RESUMEN
PURPOSE: The first-line therapy for patients with keratitis is different for bacteria, filamentous fungi, and yeasts. The timely onset of treatments depends on rapid and accurate diagnosis. However, fungal cultures produce high rates of false-negative results. Nucleic acid amplification techniques (polymerase chain reaction [PCR]) improve fungal diagnosis performance, but they require complex postamplification procedures to differentiate filamentous fungi from yeasts or to identify the agent. The objective of this work was to develop a new diagnostic strategy based on real-time PCR high-resolution melting (HRM) analysis that in 1 run (a) detects and semiquantifies yeasts and filamentous fungi, (b) differentiates yeasts from filamentous fungi, and (c) discriminates among relevant species of yeasts. DESIGN: Experimental study to compare HRM diagnosis performances with microscopic examination of corneal scrapings and fungal culture. PARTICIPANTS AND CONTROLS: High-resolution melting detection limits and specificity were assessed with (a) isolated strains; (b) agents (other than fungi) producing keratitis; (c) corneal scrapings from fungal keratitis (culture positive and negative); and (d) corneal scrapings from bacterial, viral, or Acanthamoeba keratitis. METHODS: The DNA extracted from cornea specimens was mixed with primers diluted in the MeltDoctor HRM Master Mix (Applied Biosystems, Paris, France) in 2 tubes, the first for yeasts, containing the forward primer CandUn (5'CATGCCTGTTTGAGCGTC) and the reverse primer FungUn2 (5'TCCTCCGCTTATTGATATGCT), and the second for filamentous fungi, containing the forward primer FilamUn1 (5'TGCCTGTCCGAGCGTCAT) and FungUn2. Molecular probes were not necessary. The yields of DNA extraction and the PCR inhibitors were monitored by adding internal controls to each sample. MAIN OUTCOME MEASURES: Detection of fungi in corneal samples by HRM. RESULTS: High-resolution melting consistently detects the equivalent of 0.1 colony-forming units /ml of yeasts and filamentous fungi, differentiates filamentous fungi from yeasts, and discriminates among relevant species of yeasts. High-resolution melting sensitivity and specificity were 100% for culture-positive samples, detecting and characterizing fungi in 7 of 10 culture-negative suspected fungal keratitis. CONCLUSIONS: High-resolution melting is a new, sensitive, specific, and inexpensive test that detects fungi and differentiates filamentous fungi from yeasts directly from clinical specimens in less than 2.30 hours after DNA extraction.
Asunto(s)
Enfermedades de la Córnea/diagnóstico , ADN de Hongos/análisis , Infecciones Fúngicas del Ojo/diagnóstico , Micosis/diagnóstico , Reacción en Cadena en Tiempo Real de la Polimerasa , Enfermedades de la Córnea/microbiología , Cartilla de ADN/química , Infecciones Fúngicas del Ojo/microbiología , Hongos/genética , Hongos/aislamiento & purificación , Humanos , Micosis/microbiología , Sensibilidad y EspecificidadAsunto(s)
Úlcera de la Córnea/epidemiología , Infecciones Fúngicas del Ojo/epidemiología , Hongos/aislamiento & purificación , Micosis/epidemiología , Antibacterianos/uso terapéutico , Úlcera de la Córnea/tratamiento farmacológico , Úlcera de la Córnea/microbiología , Enucleación del Ojo , Infecciones Fúngicas del Ojo/tratamiento farmacológico , Infecciones Fúngicas del Ojo/microbiología , Femenino , Francia/epidemiología , Humanos , Masculino , Persona de Mediana Edad , Micosis/tratamiento farmacológico , Micosis/microbiología , Estudios Retrospectivos , Factores de Riesgo , Agudeza VisualRESUMEN
Human leukocyte antigen (HLA) haplotypes (n = 187) were genotyped and assigned by the mode of inheritance in migrant families from North Africa who reside in the Paris, France, area. The distribution of alleles and haplotypes in that population was compared with the one obtained in a control population of ancient French natives residing in the same area (248 independent haplotypes also assigned by the mode of inheritance were studied). The results in migrants reveal the following: (1) a higher diversity in the distribution of HLA-A and -DRB1 alleles; (2) lower frequencies of alleles common in our region, such as A*0201 B*1501, B*4001, and DRB1*0401 and increased frequencies of minor subtypes, such as A*3002 and DRB1*0402; and (3) distinct distributions of B/Cw, DRB1/DQB1 or B/Cw/DRB1/DQB1 haplotypes. The results also revealed that the four most frequent five-allele haplotypes in controls i.e., HLA-A*0101/B*0801/Cw*0701/DRB1*0301/DQB1*0201; A*0301/B*0702/Cw*0702/DRB1*1501/DQB1*0602 (both of Indo-Celtic origin); A*2902/B*4403/Cw*1601/DRB1*0701/DQB1*0202 (frequent in Western-Europeans); and A*0201/B*1501/Cw*0304/DRB1*0401/DQB1*0302, represent 10.5% of the total haplotypes in controls but 1.6% in North Africans. Conversely, 9 five-allele haplotypes in multiple copy in North Africans (among which A*3002/B*1801/Cw*0501/DRB1*0301/DQB1*0201 of Paleo-North African origin and A*0201/B*0702/Cw*0702/DRB1*1501/DQB1*0602 of ancient European and Paleo-North African origin) represent 9.6% of the total haplotypes in North Africans but 2.4% in controls. These results thus suggest a low degree of admixture between the two populations.