RESUMEN
The main objective of this study is to analyse the association between Quality of Life (QOL), Emotional Symptomology and perceived Emotional Intelligence (EI) in burn patients. Additionally, it is intended determine the predictor models of QOL, and confirm the mediating effect of emotional symptomology between QOL and perceived EI. This is a transversal study developed in the Hospital da Prelada, Porto, Portugal, with a sample of 92 patients that were hospitalized in the Burn Unit and the Reconstructive Plastic Surgery Service. The assessment protocol consisted of a sociodemographic and clinical data sheet. To assess the perception of QOL of the burn patient it was used the Burn Specific Health Scale - Revised (BSHS-R), the emotional symptomology was measured by the Brief Symptom Inventory (BSI) and Trait Met-Mood Scale-24 (TMMS) was used to assess Emotional Intelligence (EI). The cross-sectional and correctional data were analysed through descriptive statistics, correlations, regressions and simple mediations. The results obtained suggest significant associations between QOL, perceived EI and Emotional Symptomology in burn patients. The results of the predictor models of the QOL domains encompass the Positive Symptom Distress Index (PSDI of Emotional Symptomology), where the total variance is explained mainly by the models of QOL Affect and Body Image 46% and Treatment 31%. The mediating effect of the PSDI in the relationship between QOL in the Affect and Body Image dimension and the Mood Repairs (MR) was also tested, having proved to have a total mediation (the Mood Repairs loses its contribution in the QOL model when the PSDI variable is introduced). This study underscores the importance of perceived Emotional Intelligence and its association with the burn impact in the different dimensions of QOL of the patients. The intention of this study is to alert health professionals for patient support in the search for strategies that aim for positive adaptation which promotes QOL and emotional adjustment of burn patients to their new condition.
Asunto(s)
Quemaduras , Inteligencia Emocional , Calidad de Vida , Humanos , Quemaduras/psicología , Calidad de Vida/psicología , Masculino , Femenino , Adulto , Persona de Mediana Edad , Estudios Transversales , Imagen Corporal/psicología , Portugal , Emociones , Adulto Joven , Anciano , Encuestas y Cuestionarios , AdolescenteRESUMEN
Chronic rhinosinusitis with nasal polyps (CRSwNP) is a highly prevalent and burdensome disease for both individuals and health systems. Its management involves many specialties, including otorhinolaryngology, allergology, pulmonology, primary care, pharmacy, and pediatrics. A multidisciplinary approach and the participation of the patient in decision-making are essential, both for diagnosis and for therapy. The authors of the consensus aim to translate current knowledge into an easy-to-read practical guide and emphasize those aspects requiring further discussion or with unmet needs owing to the lack of appropriate scientific evidence. An iterative approach for the development of an evidence-based systematic review with recommendations was followed using a standard quality assessment approach (Scottish Intercollegiate Guidelines Network [SIGN] and National Institute for Health and Care Excellence [NICE]). The guideline was critically evaluated using the Appraisal of Guidelines for Research and Evaluation (AGREE II) and Recommendation Excellence (AGREE REX) instruments. Consequently, POLINA has been considered a high-quality guideline by an independent agency. The POLINA consensus provides new definitions of control, therapeutic management (including surgery and evaluation of severity), indications for use of biologics, and response. Finally, this guideline focuses on unmet research needs in CRSwNP.
RESUMEN
The objective was to quantify parallel changes in performance and physiological measures in relation to periodization of sequential altitude training over a season in elite swimmers. The altitude training of four female and two male international swimmers in selected seasons was examined using a collective case study approach. All swimmers were a medalist in World (WC) and/or European Championships (EC) 2013, 2014, 2016 and 2018 in short or long course competition. A traditional periodization model was employed using three macrocycles with 3-4 altitude camps (duration 21-24 days each) scheduled over the season, following a polarized training intensity distribution (TID) with a volume ranged between 729 km and 862 km. The timing of return from altitude prior to competition was between 20-32 days, with 28 days the most common period. Competition performance was assessed with major (international) and minor (regional or national) competitions. Hemoglobin concentration, hematocrit, anthropometric characteristics, were measured before and after each camp. Competition performance following the altitude training camps improved by 0.6% ± 0.8% (personal best time; mean ± SD) (95% confidence limits (CL) 0.1%-1.1%), 1.6% ± 0.7% (95% CL 1.2% to 2.0%) (season best time) and 1.6% ± 0.5% (95% CL 1.3%-1.9%) (previous season time). Hemoglobin concentration increased 4.9% from pre-to post-altitude training camps, while hematocrit increased by 4.5%. The sum of six skinfolds reduced by 14.4% (95% CL 18.8%-9.9%) and 4.2% (95% CL 2.4%-9.2%) for the two males (EC), and by 15.8% (95% CL 19.5%-12.0%) for two females (WC). Three to four altitude training camps in a competitive season, around 21-24 days of duration, scheduling the last return between 20-32 days before the main competition, integrated in a traditional periodized sequence, can induce worthwhile improvements in international swimming performance, hematological parameters, and anthropometric characteristics.
RESUMEN
Chronic rhinosinusitis with nasal polyps (CRSwNP) is a highly prevalent and burdensome disease for both individuals and health systems. Its management involves many specialties, including otorhinolaryngology, allergology, pulmonology, primary care, pharmacy, and pediatrics. A multidisciplinary approach and the participation of the patient in decision-making are essential, both for diagnosis and for therapy. The authors of the consensus aim to translate current knowledge into an easy-to-read practical guide and emphasize those aspects requiring further discussion or with unmet needs owing to the lack of appropriate scientific evidence. An iterative approach for the development of an evidence-based systematic review with recommendations was followed using a standard quality assessment approach (Scottish Intercollegiate Guidelines Network [SIGN] and National Institute for Health and Care Excellence [NICE]). The guideline was critically evaluated using the Appraisal of Guidelines for Research and Evaluation (AGREE II) and Recommendation Excellence (AGREE REX) instruments. Consequently, POLINA has been considered a high-quality guideline by an independent agency. The POLINA consensus provides new definitions of control, therapeutic management (including surgery and evaluation of severity), indications for use of biologics, and response. Finally, this guideline focuses on unmet research needs in CRSwNP (AU)
La rinosinusitis crónica con pólipos nasales (RSCcPN) es una enfermedad de alta prevalencia y onerosa para las personas y los sistemas de salud cuyo manejo involucra a muchas especialidades: otorrinolaringología, alergología, neumología, atención primaria, farmacia y pediatría. El abordaje multidisciplinar y la participación del paciente en la toma de decisiones son fundamentales, tanto para el diagnóstico como para la estrategia terapéutica. Los autores del consenso pretenden traducir los conocimientos actuales en una guía práctica de fácil lectura y enfatizar aquellos aspectos en los que todavía hay discusión o necesidades no cubiertas por falta de evidencia científica adecuada. Se utilizó un enfoque iterativo para el desarrollo de una revisión sistemática basada en evidencia con recomendaciones, utilizando un esquema de evaluación de calidad estándar (Scottish Intercollegiate Guidelines Network -SIGN- y National Institute for Health and Care Excellence -NICE-), y una evaluación crítica de la directriz se ha llevado a cabo a través del instrumento Evaluación de Directrices para la Investigación y Evaluación (AGREE II) y Recomendación de Excelencia (AGREE REX). Con base en lo anterior, la guía POLINA ha sido considerada una guía de buena calidad por una agencia independiente El consenso POLINA aporta nuevos esquemas para la definición de control, manejo terapéutico incluyendo evaluación de gravedad, indicaciones de la cirugía y del uso de biológicos, y la respuesta al tratamiento. Finalmente, esta guía se enfoca en las necesidades de investigación insatisfechas en la RSCcPN (AU)
Asunto(s)
Humanos , Rinitis/diagnóstico , Rinitis/terapia , Sinusitis/diagnóstico , Sinusitis/terapia , Pólipos Nasales/diagnóstico , Pólipos Nasales/terapia , Enfermedad Crónica , Consenso , EspañaRESUMEN
BACKGROUND: The mandibular opening path movements have different directions according to the craniofacial morphology of the patient but always downward and backward, therefore increasing the collapse of the upper airway. The aim of this work is to determine if there is a relationship between the craniofacial morphology and the mandibular movement to help understand the impact on the mandibular position. METHODS: 52 students with full permanent dentition aged 19 to 23 years (mean 21.3 SD 1.7; 29 females and 23 males), participated in the study. Each subject had a lateral cephalometric radiograph taken. The opening angle was determined for two levels of vertical openings at 5 and 10 mm. RESULTS: The opening angle showed a greater variability between subjects ranging from 63.15 to 77.08 for 5 mm angle and from for 61.65 to 75.72 for the 10 mm angle. Differences of facial phenotypes was evident when comparing the individual dissoccluding angle of the low angle horizontal pattern and high angle vertical pattern. CONCLUSIONS: The opening angle is related to craniofacial morphology with higher vertical anterior and shorter anteroposterior faces having a more horizontal path of mandibular movement than shorter vertical anterior and longer anteroposterior subjects who have a more vertical path.
Asunto(s)
Ferulas Oclusales , Apnea Obstructiva del Sueño , Adulto , Cefalometría , Femenino , Humanos , Masculino , Mandíbula/diagnóstico por imagen , Fenotipo , Adulto JovenRESUMEN
This work aimed at assessing the neutron radiation field with activation foils around of the PETtrace biomedical cyclotron. Activation foils of gold, gold covered with cadmium, indium and nickel was used to evaluate the thermal, epithermal and fast neutron contributions, respectively. The irradiations of the activation foils were performed using the intermittent irradiation method to conciliate the measurements with the routine 18F production. The evaluated points showed the contributions of the thermal, epithermal and fast neutrons due to interaction with the vault room, cyclotron accelerator and main cyclotron components.
Asunto(s)
Neutrones , Tomografía de Emisión de Positrones , SincrotronesRESUMEN
The objective of this study was the adaptation of the Burn Specific Health Scale-Revised (BSHS-R) into the Portuguese context. The authors of the original version of BSHS-R with 31 items are Blalock, Bunker and DeVellis and it was developed to evaluate the health status of burns victims. The Brazilian version of the BSHS-R was translated from Portuguese (Brazil) to Portuguese (Portugal), through a semantic adaptation process, by independent Portuguese-Brazilian specialists, followed by a verbal comprehension assessment of all items, with a heterogeneous group of people, in terms of age, education and occupation. After the survey adaptation to Portuguese (Portugal), a psychometric study of the BSHS-R has been realized with a sample of 92 patients, which had been hospitalized in the Burn, Plastic and Reconstructive Surgery units of the Prelada Hospital, Porto, Portugal. For the process of instrument validation, a factorial exploratory analysis has been conducted and the internal consistency indicators were analysed using Cronbach's alpha (reliability). The results analysis allowed to assess and identify the validity of the construct through the factorial exploratory analysis, which confirmed the same previous factorial structure identified in the original language and in the Brazilian version. The BSHS-R also presented good internal consistency indicators (global α = .921; affect and body image α = .874; heat sensitivity α = .830; simple functional abilities α = .893; treatment regimens α = .772; work α = .876; interpersonal relationships α = .804). The Portuguese (Portugal) adapted version has revealed useful, valid and reliable for the quality of life assessment related to the health of people that suffered burn injuries.
Asunto(s)
Afecto , Imagen Corporal , Quemaduras/fisiopatología , Hiperestesia , Calidad de Vida , Actividades Cotidianas , Adolescente , Adulto , Anciano , Anciano de 80 o más Años , Quemaduras/psicología , Quemaduras/terapia , Análisis Factorial , Femenino , Calor , Humanos , Relaciones Interpersonales , Masculino , Persona de Mediana Edad , Reproducibilidad de los Resultados , Encuestas y Cuestionarios , Traducciones , Trabajo , Adulto JovenRESUMEN
Moringa plants have an extensive range of bioactive compounds that can be obtained from different vegetative structures, such as leaves, seeds, stems and pod husks. These bioactive molecules include carbohydrates, phenolic compounds, oils and fatty acids, proteins and functional peptides and have great potential to be used in several formulations of food products. This report collects recent information concerning bioactive molecules in other species of the Moringaceae family, different from Moringa oleifera. Thus, this document aims to describe these bioactive compounds and their functional properties on foodstuffs. In addition, more suitable methodologies applied for their extraction and characterization are reviewed. Finally, an overview of patents required to protect Moringa-derived products and processes is provided.
Asunto(s)
Moringa oleifera/química , Fitoquímicos/análisis , Antioxidantes/análisis , Carbohidratos/análisis , Ácidos Grasos/análisis , Fenoles/análisis , Extractos Vegetales/análisis , Hojas de la Planta/química , Aceites de Plantas/análisis , Proteínas de Plantas/análisis , Semillas/químicaRESUMEN
BACKGROUND: Information on appropriate protocols for sedation of Nordestino donkeys is scarce. OBJECTIVES: To evaluate the sedative and cardiorespiratory effects of low doses of intravenous (i.v.) xylazine with and without acepromazine in 'Nordestino' donkeys. STUDY DESIGN: Seven healthy female Nordestino donkeys (150 ± 18 kg) were included in this blinded, randomised, crossover experiment. METHODS: Four treatments were administered, consisting of two i.v. injections, at baseline (T0, 1st injection) and 15 min later (T15, 2nd injection). Treatments included acepromazine 0.05 mg/kg bwt + saline (AS), saline + xylazine 0.5 mg/kg bwt (SX0.5), acepromazine + xylazine 0.25 mg/kg bwt (AX0.25) or acepromazine + xylazine 0.5 mg/kg bwt (AX0.5). Sedative and cardiorespiratory parameters were evaluated before T0 and 15, 20, 30, 45, 60, 75 and 90 min after treatment. Degree [height of head above ground (HHAG)] and quality of sedation [ataxia, responses to stimuli and visual analogue scale (VAS) scoring] and respiratory rate were evaluated by the main investigator in situ, and heart rate was measured by an assistant investigator. Three experienced evaluators assessed vídeos for ataxia and responses to stimuli. Normal data were analysed by repeated measures ANOVA, and non-normal by Kruskal-Wallis (P<0.05). RESULTS: HHAG was lower than baseline for 15 min after xylazine administration in AX0.25 and for 30 min in SX0.5 and AX0.5 groups. All treatments with xylazine increased VAS and ataxia scores in situ for 15 min after xylazine administration, with no differences between groups. Ataxia scores in situ were higher in SX0.5 and AX0.5 groups than AS for 15 and 30 min after xylazine administration, respectively. MAIN LIMITATIONS: Absence of a negative control group (saline-saline). CONCLUSION: Acepromazine added to xylazine at 0.25 mg/kg bwt produced briefer and milder sedation than xylazine at 0.5 mg/kg bwt.
Asunto(s)
Acepromazina/farmacología , Agonistas de Receptores Adrenérgicos alfa 2/farmacología , Equidae/fisiología , Hipnóticos y Sedantes/farmacología , Xilazina/farmacología , Acepromazina/administración & dosificación , Agonistas de Receptores Adrenérgicos alfa 2/administración & dosificación , Animales , Estudios Cruzados , Femenino , Frecuencia Cardíaca/efectos de los fármacos , Hipnóticos y Sedantes/administración & dosificación , Inyecciones Intravenosas/veterinaria , Distribución Aleatoria , Respiración/efectos de los fármacos , Método Simple Ciego , Escala Visual Analógica , Xilazina/administración & dosificaciónRESUMEN
Bovine besnoitiosis is a parasitic disease caused by the protozoan Besnoitia besnoiti. Described many decades ago, recent epidemiological studies reveal its important spread within Europe in the last years. To date, many epidemiological aspects related to life cycle, routes of transmission, incidence rates and associated risk factors are lacking; hence, the establishment of appropriate disease control programmes poses an important challenge. Thus, the aim of the present study was to determine the epidemiological pattern of the disease in an endemic herd reared under extensive conditions (Spanish Pyrenees) by identifying main factors associated with infection and clinical disease dynamics. The study population consisted of 276 Brown Swiss and Pirenaica adult animals and 145 calves born and weaned at the farm during the study. Three sampling time frames were used: January 2010, September 2010 and February 2011, which allowed us to differentiate two periods designated as mountain and valley periods. The data related to animals (breed, sex and age) and herd management (animal grouping and time in housing) were recorded. The data collection methodology was mainly based on clinical examinations and defining the serological status against bovine besnoitiosis by the immunofluorescent antibody testing of blood samples. The total prevalence among adult animals was 38.34% (CI95%: 34.53-42.07), with 18.54% of seropositive animals showing clinical signs. In regard to the cumulative incidence, 34.57% of new infections were detected during the mountain period, in contrast to the 24.59% observed in the valley period. The incidence density was 0.058 and 0.061 new infections per animal-month for the mountain and valley periods, respectively. According to the seroepidemiological study, the seroconversion probability of B. besnoiti infection was directly associated with the number of seropositive cows with whom an animal had been stabled as well as the housing period duration, supporting horizontal transmission by close contact as one of the most important methods of disease spread. In addition, the risk of developing the clinical course increased with age, and the presence of clinical signs was related to higher antibody responses. Among calves (from 3.1 to 7.1 months old) sampled once at weaning, the total seroprevalence was 15.17% (CI95%: 9.36-21.04), and the chronic stage was observed in three animals, supporting the ability of B. besnoiti to infect and even cause disease in animals less than 6 months old. Finally, the risk of calf seroconversion was positively related to the serological status of the cows, suggesting postnatal transmission between dams and offspring by contact during the suckling period.
Asunto(s)
Enfermedades de los Bovinos/epidemiología , Coccidiosis/veterinaria , Sarcocystidae/aislamiento & purificación , Animales , Bovinos , Enfermedades de los Bovinos/parasitología , Coccidiosis/epidemiología , Coccidiosis/parasitología , Femenino , Incidencia , Masculino , Prevalencia , Factores de Riesgo , Estaciones del Año , Estudios Seroepidemiológicos , España/epidemiologíaRESUMEN
Dear Editor, A recent paper (Casseb et al., 2016) published in the journal Genetics and Molecular Research described the interesting concept that dengue virus (DENV)-4 infection, in the human cell line A-549, leads to the downregulation of expression of key components of microRNA (miRNA) biogenesis, such as Drosha, Dicer, and DGCR8. For this, the authors performed a time course infection of A-549 cells for 5 days. The highest viral load was observed at 3 days post-infection, which corresponded with the maximum downregulation of expression of Drosha, Dicer, and DGCR8, assayed by quantitative PCR (RT-qPCR). These results supported the recent notion of a complex interaction between DENV and the host miRNA machinery and of the host miRNA response to this particular infection. Extensive evidence has shown that DENV can take advantage of host miRNAs for its own replication (Zhu et al., 2014) and that host miRNAs can inhibit DENV replication (Wu et al., 2013).
Asunto(s)
Virus del Dengue/fisiología , Coactivadores de Receptor Nuclear/genética , Ribonucleasa III/genética , Regiones no Traducidas 3' , Animales , Chlorocebus aethiops , Regulación hacia Abajo , Expresión Génica , Regulación Viral de la Expresión Génica , Humanos , Coactivadores de Receptor Nuclear/metabolismo , Ribonucleasa III/metabolismo , Células VeroRESUMEN
Bovine besnoitiosis is a reemerging disease in Europe. The clinically Besnoitia besnoiti infection in bulls is characterized by fever, nasal discharge, and orchitis in the acute phase and by scleroderma in the chronic phase. However, in many bulls, B besnoiti infection remains at a subclinical stage. Bull infertility is an economically relevant consequence of besnoitiosis infection. It is not clear, however, if semen quality returns to normal levels when infected animals have clinically recovered. The aim of this study was to examine the relationship between chronic besnoitiosis and bull sexual function in a region of eastern France, where the disease is reemerging, by comparing semen quality and genital lesions in 11 uninfected, 17 subclinically infected, and 12 clinically infected bulls. The presence of anti-B besnoiti antibodies was detected by Western blot test. Semen was collected by electroejaculation. Bulls clinically infected with B besnoiti showed significantly more genital tract alterations than uninfected or subclinically infected bulls. No relationship was evidenced between besnoitiosis infectious status and semen quality, whereas a significant relationship was noted between genital lesions and semen score. This means that in the absence of moderate to severe genital lesions, chronic bovine besnoitiosis is unlikely to alter semen quality. However, as the presence of infected animals could lead to spread of the disease, culling or separation of clinically infected bulls from the remaining healthy animals is strongly recommended.
Asunto(s)
Enfermedades de los Bovinos/parasitología , Coccidiosis/veterinaria , Enfermedades Testiculares/veterinaria , Animales , Anticuerpos Antiprotozoarios/sangre , Estudios de Casos y Controles , Bovinos , Enfermedades de los Bovinos/sangre , Enfermedad Crónica , Coccidiosis/patología , Masculino , Análisis de Semen , Enfermedades Testiculares/parasitología , Enfermedades Testiculares/patologíaAsunto(s)
Válvula Aórtica/lesiones , Angiografía Coronaria/efectos adversos , Enfermedades de las Válvulas Cardíacas/etiología , Hematoma/diagnóstico por imagen , Hematoma/etiología , Adulto , Angiografía Coronaria/métodos , Ecocardiografía Transesofágica/métodos , Enfermedades de las Válvulas Cardíacas/diagnóstico por imagen , Humanos , Enfermedad Iatrogénica , Masculino , Monitoreo Fisiológico/métodos , Remisión Espontánea , Índice de Severidad de la EnfermedadRESUMEN
Bovine besnoitiosis is a chronic and debilitating disease observed in many European countries that may cause important economic losses in cattle. The recent widespread of the parasite in Europe had led the European Food Safety Authority to declare bovine besnoitiosis as a re-emerging disease in Europe. Many aspects of the epidemiology of bovine besnoitiosis such as the main routes of transmission are still unclear and need to be further studied. Among the different hypotheses, a sexual transmission has not yet been investigated. Therefore, the aim of this study was to evaluate the presence of Besnoitia besnoiti DNA in the semen of naturally infected bulls by using a highly sensitive method (real-time qPCR). Both pre-sperm and sperm fractions of 40 bulls, including seronegative (n = 11), seropositive subclinically (n = 17), and seropositive clinically (n = 12) infected animals, were collected by electroejaculation and analyzed by real-time qPCR. No B. besnoiti DNA was detected in 27 pre-sperm and 28 sperm fractions of the 40 examined bulls, suggesting that the transmission of B. besnoiti infection by the semen of chronically infected bulls is very unlikely.
Asunto(s)
Enfermedades de los Bovinos/parasitología , Coccidiosis/veterinaria , ADN Protozoario/aislamiento & purificación , Sarcocystidae/aislamiento & purificación , Semen/parasitología , Animales , Bovinos , Enfermedades de los Bovinos/diagnóstico , Coccidiosis/diagnóstico , ADN Protozoario/genética , Masculino , Reacción en Cadena en Tiempo Real de la Polimerasa/métodos , Reacción en Cadena en Tiempo Real de la Polimerasa/veterinaria , Sarcocystidae/genética , Sensibilidad y EspecificidadRESUMEN
A novel begomovirus isolated from a Sida rhombifolia plant collected in Sinaloa, Mexico, was characterized. The genomic components of sida mosaic Sinaloa virus (SiMSinV) shared highest sequence identity with DNA-A and DNA-B components of chino del tomate virus (CdTV), suggesting a vertical evolutionary relationship between these viruses. However, recombination analysis indicated that a short segment of SiMSinV DNA-A encompassing the plus-strand replication origin and the 5´-proximal 43 codons of the Rep gene was derived from tomato mottle Taino virus (ToMoTV). Accordingly, the putative cis- and trans-acting replication specificity determinants of SiMSinV were identical to those of ToMoTV but differed from those of CdTV. Modeling of the SiMSinV and CdTV Rep proteins revealed significant differences in the region comprising the small ß1/ß5 sheet element, where five putative DNA-binding specificity determinants (SPDs) of Rep (i.e., amino acid residues 5, 8, 10, 69 and 71) were previously identified. Computer-assisted searches of public databases led to identification of 33 begomoviruses from three continents encoding proteins with SPDs identical to those of the Rep encoded by SiMSinV. Sequence analysis of the replication origins demonstrated that all 33 begomoviruses harbor potential Rep-binding sites identical to those of SiMSinV. These data support the hypothesis that the Rep ß1/ß5 sheet region determines specificity of this protein for DNA replication origin sequences.
Asunto(s)
Begomovirus/genética , Begomovirus/fisiología , Malvaceae/virología , Replicación Viral , Begomovirus/aislamiento & purificación , Sitios de Unión , Biología Computacional , México , Recombinación Genética , Homología de Secuencia de Ácido NucleicoRESUMEN
Bovine besnoitiosis caused by Besnoitia besnoiti is a chronic and debilitating disease. The most characteristic clinical signs of chronic besnoitiosis are visible tissue cysts in the scleral conjunctiva and the vagina, thickened skin and a generally poor body condition. However, many seropositive animals remain subclinically infected, and the role that these animals may play in spreading the disease is not known. The aim of the present study was to assess the intra-organ parasite distribution, the parasite load and the parasite-associated lesions in seropositive but subclinically infected animals. These animals were seropositive at the time of several consecutive samplings, had visible tissue cysts in the past and, at time of slaughter, had detectable specific anti-Besnoitia spp. antibody levels, but they did not show evident clinical signs at culling. Thus, histopathological, immunohistochemical and molecular analyses of several samples from the respiratory tract, reproductive tract, other internal organs and skin from six cows were performed. The tissue cysts were located primarily in the upper respiratory tract, i.e., in the rhinarium and larynx/pharynx (four cows), followed by the distal genital tract (vulva/vagina) and the skin of the neck (three and two cows, respectively, out of the four cows with cysts in the respiratory tract). We were unable to detect any parasites in the two remaining cows. Cysts were associated with a significant non-purulent inflammatory infiltrate consisting predominantly of T lymphocytes and activated monocytes/macrophages in two cows. The parasite burden, estimated by quantitative real-time PCR, was very low. It is noteworthy that the only animal that showed a recent increase in the antibody titre had the highest parasite burden and the most conspicuous inflammatory reaction against the cysts. In conclusion, although these cows no longer displayed any visible signs of besnoitiosis, they remained infected. Therefore, cows without visible signs of disease may still be able to transmit the parasite.
Asunto(s)
Enfermedades de los Bovinos/parasitología , Coccidiosis/veterinaria , Animales , Bovinos , Enfermedades de los Bovinos/patología , Enfermedad Crónica , Coccidiosis/parasitología , Coccidiosis/patología , FemeninoRESUMEN
Fleas are a common cause of feline skin disorders as well as vectors of zoonotic diseases. This study evaluated the flea species infesting domestic cats in Spain and assessed factors influencing their distribution. Fleas from 217 cats from 57 localities in Spain were identified and associations between abundance, and host-dependent, host habitat and environmental factors were examined. Variations in infracommunity and component community structure were also explored. Three species were present, of which Ctenocephalides felis (Bouché) (Siphonaptera: Pulicidae) was the most abundant (98.4%), followed by Ctenocephalides canis (Curtis) (1.1%) and Pulex irritans (L.) (Siphonaptera: Pulicidae) (0.5%). Overall abundance and abundances of both C. felis and C. canis were higher on farms than in apartments, but overall flea abundance and abundances of both C. felis and C. canis were lower in rural than urban environments. Overall abundance and C. felis abundance were lower during the warmest months, and mean annual rainfall was positively correlated with overall, C. felis and C. canis abundances. No relationship between the number of species per cat and any host, habitat or physiographical variable was found. Species richness was not correlated with mean annual temperature or rainfall. Flea abundance was mainly associated with host habitat and environmental factors.
Asunto(s)
Enfermedades de los Gatos/epidemiología , Infestaciones por Pulgas/veterinaria , Siphonaptera/fisiología , Animales , Enfermedades de los Gatos/parasitología , Gatos , Ecosistema , Ambiente , Femenino , Infestaciones por Pulgas/epidemiología , Infestaciones por Pulgas/parasitología , Masculino , Densidad de Población , España/epidemiologíaRESUMEN
The complete genome sequence of a distinct variant of tomato yellow leaf curl virus-Israel (TYLCV-IL) and the DNA-A sequence of a new strain of tomato severe leaf curl virus (ToSLCV) isolated in San Luis Potosi, Mexico, are described and analyzed. The TYLCV-IL[MX:SLP:11] variant differs from all TYLCV-IL isolates described so far by a unique 42-nt duplicated sequence comprising a part of the conserved stem-loop element of the virion-strand replication origin and adjacent regulatory sequences. TYLCV-IL[MX:SLP:11] was associated with tomato chino La Paz virus (ToChLPV-B[MX:SLP:11]) in a Solanum pimpinellifolium plant, and with pepper huasteco yellow vein virus (PHYVV-[MX:SLP:11]) and ToSLCV-GT[MX:SLP:11] in a Solanum lycopersicum plant. In addition, a distinct ToSLCV exhibiting low sequence identity (<89 %) to other ToSLCV isolates from Mexico was found in a tomato plant collected in the same field. Sequence analysis of this new ToSLCV strain indicates that it is a recombinant of close relatives of ToSLCV-GT[MX:SLP:11] and ToChLPV-B[MX:SLP:11] found in mixed infections with TYLCV-IL[MX:SLP:11].
Asunto(s)
Begomovirus/genética , ADN Viral/química , ADN Viral/genética , Genoma Viral , Solanum lycopersicum/virología , Begomovirus/aislamiento & purificación , Análisis por Conglomerados , México , Datos de Secuencia Molecular , Filogenia , Análisis de Secuencia de ADNRESUMEN
In August 2009, yellowing, upward curling of leaves, and stunted growth were observed on 15 to 40% of dry bean (Phaseolus vulgaris cv. Aluvori) plants in each of several experimental fields in Zacatecas, Mexico. Symptoms and presence of the beet leafhopper (Circulifer tenellus) in affected fields suggested an infection by curtoviruses (Geminiviridae). Total DNA extracts from 18 plant samples exhibiting symptoms were obtained by a modified Dellaporta method (2) and subjected to PCR analysis using two pairs of new, degenerate primers specific for curtoviruses: RepQEW-for (CCRAARTAAGMATCRGCCCAYTCTTG) in combination with CP450-rev (GTCCTCGAGTAGACGGCATAGCCTGACC) and V2Gen910-for (ATGTCGACGAAGCATTTGAAGTTTGATATGGC) with Rep2GQ-rev (GAAGATCTGCWCGMGGAGGYCARCAGACGGCT). This double set of primers was used to amplify two overlapping DNA segments encompassing the complete curtovirus genome. All samples produced amplicons of the expected size (1.75 and 1.8 kb, respectively) that were cloned into pGEM-T Easy Vector (Promega, Madison, WI). Restriction fragment length polymorphism analysis of PCR clones with EcoRI and HinfI endonucleases suggested the presence of a single curtovirus species because only one restriction fragment pattern was observed in all cases. Viral amplicons from three plants were sequenced, and the overlapping DNA fragments were subsequently assembled into a complete genome sequence. Comparison of the virus sequence (Accession No. HQ634913) with sequences of all curtovirus isolates available in GenBank showed that it shared the highest nucleotide identity (98%) with Beet mild curly top virus-Mexico SLP1 from pepper (BMCTV-MX [SLP1]; Accession No. EU586260). Amino acid sequence identity of the seven predicted proteins (Rep, TrAP, REn, C4, V1, V2, and V3) encoded by the virus isolated from bean plants shared 98.0, 97.3, 98.5, 98.8, 100, 99.2, and 97.8% sequence identity, respectively, with the homologous proteins of BMCTV-MX [SLP1]. A BMCTV isolate from pepper collected in Zacatecas in 2007 (Accession No. EU586260) with 96% nucleotide sequence identity to the curtovirus identified in bean induced symptoms in P. vulgaris cv. Topcrop similar to those observed in bean in Zacatecas (1). To determine the presence of curtoviruses in the local populations of insect vectors, beet leafhoppers were collected in one of the sampled dry bean fields and total DNA was isolated from a pool of approximately 20 insects. Amplification of viral DNA with the degenerate primers RepQEW-for and CP450-rev and further sequencing of the PCR products confirmed the presence of a curtovirus DNA sharing almost identical nucleotide identity (99%) with the DNA isolated from bean plants. In 2011, symptoms similar to those observed in bean in 2009 occurred in approximately 30% of dry bean plants, suggesting that BMCTV is endemic in the Zacatecas Region. To our knowledge, this is the first report of BMCTV in legumes in Mexico. References: (1) L. F. Chen et al. Arch. Virol. 156:547, 2011. (2) S. L. Dellaporta et al. Plant Mol. Biol. Rep. 1:19, 1983.