RESUMEN
The paper addresses the loop shaping problem in the altitude control of an unmanned aerial vehicle to land the flying robot with a specific landing scenario adopted. The proposed solution is optimal, in the sense of the selected performance indices, namely minimum-time, minimum-energy, and velocity-penalized related functions, achieving their minimal values, with numerous experiments conducted throughout the development and preparation to the Mohamed Bin Zayed International Robotics Challenge (MBZIRC 2020). A novel approach to generation of a reference altitude trajectory is presented, which is then tracked in a standard, though optimized, control loop. Three landing scenarios are considered, namely: minimum-time, minimum-energy, and velocity-penalized landing scenarios. The experimental results obtained with the use of the Simulink Support Package for Parrot Minidrones, and the OptiTrack motion capture system proved the effectiveness of the proposed approach.
RESUMEN
Expedited development programs for biological products to be used in the treatment of serious conditions bring about challenges because of the compressed clinical development timeframes. As expedited development does not lessen the quality expectations, one challenge is providing adequate chemistry, manufacturing, and control (CMC) information required to support approval of a biological product. In particular, the analytical comparability and, in some cases, pharmacokinetic comparability studies needed to bridge the clinical material to the commercial material could delay submission of applications for life-saving medicines. While there is the International Council for Harmonisation of Technical Requirements for Pharmaceuticals for Human Use (ICH) Topic Q5E guidance on assessing comparability of biological products before and after manufacturing changes, specific guidance on the emerging issue of conducting comparability exercises in the face of expedited drug development is lacking. In July 2019, clinical pharmacologists and product quality chemists from the US FDA and industry representatives convened an FDA workshop for a scientific exchange about considerations and challenges around conducting comparability exercises for expedited programs for biological products. This article highlights discussions from the workshop.
Asunto(s)
Productos Biológicos/farmacocinética , Productos Biológicos/normas , Desarrollo de Medicamentos/normas , Congresos como Asunto , Aprobación de Drogas , Industria Farmacéutica , Humanos , Control de Calidad , Estados Unidos , United States Food and Drug AdministrationRESUMEN
An efficient process for the purification of synthetic phosphorothioate and native DNA sequences is presented. The process is based on the use of an aminopropylated silica gel support functionalized with aminooxyalkyl functions to enable capture of DNA sequences through an oximation reaction with the keto function of a linker conjugated to the 5'-terminus of DNA sequences. Deoxyribonucleoside phosphoramidites carrying this linker, as a 5'-hydroxyl protecting group, have been synthesized for incorporation into DNA sequences during the last coupling step of a standard solid-phase synthesis protocol executed on a controlled pore glass (CPG) support. Solid-phase capture of the nucleobase- and phosphate-deprotected DNA sequences released from the CPG support is demonstrated to proceed near quantitatively. Shorter than full-length DNA sequences are first washed away from the capture support; the solid-phase purified DNA sequences are then released from this support upon reaction with tetra-n-butylammonium fluoride in dry dimethylsulfoxide (DMSO) and precipitated in tetrahydrofuran (THF). The purity of solid-phase-purified DNA sequences exceeds 98%. The simulated high-throughput and scalability features of the solid-phase purification process are demonstrated without sacrificing purity of the DNA sequences. © 2017 by John Wiley & Sons, Inc.
Asunto(s)
Cromatografía Líquida de Alta Presión/métodos , ADN/aislamiento & purificación , Ensayos Analíticos de Alto Rendimiento/métodos , Espectroscopía de Resonancia Magnética con Carbono-13 , ADN/química , Espectroscopía de Protones por Resonancia Magnética , Espectrometría de Masa por Ionización de ElectrosprayRESUMEN
Although high-throughput methods for solid-phase synthesis of DNA sequences are currently available for synthetic biology applications and technologies for large-scale production of nucleic acid-based drugs have been exploited for various therapeutic indications, little has been done to develop high-throughput procedures for the purification of synthetic nucleic acid sequences. An efficient process for purification of phosphorothioate and native DNA sequences is described herein. This process consists of functionalizing commercial aminopropylated silica gel with aminooxyalkyl functions to enable capture of DNA sequences carrying a 5'-siloxyl ether linker with a "keto" function through an oximation reaction. Deoxyribonucleoside phosphoramidites functionalized with the 5'-siloxyl ether linker were prepared in yields of 75-83% and incorporated last into the solid-phase assembly of DNA sequences. Capture of nucleobase- and phosphate-deprotected DNA sequences released from the synthesis support is demonstrated to proceed near quantitatively. After shorter than full-length DNA sequences were washed from the capture support, the purified DNA sequences were released from this support upon treatment with tetra-n-butylammonium fluoride in dry DMSO. The purity of released DNA sequences exceeds 98%. The scalability and high-throughput features of the purification process are demonstrated without sacrificing purity of the DNA sequences.
Asunto(s)
ADN/síntesis química , Técnicas de Síntesis en Fase Sólida , Animales , Secuencia de Bases , Cromatografía Líquida de Alta Presión , ADN/química , Escherichia coli/enzimología , Espectroscopía de Resonancia Magnética , Ácidos Nucleicos , Compuestos Organofosforados , Fosfatos/química , Dióxido de Silicio/química , Venenos de Serpiente/enzimologíaRESUMEN
Commercial N(2)-isobutyryl-5'-O-(4,4'-dimethoxytrityl)-2'-O-(propargyl)guanosine is converted to its 3'-O-levulinyl ester in a yield of 91%. The reaction of commercial N(2)-isobutyryl-5'-O-(4,4'-dimethoxytrityl)-2'-O-tert-butyldimethylsilyl-3'-O-[(2-cyanoethyl)-N,N-diisopropylaminophosphinyl]guanosine with N(2)-isobutyryl-2'-O-propargyl-3'-O-(levulinyl)guanosine provides, after P(III) oxidation, 3'-/5'-deprotection, and purification, the 2'-O-propargylated guanylyl(3'-5')guanosine 2-cyanoethyl phosphate triester in a yield of 88%. Phosphitylation of this dinucleoside phosphate triester with 2-cyanoethyl tetraisopropylphosphordiamidite and 1H-tetrazole, followed by an in situ intramolecular cyclization, gives the propargylated cyclic dinucleoside phosphate triester, which is isolated in a yield of 40% after P(III) oxidation and purification. Complete removal of the nucleobases, phosphates, and 2'-O-tert-butyldimethylsilyl protecting groups leads to the desired propargylated c-di-GMP diester. Cycloaddition of a biotinylated azide with the propargylated c-di-GMP diester under click conditions provides the biotinylated c-di-GMP conjugate in an isolated yield of 62%. Replacement of the 6-oxo function of N(2)-isobutyryl-5'-O-(4,4'-dimethoxytrityl)-3'-O-levulinyl-2'-O-(propargyl)guanosine with a 2-cyanoethylthio group is effected by treatment with 2,4,6-triisopropybenzenesulfonyl chloride and triethylamine to give a 6-(2,4,6-triisopropylbenzenesulfonic acid) ester intermediate. Reaction of this key intermediate with 3-mercaptoproprionitrile and triethylamine, followed by 5'-dedimethoxytritylation, affords the 6-(2-cyanoethylthio)guanosine derivative in a yield of 70%. The 5'-hydroxy function of this derivative is reacted with commercial N(2)-isobutyryl-5'-O-(4,4'-dimethoxytrityl)-2'-O-tert-butyldimethylsilyl-3'-O-[(2-cyanoethyl)-N,N-diisopropylaminophosphinyl]guanosine. The reaction product is then converted to the mono-6-thioated c-di- GMP biotinylated conjugate under conditions highly similar to those described above for the preparation of the biotinylated c-di-GMP conjugate, and isolated in similar yields.
Asunto(s)
Biotinilación/métodos , Química Clic/métodos , GMP Cíclico/análogos & derivados , Guanosina Monofosfato/análogos & derivados , Azidas/química , GMP Cíclico/química , Fosfatos de Dinucleósidos/química , Guanosina/química , Guanosina Monofosfato/química , Tetrazoles/químicaRESUMEN
The reaction of 2-cyano-2-methyl propanal with 2'-O-aminooxymethylribonucleosides leads to stable and yet reversible 2'-O-(2-cyano-2,2-dimethylethanimine-N-oxymethyl)ribonucleosides. Following N-protection of the nucleobases, 5'-dimethoxytritylation and 3'-phosphitylation, the resulting 2'-protected ribonucleoside phosphoramidite monomers are employed in the solid-phase synthesis of three chimeric RNA sequences, each differing in their ratios of purine/pyrimidine. When the activation of phosphoramidite monomers is performed in the presence of 5-benzylthio-1H-tetrazole, coupling efficiencies averaging 99% are obtained within 180 s. Upon completion of the RNA-chain assemblies, removal of the nucleobase and phosphate protecting groups and release of the sequences from the solid support are carried out under standard basic conditions, whereas the cleavage of 2'-O-(2-cyano-2,2-dimethylethanimine-N-oxymethyl) protective groups is effected (without releasing RNA alkylating side-products) by treatment with tetra-n-butylammonium fluoride (0.5 M) in dry DMSO over a period of 24-48 h at 55 °C. Characterization of the fully deprotected RNA sequences by polyacrylamide gel electrophoresis (PAGE), enzymatic hydrolysis, and matrix-assisted laser desorption/ionization (MALDI) mass spectrometry confirmed the identity and quality of these sequences. Thus, the use of 2'-O-aminooxymethylribonucleosides in the design of new 2'-hydroxyl protecting groups is a powerful approach to the development of a straightforward, efficient, and cost-effective method for the chemical synthesis of high-quality RNA sequences in the framework of RNA interference applications.
Asunto(s)
Nitrilos/química , ARN/síntesis química , Ribonucleósidos/química , Secuencia de Bases , Radical Hidroxilo , Estructura Molecular , Compuestos Organofosforados , ARN/química , Interferencia de ARN , Técnicas de Síntesis en Fase Sólida , TetrazolesRESUMEN
The reaction of 2'-O-aminooxymethylribonucleosides with 2-cyano-2-methyl propanal leads to the formation of stable and yet reversible 2'-O-(2-cyano-2,2-dimethylethanimine-N-oxymethyl)ribonucleosides in post-purification yields of 54% to 82%. Phenoxyacetylation of the exocyclic amino functions of these ribonucleosides proceeds in yields of 74% to 89%, and subsequent 5'-O-dimethoxytritylation and 3'-O-phosphitylation of the corresponding N-phenoxyacetylated ribonucleosides provide the fully protected ribonucleoside phosphoramidite monomers in isolated yields of 69% to 88%. These ribonucleoside phosphoramidites are employed in solid-phase synthesis of three chimeric RNA sequences, each differing in purine/pyrimidine content. The stepwise coupling efficiency of the ribonucleoside phosphoramidites (as 0.15 M solutions in acetonitrile) averages 99% over a coupling time of 180 s when 5-benzylthio-1H-tetrazole is used as an activator. Upon completion of RNA chain assembly, removal of the nucleobase- and phosphate-protecting groups and release of sequences from the solid support are carried out under standard basic conditions. Finally, the 2'-O-(2-cyano-2,2-dimethylethanimine-N-oxymethyl) protective groups are cleaved from the RNA sequences by treatment with 0.5 M tetra-n-butylammonium fluoride in dry DMSO for 24 to 48 hr at 55°C without releasing RNA-alkylating side-products. Characterization of the fully deprotected RNA sequences by PAGE, enzymatic hydrolysis, and MALDI-TOF mass spectrometry confirms the identity and high quality of these sequences.
Asunto(s)
ARN/síntesis química , Ribonucleósidos/química , Técnicas de Síntesis en Fase Sólida , Cianatos/química , Electroforesis en Gel de Poliacrilamida , Éteres/química , Iminas/química , Compuestos Organofosforados/química , Compuestos de Amonio Cuaternario/química , Espectrometría de Masa por Láser de Matriz Asistida de Ionización DesorciónRESUMEN
The conversion of 3',5'-disilylated 2'-O-(methylthiomethyl)ribonucleosides to 2'-O-(phthalimidooxymethyl)ribonucleosides is achieved in yields of 66% to 94%. Desilylation and dephtalimidation of these ribonucleosides by treatment with NH(4)F in MeOH produce 2'-O-aminooxymethylated ribonucleosides, which are efficient in producing stable and yet reversible 2'-conjugates upon reaction with 1-pyrenecarboxaldehyde. Exposure of 2'-pyrenylated ribonucleosides to 0.5 M tetra-n-butylammonium fluoride (TBAF) in THF or DMSO results in the cleavage of their iminoether functions to give the native ribonucleosides along with an innocuous nitrile side product. Conversely, the reaction of 2'-O-(aminooxymethyl)uridine with 5-cholesten-3-one leads to a permanent uridine 2'-conjugate, which is left unreacted when treated with TBAF. The versatility and uniqueness of 2'-O-(aminooxymethyl)ribonucleosides is demonstrated by the single or double incorporation of a reversible pyrenylated uridine 2'-conjugate into an RNA sequence. Furthermore, the conjugation of 2'-O-(aminooxymethyl)ribonucleosides with various aldehydes, including those generated from their acetals, is also presented. The preparation of 5'-O-(aminooxymethyl)thymidine is also achieved, albeit in modest yields, from the conversion of 5'-O-methylthiomethyl-3'-O-(levulinyl)thymidine to 5'-O-phthalimidooxymethyl-3'-O-(levuliny)lthymidine followed by hydrazinolysis of both 5'-phthalimido and 3'-levulinyl groups. Pyrenylation of the 5'-O-(aminooxymethyl)deoxyribonucleoside also provides a reversible 5'-conjugate that is sensitive to TBAF, thereby further demonstrating the usefulness of 5'-O-(aminooxymethyl)deoxyribonucleosides for permanent or reversible modification of DNA sequences. Curr. Protoc. Nucleic Acid Chem. 50:4.52.1-4.52.36. © 2012 by John Wiley & Sons, Inc.
Asunto(s)
ADN/química , Desoxirribonucleósidos/química , ARN/química , Ribonucleósidos/química , ADN/metabolismo , Desoxirribonucleósidos/síntesis química , Dimetilsulfóxido/química , Compuestos de Amonio Cuaternario/química , ARN/metabolismo , Ribonucleósidos/síntesis químicaRESUMEN
2'-O-Aminooxymethyl ribonucleosides are prepared from their 3',5'-disilylated 2'-O-phthalimidooxymethyl derivatives by treatment with NH(4)F in MeOH. The reaction of these novel ribonucleosides with 1-pyrenecarboxaldehyde results in the efficient formation of stable and yet reversible ribonucleoside 2'-conjugates in yields of 69-82%. Indeed, exposure of these conjugates to 0.5 M tetra-n-butylammonium fluoride (TBAF) in THF results in the cleavage of their iminoether functions to give the native ribonucleosides along with the innocuous nitrile side product. Conversely, the reaction of 5-cholesten-3-one or dansyl chloride with 2'-O-aminooxymethyl uridine provides permanent uridine 2'-conjugates, which are left essentially intact upon treatment with TBAF. Alternatively, 5'-O-aminooxymethyl thymidine is prepared by hydrazinolysis of its 3'-O-levulinyl-5'-O-phthalimidooxymethyl precursor. Pyrenylation of 5'-O-aminooxymethyl thymidine and the sensitivity of the 5'-conjugate to TBAF further exemplify the usefulness of this nucleoside for modifying DNA sequences either permanently or reversibly. Although the versatility and uniqueness of 2'-O-aminooxymethyl ribonucleosides in the preparation of modified RNA sequences is demonstrated by the single or double incorporation of a reversible pyrenylated uridine 2'-conjugate into an RNA sequence, the conjugation of 2'-O-aminooxymethyl ribonucleosides with aldehydes, including those generated from their acetals, provides reversible 2'-O-protected ribonucleosides for potential applications in the solid-phase synthesis of native RNA sequences. The synthesis of a chimeric polyuridylic acid is presented as an exemplary model.
Asunto(s)
ADN/química , ARN/química , Ribonucleósidos/química , Secuencia de Bases , Oximas/química , Poli U/síntesis química , Poli U/química , ARN/síntesis química , Ribonucleósidos/síntesis químicaRESUMEN
This unit describes the preparation of alkylthioalkylated and formamidoalkylated alcohols, an amidoalkylated alcohol, a hydroxylalkylated phosphoramidate, and their phosphoramidothioate derivatives, all of which have been identified as heat-sensitive thiophosphate-protecting groups in the development of thermolytic immunostimulatory DNA prodrugs. The alcohols are converted to their deoxyribonucleoside phosphoramidite derivatives, which are then used in the preparation of thermosensitive dinucleoside phosphorothioates. The thiophosphate-protecting groups of these dinucleoside phosphorothioates presumably undergo thermolytic cyclodeesterification at elevated temperature under essentially neutral conditions to release the desired phosphorothioate diester function. On the basis of their thermolytic deprotection kinetics, one can identify those thiophosphate-protecting groups that (i) may be useful for thiophosphate protection of CpG motifs of immunostimulatory DNA oligonucleotides (CpG ODNs); (ii) are suitable for protection of phosphodiester functions flanking the CpG motifs; and (iii) offer adequate protection of terminal phosphodiester functions against ubiquitous extracellular and intracellular exonucleases that may be found in biological environments.
Asunto(s)
Adyuvantes Inmunológicos/síntesis química , ADN/química , Oligonucleótidos/química , Compuestos Organofosforados/síntesis química , Profármacos/química , Adyuvantes Inmunológicos/química , Interacciones Hidrofóbicas e Hidrofílicas , Oligonucleótidos/síntesis química , Compuestos Organofosforados/química , Profármacos/síntesis química , Solubilidad , TermodinámicaRESUMEN
The ribonucleoside building block, N²-isobutyryl-2'-O-propargyl-3'-O-levulinyl guanosine, was prepared from commercial N²-isobutyryl-5'-O-(4,4'-dimethoxytrityl)-2'-O-propargyl guanosine in a yield of 91%. The propargylated guanylyl(3'-5')guanosine phosphotriester was synthesized from the reaction of N²-isobutyryl-2'-O-propargyl-3'-O-levulinyl guanosine with N²-isobutyryl-5'-O-(4,4'-dimethoxytrityl)-2'-O-tert-butyldimethylsilyl-3'-O-[(2-cyanoethyl)-N,N-diisopropylaminophosphinyl] guanosine and isolated in a yield of 88% after P(III) oxidation, 3'-/5'-deprotection, and purification. The propargylated guanylyl(3'-5')guanosine phosphotriester was phosphitylated using 2-cyanoethyl tetraisopropylphosphordiamidite and 1H-tetrazole and was followed by an in situ intramolecular cyclization to give a propargylated c-di-GMP triester, which was isolated in a yield of 40% after P(III) oxidation and purification. Complete N-deacylation of the guanine bases and removal of the 2-cyanoethyl phosphate protecting groups from the propargylated c-di-GMP triester were performed by treatment with aqueous ammonia at ambient temperature. The final 2'-desilylation reaction was effected by exposure to triethylammonium trihydrofluoride affording the desired propargylated c-di-GMP diester, the purity of which exceeded 95%. Biotinylation of the propargylated c-di-GMP diester was easily accomplished through its cycloaddition reaction with a biotinylated azide derivative under click conditions to produce the biotinylated c-di-GMP conjugate of interest in an isolated yield of 62%.
Asunto(s)
Azidas/química , Biotina/química , Química Clic , Guanosina Monofosfato/análogos & derivados , Biotinilación , Guanosina Monofosfato/síntesis química , Guanosina Monofosfato/química , Conformación Molecular , EstereoisomerismoRESUMEN
The sequential functionalization of long-chain alkylamine controlled-pore glass (CPG) with a 3-hydroxypropyl-(2-cyanoethyl)thiophosphoryl linker and a dinucleoside phosphorotetrazolide leads to a uniquely engineered support for solid-phase synthesis. Unlike conventional succinylated-CPG supports, this support is designed to allow oligonucleotide deprotection and elimination of deprotection side-products to proceed without release of the oligonucleotide. When needed, the DNA oligonucleotide can be thermolytically released in 2 hr under essentially neutral conditions. The modified CPG support has been successfully employed in the synthesis of both native and fully phosphorothioated DNA 20-mers. On the basis of reversed-phase HPLC and electrophoretic analyses, the purity of the released oligonucleotides is comparable to that of identical oligonucleotides synthesized from succinylated-CPG supports, in terms of both shorter-than-full-length oligonucleotide contaminants and overall yields. The detailed preparation of DNA oligonucleotides conjugated with exemplary reporter or functional groups, either at the 3'-terminus or at both 3'- and 5'-termini, is also described.
Asunto(s)
Oligodesoxirribonucleótidos/síntesis química , Reactivos de Enlaces Cruzados , Vidrio , Calor , Ligandos , Métodos , Oligodesoxirribonucleótidos/química , Propiedades de SuperficieRESUMEN
The functionalization of long chain alkylamine controlled-pore glass (CPG) with a 3-hydroxypropyl-(2-cyanoethyl)thiophosphoryl linker and its conversion to the support 7 has led to the synthesis of DNA oligonucleotides and their 3'- or (3',5')-conjugates. Indeed, CPG support 7 has been successfully employed in the synthesis of both native and fully phosphorothioated DNA 20-mers. Unlike conventional succinylated CPG supports, this distinctively functionalized support allows oligonucleotide deprotection and removal of the deprotection side products to proceed without releasing the oligonucleotide into the aqueous milieu. When freed from deprotection side products, the DNA oligonucleotide is thermolytically released from the support within 2 h under nearly neutral conditions (pH 7.2, 90 degrees C). The quality of these oligonucleotides is comparable to that of identical oligonucleotides synthesized from succinylated CPG supports in terms of shorter than full length oligonucleotide contaminants and overall yields. The versatility of the thermolytic CPG support 7 is further demonstrated by the synthesis of a DNA oligonucleotide (20-mer) and its conjugation with an azido and alkynyl groups at both 5'-and 3'-termini, respectively. The functionality of the (3',5')-heteroconjugated oligonucleotide 18 is verified by its circularization to the DNA oligonucleotide 19 under "click" chemistry conditions.
Asunto(s)
ADN/química , Vidrio/química , Calor , Oligonucleótidos/química , Amidas/química , Secuencia de Bases , ADN/genética , Fosfatos de Dinucleósidos/química , Concentración de Iones de Hidrógeno , Oligonucleótidos/genética , Fosfatos/química , Fosforamidas , Ácidos Fosfóricos/química , PorosidadRESUMEN
Emerging RNA-based technologies for controlling gene expression have triggered a high demand for synthetic oligoribonucleotides and have motivated the development of ribonucleoside phosphoramidites that would exhibit coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites. To fulfill these needs, the novel 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleoside phosphoramidites 9a-d has been implemented (Schemes 1 and 2). The solid-phase synthesis of AUCCGUAGCUAACGUCAUGG was then carried out employing 9a-d as 0.2 M solutions in dry MeCN and 5-benzylthio-1H-tetrazole as an activator. The coupling efficiency of 9a-d averaged 99% within a coupling time of 180 s. Following removal of all base-sensitive protecting groups, cleavage of the remaining 2'-[4-(N-methylamino)benzyl] acetals from the RNA oligonucleotide was effected in buffered 0.1 M AcOH (pH 3.8) within 30 min at 90 degrees C. RP-HPLC and PAGE analyses of the fully deprotected AUCCGUAGCUAACGUCAUGG were comparable to those of a commercial RNA oligonucleotide sharing an identical sequence. Enzymatic digestion of the RNA oligomer catalyzed by bovine spleen phosphodiesterase and bacterial alkaline phosphatase revealed no significant amounts of RNA fragments containing (2'-->5')-internucleotidic phosphodiester linkages or noteworthy nucleobase modifications.
Asunto(s)
Acetanilidas/química , Oligorribonucleótidos/síntesis química , Ribonucleósidos/química , Cromatografía Líquida de Alta Presión , Estructura Molecular , Oligorribonucleótidos/química , Compuestos Organofosforados/química , Ribonucleósidos/síntesis química , Factores de TiempoRESUMEN
The search for a 2'-OH protecting group that would impart ribonucleoside phosphoramidites with coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites led to an assessment of 2'-O-(4-nitrogenated benzyloxy)methyl groups through solid-phase RNA synthesis using phosphoramidites 2a-d, 12a, and 14a. These phosphoramidites exhibited rapid and efficient coupling properties. Particularly noteworthy is the cleavage of the 2'-O-[4-(N-methylamino)benzyloxy]methyl groups in 0.1 M AcOH, which led to U19dT within 15 min at 90 degrees C. [reaction: see text]
Asunto(s)
Compuestos de Bencilo/química , ARN/síntesis química , Cromatografía Líquida de Alta Presión , Indicadores y Reactivos , Cinética , Metilación , Nitrocompuestos/química , Timidina/química , Uridina/químicaRESUMEN
The phosphorylating reagent bis[S-(4,4'-dimethoxytrityl)-2-mercaptoethyl]-N,N-diisopropylphosphoramidite is prepared in three steps from commercial methyl thioglycolate and diisopropylphosphoramidous dichloride. The phosphorylating reagent has been used successfully in the solid-phase synthesis of deoxyribonucleoside 5'-/3'-phosphate or -thiophosphate monoesters and oligonucleotide 5'-phosphate/-thiophosphate monoesters. Bis[S-(4,4'-dimethoxytrityl)-2-mercaptoethyl]-N,N-diisopropylphosphoramidite has also been employed in the construction of a thermolytic dinucleotide prodrug model to evaluate the ability of the reagent to produce thermosentive oligonucleotide prodrugs under mild temperature conditions ( approximately 25 degrees C) for potential therapeutic applications.
Asunto(s)
ADN/química , Desoxirribonucleósidos/química , Cromatografía Líquida de Alta Presión , FosforilaciónRESUMEN
[reaction: see text] The phosphoramidite 11 was prepared in three steps from methyl 2-mercaptoacetate and demonstrated efficiency in the synthesis of conventional 5'-/3'-phosphate/thiophosphate monoester derivatives of 2'-deoxyribonucleosides and DNA oligonucleotides. Moreover, the use of 11 has enabled the preparation of the dinucleoside phosphorothioate analogue 26 in high yields (>95%) with minimal cleavage (<2%) of the thermolytic thiophosphate protecting group.
Asunto(s)
ADN/química , Desoxirribonucleósidos/química , Oligonucleótidos/química , Indicadores y Reactivos/química , Estructura Molecular , Compuestos Organofosforados/química , Fosfatos/química , Fosforilación , TemperaturaRESUMEN
When employing phosphoramidites 1a-d in the solid-phase synthesis of oligonucleoside phosphorothioates, the thermolytic 2-[N-methyl-N-(2-pyridyl)]aminoethyl thiophosphate protecting group is lost to a large extent during the course of the synthesis. The resulting phosphorothioate diesters are then substantially desulfurized upon recurring exposure to a commercial solution of deblocking reagent during chain assembly. This problem is caused by the secondary decomposition product(s) of the reagent and is alleviated by using a fresh solution of the deblocking reagent prepared from solid trichloroacetic acid.
Asunto(s)
Oligodesoxirribonucleótidos/síntesis química , Organofosfatos/química , Secuencia de Bases , Espectroscopía de Resonancia Magnética , Estructura Molecular , Oligodesoxirribonucleótidos/química , Fosfatos/química , Isótopos de Fósforo , Azufre/química , Tionucleótidos/química , Ácido Tricloroacético/químicaRESUMEN
Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.
Asunto(s)
ADN/síntesis química , Desoxirribonucleósidos/química , Oligonucleótidos/síntesis química , Compuestos Organofosforados/química , Pirrolidinonas/química , Compuestos de Sulfonio/química , Cromatografía Líquida de Alta Presión , Análisis de Secuencia por Matrices de OligonucleótidosRESUMEN
The thermolabile 4-methylthio-1-butyl phosphate/thiophosphate protecting group for DNA oligonucleotides has been investigated for its potential application to a "heat-driven" process for either oligonucleotide synthesis on diagnostic microarrays or, oppositely, to the large-scale preparation of therapeutic oligonucleotides. The preparation of phosphoramidites 10a-d is straightforward, and the incorporation of these amidites into oligonucleotides via solid-phase techniques proceeds as efficiently as that achieved with 2-cyanoethyl deoxyribonucleoside phosphoramidites. The versatility of the 4-methylthio-1-butyl phosphate/thiophosphate protecting group is exemplified by its facile removal from oligonucleotides upon heating for 30 min at 55 degrees C in an aqueous buffer under neutral conditions or within 2 h at 55 degrees C in concentrated NH(4)OH. The deprotection reaction occurs through an intramolecular cyclodeesterification mechanism leading to the formation of sulfonium salt 18. When mixed with deoxyribonucleosides and N-protected 2'-deoxyribonucleosides or with a model phosphorothioate diester under conditions approximating those of large-scale (>50 mmol) oligonucleotide deprotection reactions, the salt 18 did not significantly alter DNA nucleobases or desulfurize the phosphorothioate diester model to an appreciable extent.