RESUMEN
1. Cellular prion protein, PrP(C), is a ubiquitous glycoprotein strongly expressed in neurons with an as yet unknown biological function. In previous studies, we demonstrated that PrP(C) could be regulated by heat shock stress, implying that it might be a stress-responsive protein. Hyperbaric oxygen (HBO) administration is a well-defined model for the study of oxidative stress. 2. This study investigated the effect of HBO on PrP(C) and Hsp 70 expression in mouse neuroblastoma cell lines (N18), assessing the expression of PrP(C) and Hsp 70 using RT-PCR and Western blotting. HBO administration resulted in a time- and dose-dependent increase in PrP(C) and Hsp70 expression in N18 cells at both mRNA and protein levels, with a concomitant upregulation of c-Jun N-terminal kinase (JNK). 3. Under HBO treatment, luciferase reporter constructs of the rat PrP(C) promoter, containing the heat shock element (HSE) also present in Hsp70, expressed higher luciferase activity (3- to 10-fold) than those constructs without HSE. 4. In summary, these data suggest that PrP(C) and Hsp 70 may be regulated by HBO, through the activation of JNK. Thus, the activated heat shock transcriptional factor 1, phosphorylated by JNK interacted with HSE in the promoter of PrP(C) resulted in increased gene expression. These findings are vital for future therapeutic approaches in transmissible spongiform encephalopathies and the understanding of the function of the PrP(C).
Asunto(s)
Proteínas HSP70 de Choque Térmico/metabolismo , Neuronas/metabolismo , Estrés Oxidativo/fisiología , Oxígeno/farmacología , Proteínas PrPC/metabolismo , Animales , Encéfalo/metabolismo , Encéfalo/fisiopatología , Línea Celular Tumoral , Proteínas de Unión al ADN/efectos de los fármacos , Proteínas de Unión al ADN/genética , Relación Dosis-Respuesta a Droga , Regulación de la Expresión Génica/efectos de los fármacos , Regulación de la Expresión Génica/genética , Proteínas HSP70 de Choque Térmico/efectos de los fármacos , Proteínas HSP70 de Choque Térmico/genética , Factores de Transcripción del Choque Térmico , Oxigenoterapia Hiperbárica , Proteínas Quinasas JNK Activadas por Mitógenos , Luciferasas/genética , Ratones , Proteínas Quinasas Activadas por Mitógenos/efectos de los fármacos , Proteínas Quinasas Activadas por Mitógenos/metabolismo , Neuroblastoma , Neuronas/efectos de los fármacos , Estrés Oxidativo/efectos de los fármacos , Fosforilación , Proteínas PrPC/efectos de los fármacos , Proteínas PrPC/genética , Regiones Promotoras Genéticas/efectos de los fármacos , Regiones Promotoras Genéticas/genética , ARN Mensajero/efectos de los fármacos , ARN Mensajero/metabolismo , Factores de Tiempo , Factores de Transcripción , Regulación hacia Arriba/efectos de los fármacos , Regulación hacia Arriba/fisiologíaRESUMEN
Prion diseases (also known as transmissible spongiform encephalopathies) are associated with the conversion of the normal cellular form of the prion protein (PrPC) to an abnormal scrapie-isoform (PrP(Sc). The conversion of PrP(C) to PrP(Sc) is post-translational and is owing to protein conformational change. This has led to the hypothesis that molecular chaperones may be involved in the folding of prion proteins, and hence the disease process. By treating human NT-2 cells with heat-shock stress, we found that both the mRNA levels for prion protein (PrP) and heat shock protein 70 (HSP70) increased simultaneously after heat treatment. Western-blot analysis of PrP also showed a two-fold increase in PrP protein level 3 after heat treatment. Furthermore, two heat-shock elements (HSEs) were located at the positions of -680 bp (HSE1; GGAACTATTCTTGACATTGCT), and -1653 bp (HSE2; TGAGAACTCAGGAAG) of the rat PrP (RaPrP) gene promoter. Luciferase reporter constructs of the RaPrP promoter with HSE expressed higher luciferase activity (10- to 15-fold) than those constructs without HSE. Electrophoretic gel mobility shift assay (EMSA) and super-shift assay confirmed the interaction of HSE1 and HSE2 with the heat-shock transcription factor-1 (HSTF-1). These results suggest that cellular stress up-regulates both the transcription and translation of PrP through interaction with the HSEs on the PrP gene promoter, resulting in an increase in protein synthesis.