RESUMEN

Bacillus thuringiensis is the most widely used biopesticide, targets a diversity of insect pests belonging to several orders. However, information regarding the B. thuringiensis strains and toxins targeting Zeugodacus cucurbitae is very limited. Therefore, in the present study, we isolated and identified five indigenous B. thuringiensisstrains toxic to larvae of Z. cucurbitae. However, of five strains NBAIR BtPl displayed the highest mortality (LC50 = 37.3 µg/mL) than reference strain B. thuringiensis var. israelensis (4Q1) (LC50 = 45.41 µg/mL). Therefore, the NBAIR BtPl was considered for whole genome sequencing to identify the cry genes present in it. Whole genome sequencing of our strain revealed genome size of 6.87 Mb with 34.95% GC content. Homology search through the BLAST algorithm revealed that NBAIR BtPl is 99.8% similar to B. thuringiensis serovar tolworthi, and gene prediction through Prokka revealed 7406 genes, 7168 proteins, 5 rRNAs, and 66 tRNAs. BtToxin_Digger analysis of NBAIR BtPl genome revealed four cry gene families: cry1, cry2, cry8Aa1, and cry70Aa1. When tested for the presence of these four cry genes in other indigenous strains, results showed that cry70Aa1 was absent. Thus, the study provided a basis for predicting cry70Aa1 be the possible reason for toxicity. In this study apart from novel genes, we also identified other virulent genes encoding zwittermicin, chitinase, fengycin, and bacillibactin. Thus, the current study aids in predicting potential toxin-encoding genes responsible for toxicity to Z. cucurbitae and thus paves the way for the development of B. thuringiensis-based formulations and transgenic crops for management of dipteran pests.

Asunto(s)

RESUMEN

Fine-scale currents, O(1-100 km, days-months), are actively involved in the transport and transformation of biogeochemical tracers in the ocean. However, their overall impact on large-scale biogeochemical cycling on the timescale of years remains poorly understood due to the multiscale nature of the problem. Here, we summarize these impacts and critically review current estimates. We examine how eddy fluxes and upscale connections enter into the large-scale balance of biogeochemical tracers. We show that the overall contribution of eddy fluxes to primary production and carbon export may not be as large as it is for oxygen ventilation. We highlight the importance of fine scales to low-frequency natural variability through upscale connections and show that they may also buffer the negative effects of climate change on the functioning of biogeochemical cycles. Significant interdisciplinary efforts are needed to properly account for the cross-scale effects of fine scales on biogeochemical cycles in climate projections.

Asunto(s)

RESUMEN

Objectives: Stigma towards persons with mental illness is widespread. Mindfulness may protect against stigma by cultivating accepting attitudes, non-reactivity, and prosocial emotions. This study aimed to assess whether higher trait mindfulness among nurses was linked to lower stigma towards psychiatric patients, and whether compassion mediated this relationship. Method: In this cross-sectional study among nurses in four tertiary care hospitals in Sri Lanka, stigma towards psychiatric patients was assessed using the Attribution Questionnaire (AQ-9), which assesses nine separate domains of stigma. The 20-item Six-Facet Mindfulness Questionnaire and the 5-item Santa Clara Brief Compassion Scale were used to assess mindfulness and compassion, respectively. Correlations among these variables were explored. Mediation analyses were performed. Results: A total of 405 nurses (90.6% female, mean age = 39.6 years) participated in the study. Those with higher trait mindfulness were more likely to believe they would help a person with mental illness, and less likely to believe a person with mental illness should be avoided or segregated from the society. Compassion was inversely correlated with avoidance and anger, and positively correlated with pity, helping, and coercion domains. Trait mindfulness was positively correlated with compassion. Mediation models revealed that compassion partially mediated the effects of trait mindfulness on helping and avoidance. Facet-level analyses revealed significant effects of describing, non-reactivity, and observing on several stigma domains mediated through compassion. Conclusions: Trait mindfulness among nurses appears to have a direct buffering effect against several domains of stigma towards psychiatric patients and significant indirect effects through compassion, albeit with small effect sizes. Preregistration: This study is not pre-registered.

RESUMEN

PURPOSE: Ancylostoma spp. causing canine hookworm infections are distributed worldwide with a high prevalence in the South Asian region. Here, we report the first molecular identification of the canine hookworm infecting the dogs in Sri Lanka. METHOD: Fresh faecal samples were collected from free-roaming dogs in tea estate communities in Talawakelle, processed and microscopically analysed for gastro-intestinal parasites. The common dog hookworm Ancylostoma sp. was further investigated using molecular diagnostic tools including PCR, sequencing, and phylogenetic analyses. RESULTS: Of the individual dogs sampled, 97.0% (97/100) were positive for GI parasites, identifying 14 species, all of which were zoonotic. Entamoeba sp. (58.0% (58/100)) was the most prevalent infection and Ancylostoma sp. (45.0% (45/100)) was the most prevalent helminth infection. Overall, helminth prevalence was higher in female dogs (92.5% (37/40)) than male dogs (73.3% (44/60)), potentially due to immune suppression during pregnancy and lactation. The prevalence and burden of Toxocara canis was higher in puppies (≤ 1 year) (68.8%(11/16); Chi-square test; χ2 = 20.912, p < 0.001 and FEC = 5.91; Mann-Whitney U test; p < 0.001), possibly due to vertical trans-mammary or trans-placental transmission of infective larvae. This study also presents the first record of Hymenolepis sp. from dogs in Sri Lanka. Ancylostoma sp. was molecularly confirmed as A. caninum. CONCLUSION: The local variant of A. caninum was phylogenetically unique and showed 99.2% similarity to that from India. The high prevalence of zoonotic GI parasites with public health significance highlights the importance of improving community well-being, veterinary care for dogs, and public awareness on zoonoses.

Asunto(s)

RESUMEN

Engineering of self-disinfecting surfaces to constrain the spread of SARS-CoV-2 is a challenging task for the scientific community because the human coronavirus spreads through respiratory droplets. Titania (TiO2) nanocomposite antimicrobial coatings is one of the ideal remedies to disinfect pathogens (virus, bacteria, fungi) from common surfaces under light illumination. The photocatalytic disinfection efficiency of recent TiO2 nanocomposite antimicrobial coatings for surfaces, dental and orthopaedic implants are emphasized in this review. Mostly, inorganic metals (e.g. copper (Cu), silver (Ag), manganese (Mn), etc), non-metals (e.g. fluorine (F), calcium (Ca), phosphorus (P)) and two-dimensional materials (e.g. MXenes, MOF, graphdiyne) were incorporated with TiO2 to regulate the charge transfer mechanism, surface porosity, crystallinity, and the microbial disinfection efficiency. The antimicrobial activity of TiO2 coatings was evaluated against the most crucial pathogenic microbes such as Escherichia coli, methicillin-resistant Staphylococcus aureus, Pseudomonas aeruginosa, Bacillus subtilis, Legionella pneumophila, Staphylococcus aureus, Streptococcus mutans, T2 bacteriophage, H1N1, HCoV-NL63, vesicular stomatitis virus, bovine coronavirus. Silane functionalizing agents and polymers were used to coat the titanium (Ti) metal implants to introduce superhydrophobic features to avoid microbial adhesion. TiO2 nanocomposite coatings in dental and orthopaedic metal implants disclosed exceptional bio-corrosion resistance, durability, biocompatibility, bone-formation capability, and long-term antimicrobial efficiency. Moreover, the commercial trend, techno-economics, challenges, and prospects of antimicrobial nanocomposite coatings are also discussed briefly.

RESUMEN

Electro-Fenton (EF) technique has gained significant attention in recent years owing to its high efficiency and environmental compatibility for the degradation of organic pollutants and contaminants of emerging concern (CECs). The efficiency of an EF reaction relies primarily on the formation of hydrogen peroxide (H2O2) via 2e─ oxygen reduction reaction (ORR) and the generation of hydroxyl radicals (●OH). This could be achieved through an efficient cathode material which operates over a wide pH range (pH 3-9). Herein, the current progresses on the advancements of carbonaceous cathode materials for EF reactions are comprehensively reviewed. The insights of various materials such as, activated carbon fibres (ACFs), carbon/graphite felt (CF/GF), carbon nanotubes (CNTs), graphene, carbon aerogels (CAs), ordered mesoporous carbon (OMCs), etc. are discussed inclusively. Transition metals and hetero atoms were used as dopants to enhance the efficiency of homogeneous and heterogeneous EF reactions. Iron-functionalized cathodes widened the working pH window (pH 1-9) and limited the energy consumption. The mechanism, reactor configuration, and kinetic models, are explained. Techno economic analysis of the EF reaction revealed that the anode and the raw materials contributed significantly to the overall cost. It is concluded that most reactions follow pseudo-first order kinetics and rotating cathodes provide the best H2O2 production efficiency in lab scale. The challenges, future prospects and commercialization of EF reaction for wastewater treatment are also discussed.

Asunto(s)

RESUMEN

Berseem (Trifolium alexandrinum) is a winter season legume fodder crop widely cultivated in the central and northern parts of India. It is considered the 'King of fodder' for its high quality green fodder, which is a rich source of protein and low in fibre. Symptoms similar to collar rot were observed in experimental sites at the ICAR-Indian Grassland and Fodder Research institute (IGFRI), Jhansi (N25º 52' 749.20″, E78º 55' 452.70″), Uttar Pradesh, India in March 2019. The incidence of disease was ranged from 18 to 22% during 2019. Symptoms included dark colored water-soaked lesions at the base of stems, stem thinning (resembles wire stem) and eventually wilting of the whole plant. A white mycelial mat was observed on the stem and collar region and light brown to tan colored sclerotial bodies formed as disease progressed. To determine the etiology of the infection, 30 diseased plants with typical symptoms were collected from the 3 different fields and used for the isolation of causal agent. Infected stem portion were cut in to small pieces (5mm), surface sterilized with 2% sodium hypochlorite (NaOCl) for 2 minutes, washed three times with sterile distilled water and air dried. The sterilized infected tissues were cultured on potato dextrose agar amended with streptomycin sulphate @ 50µg/ml and incubated at 28±1º C for 3 days. After four days, hyaline septate mycelia ranging 2-3µm in diameter grow radially over the whole plate (90 mm). Sclerotia formation started 6 days after incubation. Sclerotia were initially white and later turned brownish to tan as they matured. The number of sclerotia per plate ranged from 55 to 120 (n=5) at 12 days after inoculation. The diameter of matured sclerotial bodies ranged from 0.1mm to 1.35mm (n=25). Genomic DNA was extracted from mycelium using the CTAB method (Murray and Thompson, 1980). Three regions of rDNA viz., internal transcribed spacer (ITS), large subunit (LSU), and small subunit (SSU) were used to identify the etiology of the disease. The isolate was amplified with ITS1 (5'CGGATCTCTTGGTTCTGGGA3')/ ITS4 (5'GACGCTCGAACATGCC3') described by White et al. (1990) and sequenced. The ITS sequence (NCBI GenBank Accession No: MT026581) showed 98.21 % similar to Athelia rolfsii (MH514001.1). The isolate also amplified with primers LSU (LROR: ACCCGCTGAACTTAAGC/ LR5: TCCTGAGGGAAACTTCG) and SSU (NS1: GTAGTCATATGCTTGTCTC/ NS4: CTTCCGTCAATTCCTTTAAG). The LSU (MT225781) and SSU (MT225782) sequences showed 99.90 % and 100 % similarity to Athelia rolfsii (AY635773.1) and Athelia rolfsii (AY635773.1) respectively. Based on the morphological and molecular characteristics, the pathogen responsible for collar rot in berseem was identified as Athelia rolfsii (Anamorph: Sclerotium rolfsii) (Mordue, 1974). To confirm pathogenicity, inoculum was prepared by inoculating mycelial plugs of pathogen into autoclaved corn sand meal (5:95) and incubated at 28±1º C for 12 days. The inoculum (30g) was placed at stem portion of 15 day old seedlings (n=30) of berseem (Cv. Wardan) raised in pots filled with sterilized soil. Seedlings (n=25) inoculated with sterilized corn sand meal (30g) served as the control. The pots were placed inside of a plant growth chamber (26±2º C, 65% RH) for 15 days. Water soaked spots with white mycelium were observed on the collar region after 3 days. After 7 days, stems were completely covered by mycelia and death of seedlings was observed 14 days after inoculation. The pathogen was recovered from the artificially inoculated berseem seedlings (n=15). No symptoms were observed in control plants. Based on morphological and molecular characterization, the present isolate was confirmed as Sclerotium rolfsii. To the best of our knowledge, this is the first report of S. rolfsii causing collar rot of berseem in India.

RESUMEN

The outbreak of COVID-19 has spread rapidly across the globe, greatly affecting how humans as a whole interact, work and go about their daily life. One of the key pieces of personal protective equipment (PPE) that is being utilised to return to the norm is the face mask or respirator. In this review we aim to examine face masks and respirators, looking at the current materials in use and possible future innovations that will enhance their protection against SARS-CoV-2. Previous studies concluded that cotton, natural silk and chiffon could provide above 50% efficiency. In addition, it was found that cotton quilt with a highly tangled fibrous nature provides efficient filtration in the small particle size range. Novel designs by employing various filter materials such as nanofibres, silver nanoparticles, and nano-webs on the filter surfaces to induce antimicrobial properties are also discussed in detail. Modification of N95/N99 masks to provide additional filtration of air and to deactivate the pathogens using various technologies such as low- temperature plasma is reviewed. Legislative guidelines for selecting and wearing facial protection are also discussed. The feasibility of reusing these masks will be examined as well as a discussion on the modelling of mask use and the impact wearing them can have. The use of Artificial Intelligence (AI) models and its applications to minimise or prevent the spread of the virus using face masks and respirators is also addressed. It is concluded that a significant amount of research is required for the development of highly efficient, reusable, anti-viral and thermally regulated face masks and respirators.

RESUMEN

OBJECTIVE: The objective is to evaluate and compare immunohistochemically, the biological behavior of keratocystic odontogenic tumor (KCOT) with normal oral mucosa by analyzing cell proliferation, angiogenesis, and antiapoptosis using cyclooxygenase-2 (COX-2), protein 53 (p53), B-cell lymphoma-2 (Bcl-2), and CD105 (endoglin). MATERIALS AND METHODS: The present study comprised 30 cases of KCOT in the study group, in which the expression of COX-2, p53, Bcl-2, and CD105 were analyzed and compared with that of control group consisting of 30 normal oral mucosae. RESULTS: The results were evaluated based on a number of positively stained cells; among 30 samples of KCOT, 22 samples were p53 positive, 23 samples were Bcl-2 positive, 18 samples were COX-2 positive, whereas all the above markers were negative in all the 30 samples of the normal oral mucosa and CD105 mean vascular density in KCOT 13.8 in normal oral mucosa. CONCLUSION: The present study suggests that angiogenesis, cell proliferation, and antiapoptosis may be the possible factors contributing for the unique biological behavior of KCOT.

RESUMEN

BACKGROUND: Significant increase in cell proliferation and vascularity occurs during the transition from normal oral mucosa through differing degrees of dysplasia to oral squamous cell carcinoma (OSCC). AIMS: To evaluate the cell proliferation and vascularity in potentially malignant disorders and OSCC. SETTINGS AND DESIGN: Proliferating cell nuclear antigen (PCNA), vascular endothelial growth factor (VEGF) and CD34 were quantified immunohistochemically (IHC) using anti-PCNA, anti-VEGF and anti-CD34 antibody. MATERIALS AND METHODS: A total of 60 archival specimens included 10 oral lichen planus, 10 oral leukoplakia, 10 oral submucous fibrosis and 30 OSCC (well differentiated, moderately differentiated and poorly differentiated), and also, 10 normal oral mucosa as control group were taken. PCNA, VEGF and CD34 expression was assessed in relation to the localization and area of IHC-stained cells. STATISTICAL ANALYSIS: One-way analysis of variance test and post hoc least significant difference test were assessed for statistical significance. RESULTS: Cell proliferation and vascularity appeared to increase gradually with disease progression. CONCLUSION: Upregulation of cell proliferation and vascularity indicates their possible role in malignant transformation of potentially malignant disorders.

RESUMEN

Penetrating abdominal trauma forms an important component of surgical emergencies, most of the victims being young aged in the prime of their life. Over the past century, the diagnosis and management of this common problem has seen drastic changes, finally reaching the destination of selective approach. We present our experience in the management of this group of patients in the rural setup. This is a prospective observational study done at our hospital between 1 April 2013 and 31 March 2015 including patients who presented with penetrating abdominal injury. The clinical presentation, imaging features, diagnosis, management, and complications of all these patients are analyzed. The mean age was 33.5 years with majority being males. Homicidal stab injuries accounted for most of the injuries (62.5 %). Forty-eight patients underwent laparotomy, and among which, the procedure was therapeutic in 36 patients. Peritoneal penetration was the best predictor of a therapeutic laparotomy with a high sensitivity and positive predictive value (100 and 80 %, respectively). The small intestine was the most commonly injured organ. The mean postoperative stay was 8.25 days, and there was no mortality. Though the management of these patients should aim at minimizing the rate of negative laparotomies, this should not be done at the expense of delayed diagnosis and treatment. Diagnostic laparoscopy may avoid unnecessary laparotomies; however, it requires adequate skills in laparoendoscopy. Management is best tailor made for each individual based on the nature of injury, findings at presentation, and the organ injured.

RESUMEN

INTRODUCTION: Odontogenic cysts and tumors have variable recurrence rates. Recurrence rate is mainly due to the activity of the epithelium. The epithelium of these lesions has been investigated extensively in regard to their role in proliferative and aggressive behavior of the lesions. However, the role of the connective tissue wall in their behavior has not been studied as extensively. Collagen is an essential part of the connective tissue as a whole and fibrous wall of cystic lesions especially. It is demonstrated by picrosirius red dye staining combined with polarization microscopy. This method permits the evaluation of the nature of the collagen fibers in addition to their thickness. MATERIALS AND METHODS: A total of 56 histopathologically diagnosed cases comprising odontogenic follicle, dentigerous cyst, unicystic ameloblastoma, keratocystic odontogenic tumor (KCOT), multicystic/solid ameloblastoma, and ameloblastic carcinoma were taken and stained using picrosirius red stain and evaluated using a polarizing microscope. RESULTS: Collagen fibers in odontogenic follicles and dentiger-ous cysts showed predominant orange-red birefringence; fibers in unicystic ameloblastoma and KCOT showed both orange red and greenish-yellow birefringence; and fibers of multicystic/ solid ameloblastoma showed predominant greenish-yellow birefringence and ameloblastic carcinoma that showed almost complete greenish birefringence. As the biological behavior of the lesions in the spectrum studied progress toward aggressive nature, increase in immature collagen fibers is noticed. CONCLUSION: This study suggests that the nature of collagen fibers plays a pivotal role in predicting the biological behavior of odontogenic lesions. CLINICAL SIGNIFICANCE: Aggressive nature of the odontogenic lesions is determined by both the epithelium and the connective tissue components (collagen). Studying the nature and type of collagen helps in predicting its biological behavior.

Asunto(s)

RESUMEN

In this study we have assessed, using dielectric relaxation spectroscopy (DRS), the confinement effects of the more mobile chain in partially miscible polymeric blends of PS/PVME (polystyrene/poly(vinyl methyl ether)) in the presence of anisotropically shaped MWCNTs (multiwalled carbon nanotubes). To understand if this confinement effect is very specific to MWCNTs, the characteristic dimensions of which are often close to the radius of gyration of the polymeric chains, a few other particles like spherical silver, stacked clay tactoids and platy graphene sheets at similar weight fractions were also incorporated and systematically studied. The DRS studies reveal that the more mobile chain (here PVME) experiences possibly two different environments in the presence of frozen PS and more importantly in the presence of MWCNTs at temperatures close to and not so far from the blend Tg. The presence of bimodal relaxations with a weak temperature independent faster relaxation in the blends is composition dependent (PS rich blends). Assuming that there are no chemical interactions of PVME with the particles, these confinement effects seem to be very specific to MWCNTs as the bimodal relaxations were completely absent in the case of other nanoparticles. In the case of polymer blends, when two different chains are brought together, a loss in the deformational entropy is expected due to the excluded volume interaction and chain connectivity effects. In the presence of nanoparticles, especially MWCNTs, the polymer coils are subjected to perturbation leading to entropic loss in the system, which determine the miscibility in the blends. The configurational entropy near glass transition was assessed to understand the improved miscibility due to MWCNTs in this particular blend. The length of cooperativity suggests a cooperative motion of PS and PVME over shorter length scales in the case of MWCNTs as compared to other particles. This also hints at perturbed PVME motion in the network of MWCNTs. Taken together, our study reveals that the kinetic PVME arrest results in two different environments and is dependent on the effective concentration of MWCNTs in the blends.

RESUMEN

Median arcuate ligament (MAL) syndrome is an uncommon condition caused by the external compression of the celiac trunk by the median arcuate ligament. In the current era of technological advancement, this syndrome may be corrected through the laparoscopic approach. We report two patients who were diagnosed as MAL syndrome and underwent laparoscopic division of MAL fibers at our institute. Both the patients improved symptomatically following the procedure and were discharged on the fourth post-operative day. Also, they remained symptom free during subsequent follow-up period of 1 year and 8 months, respectively. Laparoscopic approach to correct the MAL syndrome is feasible and safe. It may be the preferred modality of treatment in view of its superior visualization and lack of morbidity. However, adequate experience in advanced laparoscopic surgery is required before attempting this procedure.

RESUMEN

RATIONALE: Public health and preventive medicine (PHPM) has been recognized internationally as a physician specialty, but national parallels and differences exist between training contexts. This paper reviews PHPM training and employment in Canada, France, Italy, Japan, the United Kingdom, and the USA. METHODS: Information gathered from relevant accreditation bodies and literature searches was used to create descriptive profiles of national training demographics and structure and a narrative outlining trends and challenges facing the specialty. RESULTS: Notable similarities and differences exist between national contexts. Key themes were differences in training strategies and practice scope, specialty stakeholders, certification structure, and funding. Recognition challenges faced the specialty across all six countries. Other challenges included unclear competencies and training strategies and a need for PHPM specialists to highlight their role in combating population health threats. Additional differences existed between comparator countries on the structure of training, funding sources for training programs, availability of training posts, and linkages with other physician specialties. CONCLUSION: Highlighting these themes is a first step to fostering training collaborations between PHPM specialist physicians to augment transnational action on global public health challenges and also supports PHPM physician educators with innovative solutions from abroad that might address domestic specialty challenges.

Asunto(s)

RESUMEN

Myositis ossificans is a rare disease that is characterized by bone deposition in the muscle or soft tissues. Myositis ossificans of the masticatory muscles is an uncommon finding. The condition is benign and results in heterotopic bone formation in the muscles of mastication, usually producing limitation of opening of the jaws. It is important to know the exact cause of the limitation of opening of the jaws for successful treatment. Computed tomographic scan and panoramic radiographs along with histological findings are essential diagnostic aids for evaluating conditions such as myositis ossificans. A rare case of myositis ossificans traumatica of temporalis and medial pterygoid muscle is presented here along with the discussion of clinical, radiological and histological features. The present case emphasizes not only on the importance of considering myositis ossificans in the differential diagnosis of limitation of opening of the jaws but also on the improvement of the overall mouth opening and treatment results.

RESUMEN

BACKGROUND AND PURPOSE: Rates of stroke incidence and mortality vary across populations with important differences between socioeconomic groups worldwide. Knowledge of existing disparities in stroke risk is important for effective stroke prevention and management strategies. This review updates the evidence for associations between socioeconomic status and stroke. Summary of Review- Studies were identified with electronic searches of MEDLINE and EMBASE databases (January 2006 to July 2011) and reference lists from identified studies were searched manually. Articles reporting the association between any measure of socioeconomic status and stroke were included. CONCLUSIONS: The impact of stroke as measured by disability-adjusted life-years lost and mortality rates is >3-fold higher in low-income compared with high- and middle-income countries. The number of stroke deaths is projected to increase by >30% in the next 20 years with the majority occurring in low-income countries. Higher incidence of stroke, stroke risk factors, and rates of stroke mortality are generally observed in low compared with high socioeconomic groups within and between populations worldwide. There is less available evidence of an association between socioeconomic status and stroke recurrence or temporal trends in inequalities. Those with a lower socioeconomic status have more severe deficits and are less likely to receive evidence-based stroke services, although the results are inconsistent. Poorer people within a population and poorer countries globally are most affected in terms of incidence and poor outcomes of stroke. Innovative prevention strategies targeting people in low socioeconomic groups are required along with effective measures to promote access to effective stroke interventions worldwide.

Asunto(s)

RESUMEN

BACKGROUND AND PURPOSE: Estimates of risk of stroke recurrence are widely variable and focused on the short- term. A systematic review and meta-analysis was conducted to estimate the pooled cumulative risk of stroke recurrence. METHODS: Studies reporting cumulative risk of recurrence after first-ever stroke were identified using electronic databases and by manually searching relevant journals and conference abstracts. Overall cumulative risks of stroke recurrence at 30 days and 1, 5, and 10 years after first stroke were calculated, and analyses for heterogeneity were conducted. A Weibull model was fitted to the risk of stroke recurrence of the individual studies and pooled estimates were calculated with 95% CI. RESULTS: Sixteen studies were identified, of which 13 studies reported cumulative risk of stroke recurrence in 9115 survivors. The pooled cumulative risk was 3.1% (95% CI, 1.7-4.4) at 30 days, 11.1% (95% CI, 9.0-13.3) at 1 year, 26.4% (95% CI, 20.1-32.8) at 5 years, and 39.2% (95% CI, 27.2-51.2) at 10 years after initial stroke. Substantial heterogeneity was found at all time points. This study also demonstrates a temporal reduction in 5-year risk of stroke recurrence from 32% to 16.2% across the studies. CONCLUSIONS: The cumulative risk of recurrence varies greatly up to 10 years. This may be explained by differences in case mix and changes in secondary prevention over time However, methodological differences are likely to play an important role and consensus on definitions would improve future comparability of estimates and characterization of groups of stroke survivors at increased risk of recurrence.

Asunto(s)

RESUMEN

Concentrations and accumulation of 13 fluorinated organic compounds (FOCs) in human sera and seminal plasma were measured in an Asian developing country, Sri Lanka. Six of the FOCs, PFOS (perfluorooctanesulfonate), PFHS (perfluorohexanesulfonate), PFUnA (perfluoroundecanoic acid), PFDA (perfluorodecanoic acid), PFNA (perfluorononanoic acid) and PFOA (perfluorooctanoic acid), were detected in all of the sera samples. Measurable quantities of two main perfluorosulfonates, PFOS and PFHS, were found in all seminal plasma samples. The detection frequency of the predominant perfluoroalkylcarboxylate, PFOA, in seminal plasma was >70%. Accumulation of PFOS in sera was significantly positively correlated with PFOA, PFHS and PFNA. Positive linear regressions were also found between PFNA and PFUnA and PFNA and PFDA suggesting that these compounds may have a similar origin of exposure and accumulation. Significantly positive associations were observed for partitioning of both PFOS and PFNA between sera and seminal plasma. The accumulation of FOCs was not significantly different in sera from Colombo (urban population) and Talawakele (rural conventional tea workers). However, the Haldummulla population (rural organic tea workers) had relatively lower exposure to FOCs compared to the other two groups, urban and rural conventional tea workers. Concentrations of FOCs in Sri Lanka were similar to those reported for industrialized countries suggesting that human exposure to such chemicals is widespread even in developing countries. The novel finding of FOCs in human seminal plasma implies that further studies are needed to determine whether long-term exposure in humans can result in reproductive impairments.

Asunto(s)