RESUMEN

Universalising actions aimed at water supply in rural communities and indigenous populations must focus on simple and low-cost technologies adapted to the local context. In this setting, this research studied the dynamic gravel filter (DGF) as a pre-treatment to household slow-sand filters (HSSFs), which is the first description of a household multistage filtration scale to treat drinking water. DGFs (with and without a non-woven blanket on top of the gravel layer) followed by HSSFs were tested. DGFs operated with a filtration rate of 3.21 m3 m-2.d-1 and HSSFs with 1.52 m3 m-2.d-1. Influent water contained kaolinite, humic acid and suspension of coliforms and protozoa. Physical-chemical parameters were evaluated, as well as Escherichia coli, Giardia spp. cysts and Cryptosporidium spp. oocyst reductions. Removal was low (up to 6.6%) concerning true colour, total organic carbon and absorbance (λ = 254 nm). Nevertheless, HMSFs showed turbidity decrease above 60%, E. coli reduction up to 1.78 log, Giardia cysts and Cryptosporidium oocysts reductions up to 3.15 log and 2.24 log, respectively. The non-woven blanket was shown as an important physical barrier to remove solids, E. coli and protozoa.

Asunto(s)

RESUMEN

Garlic is the fifth most economically important vegetable in Brazil and is frequently infected by a complex of different viruses that cause significant degeneration of the crop under field conditions. The species of the genus Allexivirus that infect garlic are: Garlic virus A (GarV-A), Garlic virus B (GarV-B), Garlic virus C (GarV-C), Garlic virus D (GarV-D), Garlic virus E (GarV-E), Garlic virus X (GarV-X), Garlic mite-borne filamentous viru s (GarMbFV), and Shallot virus X (ShVX). So far, only GarV-A, GarV-B, GarV-C, GarV-D, and GarMbFV have been reported in Brazil (3). During the 2010 through 2013 seasons, between April and October, 302 garlic plants with yellow mosaic strips and distorted leaves from the cultivars Caçador, Quitéria, Tropical Bergamota, and Tropical Shangai were collected in the states of Paraná, Minas Gerais, São Paulo, and Goiás and analyzed for the presence of allexiviruses. Total plant RNA was extracted with the Total RNA Purification kit (Norgen Biotek Corp., Canada) according to manufacturer's instructions. RT-PCR reactions were performed initially with the primer pair named Cpallexi-senso2 (5' CTACCACAAYGGNTCVTC 3') and Cpallexi-anti1 (5' CACNGCGTTRAAGAARTC 3') specifically designed to amplify a ~230-bp fragment from all currently known allexiviruses. Positive samples were then analyzed with specific primers for GarV-A, GarV-C, and GarV-D (2), GarMbFV (1) and GarV-B named CPBS2 (5' GCAGAATAARCCCCCYTC 3') and CPBA1 (5' RAAGGGTTTATTCTGTTG 3') obtained in this work. Among the plants analyzed, 50 were positive for the Cpallexi-senso2/Cpallexi-anti1 primers but negative for all the specific primers tested, indicating the presence of a different allexivirus. These samples were then analyzed by RT-PCR for the presence of GarV-X, GarV-E, and ShVX and an amplicon of ~550 bp was obtained only with primers CPXS2 (5' GCCTTCTGAAAATGACTTAG 3') and CPXA1 (5' CTAGGATTTGCTGTTGGG 3') designed in this work to amplify a fragment of the capsid protein gene for GarV-X. Since species demarcation in the genus Allexivirus is based on the coat protein (CP) gene (2), another set of primers, namely PIXS1 (GACGACGGYGCACTACTC) / PIXA1 (YGTGAATCGTGATGATCC) and PFXS2 (CRCTGAGACAATTYYGTGG) / PFXA2 (CAAAGCATCGGCCRTAGCG) derived from conserved regions of ORF4, ORF5 (CP), and ORF 6 sequences of allexiviruses available in the NCBI database, were used in RT-PCR to obtain the complete CP gene nucleotide sequence. A 1,071-nt sequence comprising 108 bp of ORF4 (partial), 732 bp of the CP, and 177 bp of ORF 6 was successfully amplified (GenBank Accession No. KF530328). The complete CP gene showed 98% nucleotide sequence identity with GarV-X from Australia (JQ807994.1). In summary, GarV-X was detected in the 50 samples collected from Minas Gerais, São Paulo, and Paraná, indicating widespread distribution in Brazil. To our knowledge, this is the first report of GarV-X in garlic in Brazil. References: (1) M. S. Fayad-Andre et al. Trop. Plant Pathol. 36:341, 2011. (2) P. A. Melo Filho et al. Pesq. Agropec. Bras. 39:735, 2004. (3) R. J. Nascimento et al. Summa Phytopathol. 34:267, 2008.

Asunto(s)

RESUMEN

In this work we investigated the toxicity of a polyphenolic p-benzoquinone derivative, the tetrahydroxy-1,4-quinone (THQ) toward V79 Chinese hamster fibroblasts and analyzed the role of H2O2 and Ca2+ in that mechanism. The exposure of exponentially growing cultures to THQ, in the presence of 1.0 mM Ca2+, caused a dose-dependent inhibition of cell growth and DNA synthesis. Complete prevention of those effects by catalase indicated that H2O2-induced damages should underlie both toxic processes. Further detection of a rise in the intracellular free Ca2+ concentration ([Ca2+]i) in cells exposed to THQ plus Ca2+, together with the partial protection conferred by the intracellular Ca(2+)-chelator fura-2 against cell growth inhibition, indicated that a disruption of Ca2+ homeostasis is a determinant event in THQ cytotoxicity. Furthermore, the intracellular accumulation of rhodizonic acid (RDZ), the primary oxidative product of THQ, indicated that THQ, or its corresponding semiquinone form, was entering the cells and undergoing further autoxidation to RDZ. It was also evidenced that mitochondria represent an important target in the development of THQ toxicity, as shown by the disruption of the transmembrane electrical potential (delta psi) of isolated rat liver mitochondria, as well as by the Ca(2+)-release by mitochondria of permeabilized V79 cells. We concluded that disruption of Ca2+ homeostasis and generation of H2O2 are critically involved in THQ-induced impairment of DNA replication and mitochondrial functions, leading ultimately to cell growth inhibition.

Asunto(s)

RESUMEN

Cell viability requires the perfect functioning of the processes controlling ATP and Ca2+ homeostasis. It is known that cell death caused by a variety of toxins or pathological conditions is associated with disruption of ATP and Ca2+ homeostasis. Therefore, the study of the mechanisms by which different T. cruzi stages regulate the intracellular Ca2+ distribution and the ATP supply to maintain cell viability could provide new insights into the physiology of these parasites. One important objective of these studies is the identification of possible metabolic differences between host and parasite that could be exploited for the rational design of new and more effective trypanocidal drugs.

Asunto(s)

RESUMEN

Cell viability requires the perfect functioning of the processes controlling ATP and Ca2+ homeostasis. It is known that cell death caused by a variety of toxins or pathological conditions is associated with disruption of ATP and Ca2+ homeostasis. Therefore, the study of the mechanisms by which different T. cruzi stages regulate the intracellular Ca2+ distribution and the ATP supply to maintain cell viability could provide new insights into the physiology of these parasites. One important objective of these studies is the identification of possible metabolic differences between host and parasite that could be exploited for the rational design of new and more effective trypanocidal drugs

Asunto(s)

RESUMEN

The biosynthetic pigment from Chromobacterium violaceum BB-78, 1,3-dihydro-2H-indol-2-one and its derivatives exhibit biological activities such as antimicrobial action, low hemolytic effects on red blood cells and in vitro trypanocide activity. A relatively high cytotoxicity on V-79 hamster fibroblast cells of the biosynthetic pigment was found, although with the methylol derivative the toxicity was almost eliminated. The methylol derivative exhibited similar toxicity as Nifurtimox, a known, commercial trypanocide compound.

Asunto(s)

RESUMEN

Trypanosoma cruzi epimastigotes maintained an intracellular free calcium concentration of about 0.15 microM, as measured with the fluorescent indicator Fura-2. The maintenance of low [Ca2+]i is energy-dependent since it is disrupted by KCN and FCCP. When the cells were permeabilized with digitonin, the steady-state free Ca2+ concentration in the absence of ATP was about 0.7 microM. The additional presence of ATP resulted in a steady-state level close to 0.1-0.2 microM which compares favorably with the concentration detected in intact cells. Intracellular Ca2+ uptake at high levels of free Ca2+ (greater than 1 microM) was due to energy-dependent mitochondrial uptake as indicated by its FCCP-sensitivity. However, as the free Ca2+ concentration was lowered from 1 microM, essentially all uptake was due to the ATP-dependent Ca2+ sequestration by the endoplasmic reticulum as indicated by its stimulation by ATP, and its inhibition by sodium vanadate. High concentrations of the calmodulin antagonist trifluoperazine, inhibited both the Ca2+ uptake by the endoplasmic reticulum and by the mitochondria, while calmidazolium released Ca2+ from both compartments. In addition, trifluoperazine and calmidazolium inhibited respiration and collapsed the mitochondrial membrane potential of T. cruzi, thus indicating non-specific effects unrelated to calmodulin.

Asunto(s)

Asunto(s)