in detail, and the peaks in the Raman and infrared spectra are assigned to different vibration modes. Based on the vibration characteristics, thermodynamic properties such as enthalpy (H), Helmholtz free energy (F), entropy (S), Gibbs free energy (G), constant volume heat capacity (CV), and Debye temperature (Θ) are analyzed. This article can pave the way for subsequent work or provide data support to other researchers, promoting further research. METHODS: In this study, we utilized the density functional theory (DFT) for our calculations. The exchange-correlation potential and van der Waals interactions were characterized based on the GGA-PBE + G function calculation. We obtained Brillouin zone integrals using Monkhorst-Pack k-point grids, with the k-point of the Brillouin zone set to a 2 × 2 × 2 grid. During the self-consistent field operation, we set the total energy convergence tolerance to 5 × 10-6 eV per atom. The cut-off energy for the calculation was established at 830 eV. Additionally, the states of H (1s1), C (2s2 2p2), N (2s2 2p3), and O (2s2 2p4) were treated as valence electrons in our study.

3.
Ophthalmic Physiol Opt ; 44(6): 1279-1289, 2024 Sep.
Artículo en Inglés | MEDLINE | ID: mdl-38935437

RESUMEN

PURPOSE: The aim of this study was to investigate the effect of individualized ocular refraction customized (IORC) spectacle lenses with different actual amounts of peripheral myopic defocus (MD) on myopia control over 1 year. These lenses compensate for the original peripheral refraction via the free-form surface on the back of the lens. METHODS: This 1-year, double-masked randomised clinical trial included 184 myopic schoolchildren aged 8-12 years. Participants were randomised to receive IORC lenses with high (IORC-H group, +4.50 D), medium (IORC-M group, +3.50 D) or low (IORC-L group, +2.50 D) MD or single-vision (SV) lenses. The spherical equivalent refractive error (SER) and axial length (AL) were measured at baseline and 6-monthly intervals. RESULTS: After 1 year, the mean (SD) changes in SER were -0.18 (0.37), -0.36 (0.37), -0.52 (0.39) and -0.60 (0.42) D for the IORC-H, IORC-M, IORC-L and SV groups, respectively. Compared with the SV group, the effects of slowing myopia progression were 70%, 40% and 13% for the IORC-H (difference of 0.47 D, p < 0.001), IORC-M (difference of 0.32 D, p = 0.001) and IORC-L (difference of 0.15 D, p > 0.05) groups, respectively. The mean (SD) changes in AL were 0.12 (0.16), 0.23 (0.17), 0.29 (0.17) and 0.36 (0.17) mm for the IORC-H, IORC-M, IORC-L and SV groups, respectively. The axial elongation was 67%, 36% and 19% lower in the IORC-H (difference of 0.25 mm, p < 0.001), IORC-M (difference of 0.15 mm, p < 0.001) and IORC-L (difference of 0.10 mm, p = 0.04) groups, respectively, compared with the SV group. The IORC-H group exhibited significantly less axial elongation than the IORC-M and IORC-L groups (p = 0.01 and p < 0.001, respectively). CONCLUSION: Compared with the IORC-M and IORC-L lenses, the IORC-H lens was found to have superior efficacy in inhibiting myopic progression and slowing eye growth in schoolchildren, with better myopia control efficacy in younger children.


Asunto(s)
Anteojos , Miopía , Refracción Ocular , Humanos , Niño , Miopía/fisiopatología , Miopía/terapia , Miopía/prevención & control , Refracción Ocular/fisiología , Femenino , Masculino , Método Doble Ciego , Agudeza Visual/fisiología , Longitud Axial del Ojo/fisiopatología , Resultado del Tratamiento
4.
Transl Vis Sci Technol ; 13(6): 21, 2024 Jun 03.
Artículo en Inglés | MEDLINE | ID: mdl-38922628

RESUMEN

Purpose: Individualized ocular refraction customization (IORC) lenses can be individually adjusted depending on the initial relative peripheral refraction to determine the myopic defocus (MD). We aimed to compare visual performance of children wearing IORC lenses with different amounts of MD to determine whether higher MD resulted in greater visual compromise. Methods: This study included 184 myopic children aged eight to 12 years, and 172 completed the trial. The participants were randomly assigned to wear IORC lenses with low (IORC-L, 2.50 D), medium (IORC-M, 3.50 D), or high (IORC-H, 4.50 D) MD or single-vision spectacle lenses (SVL). Distance and near best-corrected visual acuity (BCVA), contrast sensitivity function (CSF) and questionnaires were evaluated at baseline and after six and 12 months. Results: CSF over all frequencies and distance and near BCVA were not affected by lens design (all P > 0.05). The SVL group outperformed the three IORC lens groups in terms of ghosting images at baseline, and IORC-H and IORC-M groups outperformed IORC-L group (all P < 0.001); however, no differences were observed at the six- or 12-month visit. There were no significant differences among the four groups for any other subjective variables at any of the follow-up visits regarding vision clarity, vision stability, eyestrain, dizziness, headache, or overall vision satisfaction (all P > 0.05). Conclusions: The IORC lenses with an actual MD of 4.50 D provided acceptable objective and subjective visual performance and were well tolerated by children. Translational Relevance: IORC lenses with an actual MD of 4.50 D provided acceptable visual performance.


Asunto(s)
Sensibilidad de Contraste , Anteojos , Miopía , Refracción Ocular , Agudeza Visual , Humanos , Niño , Miopía/terapia , Miopía/fisiopatología , Femenino , Masculino , Agudeza Visual/fisiología , Refracción Ocular/fisiología , Sensibilidad de Contraste/fisiología , China , Encuestas y Cuestionarios , Pueblos del Este de Asia
5.
Sci Rep ; 14(1): 12393, 2024 05 29.
Artículo en Inglés | MEDLINE | ID: mdl-38811759

RESUMEN

Parkinson's disease (PD) is a progressive late-onset neurodegenerative disease leading to physical and cognitive decline. Mutations of leucine-rich repeat kinase 2 (LRRK2) are the most common genetic cause of PD. LRRK2 is a complex scaffolding protein with known regulatory roles in multiple molecular pathways. Two prominent examples of LRRK2-modulated pathways are Wingless/Int (Wnt) and nuclear factor of activated T-cells (NFAT) signaling. Both are well described key regulators of immune and nervous system development as well as maturation. The aim of this study was to establish the physiological and pathogenic role of LRRK2 in Wnt and NFAT signaling in the brain, as well as the potential contribution of the non-canonical Wnt/Calcium pathway. In vivo cerebral Wnt and NFATc1 signaling activity was quantified in LRRK2 G2019S mutant knock-in (KI) and LRRK2 knockout (KO) male and female mice with repeated measures over 28 weeks, employing lentiviral luciferase biosensors, and analyzed using a mixed-effect model. To establish spatial resolution, we investigated tissues, and primary neuronal cell cultures from different brain regions combining luciferase signaling activity, immunohistochemistry, qPCR and western blot assays. Results were analyzed by unpaired t-test with Welch's correction or 2-way ANOVA with post hoc corrections. In vivo Wnt signaling activity in LRRK2 KO and LRRK2 G2019S KI mice was increased significantly ~ threefold, with a more pronounced effect in males (~ fourfold) than females (~ twofold). NFATc1 signaling was reduced ~ 0.5-fold in LRRK2 G2019S KI mice. Brain tissue analysis showed region-specific expression changes in Wnt and NFAT signaling components. These effects were predominantly observed at the protein level in the striatum and cerebral cortex of LRRK2 KI mice. Primary neuronal cell culture analysis showed significant genotype-dependent alterations in Wnt and NFATc1 signaling under basal and stimulated conditions. Wnt and NFATc1 signaling was primarily dysregulated in cortical and hippocampal neurons respectively. Our study further built on knowledge of LRRK2 as a Wnt and NFAT signaling protein. We identified complex changes in neuronal models of LRRK2 PD, suggesting a role for mutant LRRK2 in the dysregulation of NFAT, and canonical and non-canonical Wnt signaling.


Asunto(s)
Modelos Animales de Enfermedad , Proteína 2 Quinasa Serina-Treonina Rica en Repeticiones de Leucina , Factores de Transcripción NFATC , Enfermedad de Parkinson , Vía de Señalización Wnt , Animales , Proteína 2 Quinasa Serina-Treonina Rica en Repeticiones de Leucina/genética , Proteína 2 Quinasa Serina-Treonina Rica en Repeticiones de Leucina/metabolismo , Factores de Transcripción NFATC/metabolismo , Factores de Transcripción NFATC/genética , Enfermedad de Parkinson/genética , Enfermedad de Parkinson/metabolismo , Enfermedad de Parkinson/patología , Masculino , Ratones , Femenino , Técnicas de Sustitución del Gen , Ratones Noqueados , Neuronas/metabolismo , Encéfalo/metabolismo , Encéfalo/patología , Mutación , Humanos
6.
Zhongguo Zhong Yao Za Zhi ; 49(5): 1388-1396, 2024 Mar.
Artículo en Chino | MEDLINE | ID: mdl-38621987

RESUMEN

This study aims to systematically review the clinical features and outcome indicators in randomized controlled trial(RCT) of traditional Chinese medicine(TCM) intervention in septic kidney injury and provide a reference for optimizing clinical study design and building the core outcome set(COS) of TCM treatment of septic kidney injury. Computer searches were conducted on PubMed, Cochrane Library, EMbase, Web of Science, CNKI, Wanfang, VIP, and SinoMed to find published RCT of TCM intervention in septic kidney injury in the past five years, extract the basic characteristics, intervention measures, outcome indicators, and other data of included studies, and conduct descriptive analysis. 53 RCTs were included, and the sample size was mostly concentrated in 60-80 cases, with abdominal infection being the most common(15 articles, 83.3%) and the TCM syndrome of blood stasis being the most frequent(9 articles, 50.0%). The frequency of intervention methods from high to low were TCM decoction(28 articles, 52.8%), Chinese patent medicine(22 articles, 41.5%), and combined TCM therapy(3 articles, 7.5%); the intervention time of the trial was more than 7 d(34 articles, 69.4%). The risk of bias in included studies was unclear. A total of 84 outcome indicators were involved, which were divided into 9 fields, including 63 physical and chemical tests(305 times, 72.2%), 4 kinds of disease degree(48 times, 11.6%), 4 kinds of clinical effective rate(15 times, 3.6%), 1 kind of quality of life(1 time, 0.2%), 2 kinds of economic evaluation(14 times, 3.3%), 1 kind of TCM disease(9 times, 2.1%), 2 kinds of long-term prognosis(16 times, 3.8%), 2 kinds of safety events(6 times, 1.4%), and 5 other indicators(8 times, 0.7%). The cumulative frequency was 422 times, among which the outcome indicators with higher frequency were inflammatory factors(42 articles, 79.2%) and markers of renal function and kidney injury(40 articles, 75.5%). Only 1(1.9%) of the included articles mentioned primary and secondary outcome indicators, and 6 articles(11.3%) mentioned safety events, 13 articles(24.5%) mentioned economic assessment. The RCT quality of TCM intervention in septic renal injury was generally low, and the reference standards for sepsis, kidney injury, and TCM syndrome diagnosis were not uniform. There are some problems in outcome indicators, such as unclear distinction between primary and secondary indicators, neglect of endpoint indicators, lack of application of TCM characteristic indicators, and insufficient attention to safety events and economic assessment. It is suggested that the quality of clinical research methodology should be improved in the future, and the COS should be constructed to provide high-level evidence-based evidence for TCM intervention in septic kidney injury.


Asunto(s)
Medicamentos Herbarios Chinos , Medicina Tradicional China , Ensayos Clínicos Controlados Aleatorios como Asunto , Sepsis , Humanos , Medicamentos Herbarios Chinos/uso terapéutico , Sepsis/tratamiento farmacológico , Masculino , Resultado del Tratamiento , Femenino , Anciano , Adulto , Persona de Mediana Edad , Lesión Renal Aguda/tratamiento farmacológico , Lesión Renal Aguda/terapia
7.
World J Gastroenterol ; 30(12): 1727-1738, 2024 Mar 28.
Artículo en Inglés | MEDLINE | ID: mdl-38617742

RESUMEN

BACKGROUND: Sarcopenia may be associated with hepatocellular carcinoma (HCC) following hepatectomy. But traditional single clinical variables are still insufficient to predict recurrence. We still lack effective prediction models for recent recurrence (time to recurrence < 2 years) after hepatectomy for HCC. AIM: To establish an interventable prediction model to estimate recurrence-free survival (RFS) after hepatectomy for HCC based on sarcopenia. METHODS: We retrospectively analyzed 283 hepatitis B-related HCC patients who underwent curative hepatectomy for the first time, and the skeletal muscle index at the third lumbar spine was measured by preoperative computed tomography. 94 of these patients were enrolled for external validation. Cox multivariate analysis was per-formed to identify the risk factors of postoperative recurrence in training cohort. A nomogram model was developed to predict the RFS of HCC patients, and its predictive performance was validated. The predictive efficacy of this model was evaluated using the receiver operating characteristic curve. RESULTS: Multivariate analysis showed that sarcopenia [Hazard ratio(HR) = 1.767, 95%CI: 1.166-2.678, P < 0.05], alpha-fetoprotein ≥ 40 ng/mL (HR = 1.984, 95%CI: 1.307-3.011, P < 0.05), the maximum diameter of tumor > 5 cm (HR = 2.222, 95%CI: 1.285-3.842, P < 0.05), and hepatitis B virus DNA level ≥ 2000 IU/mL (HR = 2.1, 95%CI: 1.407-3.135, P < 0.05) were independent risk factors associated with postoperative recurrence of HCC. Based on the sarcopenia to assess the RFS model of hepatectomy with hepatitis B-related liver cancer disease (SAMD) was established combined with other the above risk factors. The area under the curve of the SAMD model was 0.782 (95%CI: 0.705-0.858) in the training cohort (sensitivity 81%, specificity 63%) and 0.773 (95%CI: 0.707-0.838) in the validation cohort. Besides, a SAMD score ≥ 110 was better to distinguish the high-risk group of postoperative recurrence of HCC. CONCLUSION: Sarcopenia is associated with recent recurrence after hepatectomy for hepatitis B-related HCC. A nutritional status-based prediction model is first established for postoperative recurrence of hepatitis B-related HCC, which is superior to other models and contributes to prognosis prediction.


Asunto(s)
Carcinoma Hepatocelular , Hepatitis B , Neoplasias Hepáticas , Sarcopenia , Humanos , Carcinoma Hepatocelular/cirugía , Sarcopenia/complicaciones , Sarcopenia/diagnóstico por imagen , Hepatectomía/efectos adversos , Estudios Retrospectivos , Neoplasias Hepáticas/cirugía , Hepatitis B/complicaciones
8.
Phytopathology ; 114(5): 855-868, 2024 May.
Artículo en Inglés | MEDLINE | ID: mdl-38593748

RESUMEN

Disaster plant pathology addresses how natural and human-driven disasters impact plant diseases and the requirements for smart management solutions. Local to global drivers of plant disease change in response to disasters, often creating environments more conducive to plant disease. Most disasters have indirect effects on plant health through factors such as disrupted supply chains and damaged infrastructure. There is also the potential for direct effects from disasters, such as pathogen or vector dispersal due to floods, hurricanes, and human migration driven by war. Pulse stressors such as hurricanes and war require rapid responses, whereas press stressors such as climate change leave more time for management adaptation but may ultimately cause broader challenges. Smart solutions for the effects of disasters can be deployed through digital agriculture and decision support systems supporting disaster preparedness and optimized humanitarian aid across scales. Here, we use the disaster plant pathology framework to synthesize the effects of disasters in plant pathology and outline solutions to maintain food security and plant health in catastrophic scenarios. We recommend actions for improving food security before and following disasters, including (i) strengthening regional and global cooperation, (ii) capacity building for rapid implementation of new technologies, (iii) effective clean seed systems that can act quickly to replace seed lost in disasters, (iv) resilient biosecurity infrastructure and risk assessment ready for rapid implementation, and (v) decision support systems that can adapt rapidly to unexpected scenarios. [Formula: see text] Copyright © 2024 The Author(s). This is an open access article distributed under the CC BY 4.0 International license.


Asunto(s)
Enfermedades de las Plantas , Enfermedades de las Plantas/prevención & control , Humanos , Patología de Plantas , Desastres , Cambio Climático , Seguridad Alimentaria
9.
Gene ; 899: 148136, 2024 Mar 20.
Artículo en Inglés | MEDLINE | ID: mdl-38185293

RESUMEN

BACKGROUND: Exercise therapy can improve muscle mass, strengthen muscle and cardiorespiratory function, and may be an excellent adjunctive treatment option for Duchenne muscular dystrophy. METHODS: This article investigates the effects of 10 weeks of treadmill training on skeletal muscle in control and mdx mice. Hematoxylin and eosin (H&E) staining was used to detect the morphometry of skeletal muscle; the grip strength test, suspension test, and rotarod test were used to detect limb muscle strength of mice, and Aurora Scientific Instruments were used to detect in vivo Muscle Stimulation Measuring Maximum Force of pre-fatigue and post-fatigue. The expression levels of myogenic proteins, ubiquitination markers, autophagy pathway proteins, and the proportion of different muscle fiber types were detected. RESULTS: The experimental results show that running exercise can significantly improve the muscle mass of mdx mice, promote muscle strength, endurance, and anti-fatigue ability, reverse the pathological state of skeletal muscle destruction in mdx mice, and promote muscle regeneration. WB experiments showed that running inhibited the ubiquitination and degradation of muscle protein in mdx mice, inhibited AKT activation, decreased phosphorylated FoxO1 and FoxO3a, and restored the suppressed autophagic flux. Running enhances muscle strength and endurance by comprehensively promoting the expression of Myh1/2/4/7 fast and slow muscle fibers in mdx mice. CONCLUSIONS: Running can inhibit the degradation of muscle protein in mdx mice, and promote the reuse and accumulation of proteins, thereby slowing down muscle loss. Running improves skeletal muscle mass by activating autophagic flux and inhibiting ubiquitination degradation in mdx mice.


Asunto(s)
Distrofia Muscular de Duchenne , Carrera , Animales , Ratones , Ratones Endogámicos mdx , Ratones Endogámicos C57BL , Músculo Esquelético/metabolismo , Carrera/fisiología , Proteínas Musculares/metabolismo , Autofagia , Modelos Animales de Enfermedad
10.
Artículo en Inglés | MEDLINE | ID: mdl-37957855

RESUMEN

BACKGROUND: Acute lung injury (ALI) is a serious lung disease characterized by acute and severe inflammation. Upregulation of ACE2 and inhibition of the NF-κB signaling pathway attenuate LPS-induced ALI. OBJECTIVE: To explore whether Zang Siwei Qingfei Mixture inhibits the development of ALI through the ACE2/NF-κB signaling pathway. METHODS: Alveolar type II epithelial cells (AEC II) were identified by immunofluorescence staining and flow cytometry. C57BL/6J mice were treated with LPS to establish an ALI model. Cell viability was assessed using CCK8 assays. The levels of ACE, ACE2, p-p38/p38, p- ERK1/2/ERK1/2, p-JNK/JNK, p-IκBα/IκB-α, p-NF-κBp65 were analyzed by Western blotting. ELISA was applied to detect the levels of TNF-a, IL-6, AGT, and Ang1-7. HE staining was used to observe lung injury. The mRNA expression of ACE, ACE2, and Mas was measured by RTqPCR. RESULTS: AEC II cells were successfully isolated. Treatment with Zang Siwei Qingfei mixture resulted in a decrease in ACE, p-p38/p38, p-ERK1/2/ERK1/2, p-JNK/JNK, p-IκBα/IκB-α, p- NF-κBp65 levels, while increasing ACE2 levels. Zang Siwei Qingfei mixture also led to a reduction in TNF-α, IL6, and AGT levels, while increasing Ang1-7 level. Histological analysis showed that Zang Siwei Qingfei Mixture treatment improved the alveolar structure of ALI mice and reduced inflammatory infiltration. The pretreatment with MLN-4760, an ACE2 inhibitor, resulted in opposite effects compared to Zang Siwei Qingfei Mixture treatment. CONCLUSION: Zang Siwei Qingfei mixture attenuates ALI by regulating the ACE2/NF-κB signaling pathway in mice. This study provides a theoretical foundation for the development of improved ALI treatments.

11.
Front Endocrinol (Lausanne) ; 14: 1135852, 2023.
Artículo en Inglés | MEDLINE | ID: mdl-37404302

RESUMEN

Objective: This study aimed to investigate directional influences in the association between adiposity and physical activity (PA) from pre-puberty to early adulthood. Methods: In the Calex-study, height, weight, body fat and leisure-time physical activity (LTPA) were measured at age11.2-years, 13.2-years and 18.3-years in 396 Finnish girls. Body fat was measured by dual-energy X-ray absorptiometry, calculating fat mass index (FMI) as total fat mass in kilograms divided by height in meters squared. LTPA level was evaluated using a physical activity questionnaire. In the European Youth Heart Study (EYHS), height, weight and habitual PA were measured at age 9.6-years, 15.7-years and 21.8-years in 399 Danish boys and girls. Habitual PA and sedentary behaviour were assessed with an accelerometer. Directional influences of adiposity and PA were examined using a bivariate cross-lagged path panel model. Results: The temporal stability of BMI from pre-puberty to early adulthood was higher than the temporal stability of PA or physical inactivity over the same time period both in girls and boys. In the Calex-study, BMI and FMI at age 11.2-years were both directly associated with LTPA at age 13.2-years (ß = 0.167, p = 0.005 and ß = 0.167, p = 0.005, respectively), whereas FMI at age 13.2-years showed an inverse association with LTPA at age 18.3-years (ß = - 0.187, p = 0.048). However, earlier LTPA level was not associated with subsequent BMI or FMI. In the EYHS, no directional association was found for physical inactivity, light-, moderate-, and vigorous-PA with BMI during the follow-up in girls. In boys, BMI at age 15.7-years was directly associated with moderate PA (ß = 0.301, p = 0.017) at age 21.8-years, while vigorous PA at age 15.7-years showed inverse associations with BMI at age 21.8-years (ß = - 0.185, p = 0.023). Conclusion: Our study indicates that previous fatness level is a much stronger predictor of future fatness than level of leisure-time or habitual physical activity during adolescence. The directional associations between adiposity and physical activity are not clear during adolescence, and may differ between boys and girls depending on pubertal status.


Asunto(s)
Adiposidad , Ejercicio Físico , Masculino , Femenino , Adolescente , Humanos , Adulto , Niño , Adulto Joven , Estudios Longitudinales , Índice de Masa Corporal , Obesidad , Pubertad
12.
Thorac Cancer ; 14(24): 2327-2337, 2023 08.
Artículo en Inglés | MEDLINE | ID: mdl-37407282

RESUMEN

BACKGROUND: Evidence on the influence of programmed death-ligand 1 (PD-L1) expression on the efficacy of epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs) in EGFR-mutant non-small cell lung cancer (NSCLC) patients is at variance. METHODS: A single-center retrospective study was conducted to evaluate the influence of PD-L1 expression on the efficacy of EGFR-TKIs for NSCLC patients with EGFR mutation. Clinical information was retrieved from electronic medical records. The patients were divided into three subgroups according to PD-L1 expression level: PD-L1 < 1% (negative), PD-L1 1%-49% and PD-L1 ≥ 50%. The clinicopathological features, overall response rate (ORR), progression-free survival (PFS) and comutation information were collected and compared between the three subgroups. RESULTS: A total of 117 patients were included. For PD-L1 < 1%, PD-L1 1%-49% and PD-L1 ≥ 50% group, there were 39 (33.3%), 51 (43.5%) and 27 (23.0%) patients respectively, and the ORR was 43.2%, 64.0%, and 51.9%, respectively (p = 0.162), and the median progression-free survival (mPFS) was 22.0 months (95% CI: 14.0-29.9 months), 15.4 months (95% CI: 8.9-21.8 months) and 13.0 months (95% CI: 10.6-15.3 months), respectively (log-rank, p = 0.01). The mPFS was negatively correlated with PD-L1 expression level (r = -0.264, p = 0.041) and PD-L1 expression was an independent risk factor for worse PFS of EGFR-TKIs in multivariate Cox regression. Patients with concurrent TP53 mutation had shorter PFS (p = 0.039) and the patients harboring both mutant TP53 and positive PD-L1 had the shortest PFS (p = 0.006). CONCLUSIONS: The efficacy of EGFR-TKIs was influenced by the baseline PD-L1 expression. Higher PD-L1 expression was associated with shorter PFS. The combined indicators of TP53 and PD-L1 identified subgroups showing divergent benefits from EGFR-TKIs.


Asunto(s)
Carcinoma de Pulmón de Células no Pequeñas , Neoplasias Pulmonares , Humanos , Carcinoma de Pulmón de Células no Pequeñas/tratamiento farmacológico , Carcinoma de Pulmón de Células no Pequeñas/genética , Carcinoma de Pulmón de Células no Pequeñas/metabolismo , Neoplasias Pulmonares/tratamiento farmacológico , Neoplasias Pulmonares/genética , Neoplasias Pulmonares/metabolismo , Antígeno B7-H1 , Estudios Retrospectivos , Receptores ErbB/metabolismo , Mutación , Inhibidores de Proteínas Quinasas/farmacología , Inhibidores de Proteínas Quinasas/uso terapéutico
13.
Acta Pharmacol Sin ; 44(11): 2307-2321, 2023 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-37402999

RESUMEN

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.


Asunto(s)
Neoplasias de la Mama , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B , Humanos , Femenino , Ribonucleoproteína Nuclear Heterogénea A1/genética , Ribonucleoproteína Nuclear Heterogénea A1/metabolismo , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B/genética , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B/metabolismo , Neoplasias de la Mama/genética , Isoformas de Proteínas/genética , Isoformas de Proteínas/metabolismo , Empalme Alternativo , Exones/genética , Proteínas de la Membrana/genética , Proteínas de la Membrana/metabolismo , Proteínas Supresoras de Tumor/metabolismo
14.
Artículo en Inglés | MEDLINE | ID: mdl-36767706

RESUMEN

BACKGROUND: This study adopted a quasi-experimental design to examine the effect of a 7-week mindfulness intervention on the psychological coping ability and shooting performance of college-level male basketball athletes in Macau. METHODS: A total of 43 male college basketball athletes in Macau were selected as the participants. Besides the regular basketball training, the intervention group (n = 23) received a 7-week mindfulness training; the weekly mindfulness intervention session lasted around one hour according to the mindfulness training manual for athletes, while the control group (n = 20) did not receive any mindfulness training. Before and immediately after the 7-week intervention, all players performed the following tests: the "Five-Facet Mindfulness Questionnaire", the "Acceptance and Action Questionnaire", the "Sport Competition Anxiety Test", the "Mindfulness Attention Awareness Scale", and three shooting tests. An independent-sample t-test and a paired-sample t-test were used to analyze the between- and within-group differences. Moreover, a repeated measures ANOVA was used to assess the group, time, and group-by-time effects on psychological skills and shooting performances. RESULTS: The intervention resulted in both significant between-group and within-group differences in mindfulness level, acceptance level, attention level, three-point, and free-throw shooting performances (all p < 0.05, Cohen's d ranging from 0.565 to 1.117). CONCLUSION: While further study is necessary, the present study suggests that the 7-week mindfulness training program can significantly improve psychological outcomes and shooting performance in Macau college basketball athletes. Future studies involving competition settings and objective metrics will aid in verifying mindfulness as the prevalent practice among basketball practitioners and athletes.


Asunto(s)
Rendimiento Atlético , Baloncesto , Atención Plena , Humanos , Masculino , Atención Plena/métodos , Macao , Rendimiento Atlético/psicología , Atletas/psicología
15.
Artículo en Inglés | MEDLINE | ID: mdl-36767403

RESUMEN

In recent years, mindfulness-based interventions (MBIs) have been widely applied in competition sports with respect to athletic performance and mental health promotion, whereas evidence of randomized controlled trials (RCTs) has not been well summarized. Therefore, this study aimed to systematically review and meta-analyze the existing evidence on the effects of MBIs on improving athletic performance, mindfulness level, mindfulness-related psychological components (e.g., acceptance, self-compassion, flow), and mental health (e.g., burnout, stress, psychological well-being) among athletes. Following the PRISMA guidelines, a literature search was implemented on five electronic databases (Web of Science, PubMed, Scopus, ProQuest, and ScienceDirect) and relevant review papers. The article selection, risk of bias assessment, and data extraction were performed by two investigators independently. The standardized mean difference (SMD) was calculated to evaluate the effects of interventions using the random effect model. Among the 1897 original hits, thirty-two eligible RCT studies were included in the systematic review, of which seven were involved in the meta-analysis. The results showed that MBIs were effective in promoting athletes' athletic performances (by narrative synthesis), mindfulness-level (n = 3; SMD = 0.50, 95% CI = [0.17, 0.83]; I2 = 45%, p = 0.16), and mindfulness-related psychological components (n = 5; SMD = 0.81, 95% CI = [0.53, 1.10], I2 = 77%, p =0.001), while no significant intervention effects were found on the mental health of athletes (n = 4; SMD = -0.03, 95% CI = [-0.35, 0.29], I2 = 89%, p < 0.001). Our findings preliminarily support the potential effectiveness of MBIs, whereas more high-quality RCTs were needed in the future.


Asunto(s)
Rendimiento Atlético , Atención Plena , Humanos , Atención Plena/métodos , Atletas , Salud Mental , Autocompasión , Ensayos Clínicos Controlados Aleatorios como Asunto
16.
Ticks Tick Borne Dis ; 14(2): 102100, 2023 03.
Artículo en Inglés | MEDLINE | ID: mdl-36599203

RESUMEN

Severe fever with thrombocytopenia syndrome virus (SFTSV), a tick-borne Bunyavirus, causes an emerging hemorrhagic fever in humans with a high fatality in Asia. The tick vectors and hosts of SFTSV are not well studied. We evaluated SFTSV transmission in laboratory reared Haemaphysalis flava ticks. RT-PCR demonstrated that after acquisition feeding in SFTSV-infected rabbits, 10 % (4/40) engorged larvae, 25% (5/20) engorged nymphs, and 50% (5/10) engorged females of H. flava became SFTSV RNA positive; after engorged larvae and nymphs molted into nymphs and adults, respectively, 12.5% (3/24) newly molted nymphs and 20% (2/10) newly molted adults were SFTSV RNA positive. Among 30 engorged females that oviposited, 10% (3/30) clutches of eggs and 3.3% (1/30) colonies of larvae were RNA positive for SFTSV. RT-PCR also showed that 6 days after being infested with SFTSV-infected ticks, 100% (3/3) rabbits infested with larvae, 100% (2/2) rabbits infested with nymphs, and 100% (2/2) rabbits infested with adult ticks became SFTSV RNA positive. In conclusion, H. flava can acquire SFTSV from infected rabbits by feeding; there is transstadial and transovarial transmission of the virus and all three stages of H. flava can transmit SFTSV to rabbits by feeding. Thus, H. flava tick is an effective vector of SFTSV and may play a role in the transmission of SFTSV in wild animals and humans.


Asunto(s)
Ixodidae , Phlebovirus , Síndrome de Trombocitopenia Febril Grave , Garrapatas , Animales , Humanos , Femenino , Conejos , Ixodidae/genética , Phlebovirus/genética , ARN
17.
Cell Cycle ; 22(5): 495-505, 2023 03.
Artículo en Inglés | MEDLINE | ID: mdl-36184878

RESUMEN

Skeletal muscle development is a multistep biological process regulated by a variety of myogenic regulatory factors, including MyoG, MyoD, Myf5, and Myf6 (also known as MRF4), as well as members of the FoxO subfamily. Differentiation and regeneration during skeletal muscle myogenesis contribute to the physiological function of muscles. Super enhancers (SEs) and enhancer RNAs (eRNAs) are involved in the regulation of development and diseases. Few studies have identified the roles of SEs and eRNAs in muscle development and pathophysiology. To develop approaches to enhance skeletal muscle mass and function, a more comprehensive understanding of the key processes underlying muscular diseases is needed. In this review, we summarize the roles of SEs and eRNAs in muscle development and disease through affecting of DNA methylation, FoxO subfamily, RAS-MEK signaling, chromatin modifications and accessibility, MyoD and cis regulating target genes. The summary could inform strategies to increase muscle mass and treat muscle-related diseases.


Asunto(s)
Músculo Esquelético , Factores Reguladores Miogénicos , Factores Reguladores Miogénicos/genética , Músculo Esquelético/fisiología , ARN , Desarrollo de Músculos/genética , Proteína MioD/genética , Diferenciación Celular/genética
18.
J Affect Disord ; 324: 480-488, 2023 03 01.
Artículo en Inglés | MEDLINE | ID: mdl-36584712

RESUMEN

BACKGROUND: Persons with suicidality including suicidal ideation (SI), suicide plans (SP) and/or suicide attempts (SA) are at higher risk for future suicide than those without suicidality. To reduce the risk of future suicide, it is important to understand symptoms of emotional distress that have the strongest links with SI, SP and SA. This network analysis examined item-level relations of depressive and anxiety symptoms with suicidality among adolescents during the COVID-19 pandemic. METHODS: Adolescents between 12 and 20 years of age were assessed with the Patient Health Questionnaire (PHQ-9), Generalized Anxiety Disorder Scale (GAD-7), and individual binary reponse (no/yes) items assessing SI, SP, and SA during the pandemic. The structure of depressive symptoms, anxiety symptoms and suicidality was characterized using "Expected Influence" and "Bridge Expected Influence" as centrality indices in the symptom network. Network stability was tested using a case-dropping bootstrap procedure. Node-specific predictive betweenness was computed to examine short paths of anhedonia, other depressive symptoms and anxiety symptoms with suicidality. A Network Comparison Test (NCT) was conducted to examine whether network characteristics differed based on gender. RESULTS: Prevalence rates of depressive symptoms, anxiety symptoms, and suicidality were 44.60 % (95% confidence interval (CI) = 41.53-47.67 %), 31.12 % (95%CI = 28.26-33.98 %), and 16.95 % (95%CI = 14.63-19.26 %), respectively, in the study sample. The network analysis identified GAD3 ("Worry too much") as the most central symptom, followed by GAD6 ("Irritability") and PHQ6 ("Guilt") in the sample. Additionally, PHQ6 ("Guilt"), GAD6 ("Irritability"), and PHQ2 ("Sad mood") were bridge nodes linking depressive and anxiety symptoms with suicidality. A flow network indicated that the connection between S ("Suicidality") and PHQ6 ("Guilt") reflected the strongest connection, followed by connections of S ("Suicidality") with GAD2 ("Uncontrollable worrying"), and S ("Suicidality") with PHQ2 ("Sad mood"). Finally, PHQ2 ("Sad mood") was the main bridge node linking anhedonia with other depressive and anxiety symptoms and suicidality in the sample. CONCLUSIONS: Findings highlight the potential importance of reducing specific depressive and anxiety symptoms as possible means of reducing suicidality among adolescents during the pandemic. Central symptoms and key bridge symptoms identified in this study should be targeted in suicide prevention for at-risk adolescents.


Asunto(s)
COVID-19 , Ideación Suicida , Humanos , Adolescente , Depresión/epidemiología , Depresión/psicología , Anhedonia , Pandemias , COVID-19/epidemiología , Ansiedad/epidemiología , Ansiedad/psicología , Genio Irritable
19.
Front Pharmacol ; 13: 963327, 2022.
Artículo en Inglés | MEDLINE | ID: mdl-36532787

RESUMEN

Parkinson's disease (PD) is an age-related chronic neurodegenerative disease caused by the death and degeneration of dopaminergic neurons in the substantia nigra of the midbrain. The decrease of the neurotransmitter dopamine in the patient's brain leads to various motor symptoms. PD drugs mainly enhance dopamine levels but cannot prevent or slow down the loss of dopaminergic neurons. In addition, they exhibit significant side effects and addiction issues during long-term use. Therefore, it is particularly urgent to develop novel drugs that have fewer side effects, can improve PD symptoms, and prevent the death of dopaminergic neurons. The rhizome of Gastrodia elata Blume (Tianma) is a well-known medicinal herb and has long been used as a treatment of nervous system-related diseases in China. Several clinical studies showed that formula comprising Tianma could be used as an add-on therapy for PD patients. Pharmacological studies indicated that Tianma and its bioactive components can reduce the death of dopaminergic neurons, α-synuclein accumulation, and neuroinflammation in various PD models. In this review, we briefly summarize studies regarding the effects of Tianma and its bioactive components' effects on major PD features and explore the potential use of Tianma components for the treatment of PD.

20.
Front Psychol ; 13: 1022966, 2022.
Artículo en Inglés | MEDLINE | ID: mdl-36324783

RESUMEN

Objective: To explore how a stringent campus lockdown affects the physical activity (PA), sleep and mental health of Chinese university students living in student dormitories during the COVID-19 pandemic. Methods: Data on PA, sleep and mental health were collected between 24 March and 4 April 2022 from 2084 university students (mean age = 22.4 years, 61.1% male students) via an online questionnaire distributed by the students' advisers of each dormitory. The Chinese short version of the International Physical Activity Questionnaire (IPAQ-C), Athens Insomnia Scale (CAIS) and General Health Questionnaire 12-item (GHQ-12) were applied. The Mann-Whitney test and Kruskal-Wallis tests were used to evaluate the PA profile differences between genders, before and during the lockdown period and between students' living environments. Chi-squared (χ2) or Fisher's exact test was used to assess changes in health behaviors by gender and students' living environment compared to before the lockdown. A mediation model was used to examine whether sleep disorder mediated the relationship between PA and mental health in different students' living environments. Results: Participants reported a significant decrease in weekly total PA levels (63.9%). Mean daily sedentary time increased by 21.4% and daily lying time increased by 10.7% compared to before lockdown. Among the participants, 21.2% had experienced insomnia, and 39.0% reported having high mental distress. Female students reported 10% higher rates of sleep disorders than male students (p < 0.001), and also experienced a higher incidence of mental disorders (p < 0.001). Students living with three roommates had a larger decrease in frequencies and durations of participation in light PA than other students (p < 0.001). PA was negatively associated with sleep and mental health, and sleep disorder was a mediating factor between PA and mental health in the students living with two and three roommates. Conclusion: This study showed that strict lockdowns within university dormitories during the COVID-19 pandemic had a negative effect on the health of university students by changing their health behaviors, physical activity and sleep. Our findings indicate a need for strategies to promote an active lifestyle for students in space-limited dormitories in order to maintain health during a prolonged lockdown.

SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA