RESUMEN

BACKGROUND: With earlier prostate cancer (PCa) diagnosis and increased survivorship, post-treatment quality of life (QoL) has become increasingly important. The Expanded Prostate Cancer Index Composite (EPIC) is a widely adopted QoL instrument for PCa. We aimed to create a Punjabi version of EPIC to further research in the Punjabi-speaking population. METHODS: A prototype of the Punjabi version of EPIC was created by forward-backward translations and revision. After concluding the cultural adaptation phase by interviewing 15 participants, a pilot version was created. Validation of the pilot version was performed by having 72 participants complete the Punjabi EPIC and another commonly used QoL instrument, the EORTC QLQ-c30, twice within a 4-week period. Test retest reliability (Pearson's correlations and difference distribution) and internal consistency (Cronbach's alpha) were measured using SAS version 9.4. RESULTS: Modifications were needed for the prototype Punjabi version after forward-backward translations. Cultural adaptation has highlighted a few issues including syntax and terminology.  Test-retest reliability of the Urinary, Bowel, Sexual and Hormone domains were 0.88, 0.91, 0.91, and 0.95, respectively, and subscale correlations ranged from 0.75 to 0.93. Internal consistency for domains and subscales was good except for Sexual Domain. Performance of EPIC is comparable, and in some cases, slightly better than validated Punjabi version of EORTC QLQ-C30. CONCLUSIONS: The EPIC questionnaire was successfully translated into Punjabi and was culturally adapted.  The resultant Punjabi version has high reliability and validity and will be an important tool for QoL research in the Punjabi population. EPIC was successfully translated, culturally adapted, and validated with high reliability and validity into Punjabi. It will be a valuable QoL tool for physicians in clinical and research settings, and for patients in decision-making.

Asunto(s)

RESUMEN

Scales designed for assessing male sexual function may not be suitable for men of all sexual orientations. We reviewed frequently used sexual function scales and examined the item content and documentation of validation. These scales predominantly focus on general sexual function and erection. They lack questions on behaviors relevant to men-who-have-sex-with-men (MSM), such as anal sex, masturbation, or sexual activities outside of committed relationships. Additionally, the validation samples rarely mention inclusion of MSM, revealing a clear gap in the clinical evaluation tools available for MSM, who are experiencing sexual dysfunction from prostate cancer treatment side effects.

RESUMEN

BACKGROUND: Prostate cancer (PCa) is often diagnosed early with prolonged survival, which makes sexual quality of life (QoL) an increasingly important treatment consideration, but existing QoL questionnaires have limited applicability for men who-have-sex-with-men (MSM) beyond penile erections and penetrative sex. AIM: We aimed to create a validated survey instrument for assessing a variety of sexual activities beyond penile insertive sex for MSM after PCa treatment. METHODS: Based on our previously published survey findings, we have generated a prototype questionnaire with 13 different domains, reviewed by both healthy MSM and pilot-tested by MSM treated for PCa. OUTCOMES: We report here on progress in developing the questionnaire and demonstrate the complexity of MSM sexual side effects resulting from PCa treatment(s). RESULTS: Statistical analysis of 204 responses from MSM treated for PCa showed that each domain performed well individually (Cronbach's alpha coefficients ranged from 0.80 to 0.95; item-total correlations ranged from 0.16 to 0.89), with many significant intercorrelations between the domains (ranged from -0.048 to 0.93). CLINICAL IMPLICATIONS: The questionnaire can contribute to clinical diagnosis and treatment decisions that best fit the preferred sexual practices of individual MSM. STRENGTHS & LIMITATIONS: The current questionnaire considers a much broader repertoire of MSM's sexual practices and preferences than other currently available questionnaires. The high intercorrelations between the many parameters demonstrate that problems in one domain can affect other domains. This preliminary analysis warrants further exploration with a larger sample size. CONCLUSIONS: Once validated our questionnaire should help develop tailored psychosocial supports for MSM experiencing sexual dysfunction after PCa treatment and help newly diagnosed MSM with PCa make treatment decisions informed by their preferred sexual practices. Wibowo E, Dowsett GW, Nelson CJ, et al. Development of a Sexual Quality of Life Questionnaire for Men-Who-Have-Sex-With-Men With Prostate Cancer. Sex Med 2022;10:100480.

RESUMEN

AIM: The expanded prostate cancer index composite (EPIC) is a widely adopted instrument for the quality of life of patients with prostate cancer. We aimed to create a Chinese version of EPIC to further research in the Chinese-speaking population. METHODS: A prototype was created by forward-backward translations and revisions. During cultural adaptation, 15 participants were interviewed after they had completed the prototype. A few issues highlighted included confusion related to the question format, subject non-familiarity with the Chinese term for "hot flashes," and the use of the Chinese term for "breast" as a strictly female body part. A pilot version was created based on the cultural adaptation findings. Validation of the pilot version was performed by having 50 participants complete the Chinese EPIC and EORTC QLQ-c30 twice within a 4-week period. Test-retest reliability (Pearson's correlations and difference distribution) and internal consistency (Cronbach's α) were measured using SAS version 9.4. RESULTS: Test-retest reliability values for the urinary, bowel, sexual and hormone domains were 0.71, 0.51, 0.51 and 0.66, respectively; subscale test-retest reliability ranged between 0.29 and 0.82. Internal consistency for domains was good with Cronbach's α ranging from 0.76 to 0.78 for the initial test and 0.67 to 0.85 for the retest. The performance of this version of EPIC was comparable to the validated EORTC QLQ-C30. CONCLUSION: The EPIC questionnaire was successfully translated into Chinese and was culturally adapted. The resultant Chinese version has high reliability and validity and will be an important tool for research on quality of life in the Chinese population.

Asunto(s)

RESUMEN

INTRODUCTION: With earlier prostate cancer (PCa) diagnosis and an increased focus on survivorship, post-treatment sexual quality of life (QoL) has become increasingly important. Research and validated instruments for sexual QoL assessment based on heterosexual samples have limited applicability for men-who-have-sex-with-men (MSM). AIM: We aimed to create a validated instrument for assessing sexual needs and concerns of MSM post-PCa treatment. Here we explore post-PCa treatment sexual concerns for a sample of MSM, as the first part of this multi-phase project. METHODS: Individual semi-structured interviews were conducted with 16 MSM face-to-face or via Internet-based video conferencing. Participants were asked open-ended questions about their experiences of sexual QoL following PCa. Interviews were recorded, transcribed verbatim, uploaded to NVivo 8(TM) , and analyzed using qualitative methodology. MAIN OUTCOME MEASURE: We have conducted semi-structure qualitative interviews on 16 MSM who were treated for PCa. Focus was on post-treatment sexual concerns. RESULTS: The following themes were inductively derived: (i) erectile, urinary, ejaculation, and orgasmic dysfunctions; (ii) challenges to intimate relationships; and (iii) lack of MSM-specific oncological and psychosocial support for PCa survivorship. Sexual practices pre-treatment ranked in order of frequency were masturbation, oral sex, and anal sex, an ordering that prevailed post-treatment. Sexual QoL decreased with erectile, urinary, and ejaculation dysfunctions. Post-treatment orgasms were compromised. Some single men and men in non-monogamous relationships reported a loss of confidence or difficulty meeting other men post-treatment. Limited access to targeted oncological and psychosocial supports posed difficulties in coping with PCa for MSM. CONCLUSIONS: The negative impact on sexual QoL can be severe for MSM and requires targeted attention. Penile-vaginal intercourse and erectile function have been the primary focus of sexual research and rehabilitation for men with PCa, and do not adequately reflect the sexual practices of MSM. Our findings suggest that future research dedicated to MSM with PCa is needed to incorporate their sexual practices and preferences specifically into treatment decisions, and that targeted oncological and psychosocial support services are also warranted.

Asunto(s)

RESUMEN

INTRODUCTION: The Expanded Prostate Cancer Index Composite (EPIC) is a validated and widely adopted instrument that measures patient quality of life. This study aims to describe and compare patient quality of life in the bowel, urinary, and sexual domains across different prostate cancer treatments. MATERIALS AND METHODS: A systematic review of English articles published prior to 2012 was conducted. Peer reviewed articles reporting longitudinal EPIC data in a statistically analyzable form with clearly defined time points were included. Articles were assessed by content experts to ensure optimal treatment quality. Screening of studies and extraction of data were completed using a predefined data abstraction tool. Data on bowel, urinary, and sexual domains were documented. Scores in each domain range from a low of 0 to a high of 100. RESULTS: Twenty-six articles, representing 8302 patients, were included. All treatments were associated with short term or long term reductions in urinary, bowel, and sexual domains. Surgery patients had better post-treatment bowel quality of life; however, average declines were small regardless of treatment. Post-treatment urinary incontinence scores were lower for surgery patients; while radiation patients had worse urinary irritation. Average urinary bother and function were similar between treatment groups at 18 months post-treatment. Surgery patients had better baseline sexual function. A greater decline in sexual function was observed in surgery patients compared to radiation patients. CONCLUSIONS: Prostate cancer treatments have different impacts on patient quality of life and function. The magnitude of difference between treatment-related adverse effects may be important to patients when choosing therapy.

Asunto(s)

RESUMEN

INTRODUCTION: There is limited data on post-treatment quality of life (QoL) for men-who-have-sex-with-men (MSM) with prostate cancer (PCa). QoL in MSM may not be reflected by assessment tools designed for the heterosexual population. AIMS: Our goals were to evaluate post-treatment QoL in PCa patients who are MSM, and to investigate the utility of current QoL assessment tool. METHODS: PCa patients treated with surgery and/or radiation were recruited from the local MSM community. Each participant completed the Expanded Prostate Cancer Index Composite (EPIC) questionnaire, Male Sexual Health Questionnaire (MSHQ), and a questionnaire focused on insertive and receptive roles of anal intercourse. MAIN OUTCOME MEASURES: Response scores were calculated based on questionnaire design and compared by treatment modality. RESULTS: Seven participants treated with surgery (mean age 58) and eight participants treated with radiation (mean age 67) were recruited. No participant in the surgical group received androgen deprivation therapy (ADT) while two in radiation group were treated with ADT. The sample size of this study did not permit formal statistical analysis, although potential differences in Urinary and Bowel Domains from EPIC and Ejaculation Scale from MSHQ were observed. More participants from the radiation group seemed to be able to maintain both insertive and receptive anal intercourse roles after treatment compared to participants who received surgery. CONCLUSIONS: While the two validated assessment tools suggested similar QoL scores including sexual function for both surgical and radiation groups, post-treatment sexual function related to anal intercourse may be better in the radiation group, as compared to the surgical group. Larger studies in PCa patients from MSM community are warranted to verify these data.

Asunto(s)

RESUMEN

Mutations of the NF1 locus cause neurofibromatosis 1 (NF1), a clinically variable autosomal dominant disease. Expression of neurofibromin, the protein product of the NF1 gene, is regulated in a tissue- and developmentally-specific fashion, but the basis for this regulation is not understood. We used phylogenetic footprinting and other bioinformatic methods to identify potential transcriptional regulatory regions in the 5' upstream region and intron 1 of the NF1 gene from human, mouse, rat, and pufferfish. Three genomic segments that have equal or higher homology than the coding region were found in the NF1 5' upstream region, and four more very highly homologous regions were found in intron 1. Five of these highly homologous regions are confidently predicted to contain transcription factor binding sites. One highly homologous segment in the 5' upstream region spans the transcription start site and contains several potential transcription factor binding sites. This segment includes a novel 24-bp sequence (acttccggtggggtgtcatggcgg) that lies 310-333 bp upstream of the translation initiation site. This sequence, which is identical in human, mouse, and rat and differs by only 1-bp in Fugu, may contain the core promoter element for NF1 transcription.

Asunto(s)