RESUMEN
The black rot disease in crucifer crops is caused by Xanthomonas campestris pv. campestris (Xcc) which drastically reduces the productivity of crops. Three Xcc races, such as races 1, 4, and 6, have been identified from India that possess nine avr genes, or type-III effectors (T3Es). Here, we used three T3Es-avrXccC, avrBs1, and avrGf1 to identify Xcc from bacterial DNA, bacterial suspensions, Xcc-infected seeds, and the sap of the infected leaves using multiplex PCR. The T3Es were amplified using gene-specific primers with gDNA of Xcc. Then, the multiplex PCR was optimized and amplified T3Es using the sap of black rot-infected cauliflower leaves. Further, this method amplified T3Es from artificially infected seeds (1-100%) of cauliflower and from Xcc colonies (0.1-100%) grown on nutrient agar medium. The primer specificity of T3E genes elucidates that these are specifically detected in all Indian Xcc strains and races, while no bands were observed with other unrelated bacteria, such as X. euvesicatoria, X. oryzae pv. oryzae, Pseudomonas fluorescens, Ralstonia solanacearum, Bacillus subtilis, and B. amyloliquefaciens. Further, this PCR possesses high sensitivity and amplifies T3E genes using up to 0.01 ng Xcc DNA. The high specificity and sensitivity of T3Es-based multiplex PCR make it a potential method and can be used to amplify Xcc from various templates, such as purified DNA, Xcc-infected seeds and leaves, crude extracts, etc., without the need to extract plant or bacterial DNA. Supplementary Information: The online version contains supplementary material available at 10.1007/s13205-023-03691-z.
RESUMEN
The Brassica oleracea var. botrytis (cauliflower) is an important annual vegetable crop in the Brassicaceae family and is extensively grown worldwide (Singh et al. 2018). In the early summer of 2022, the cauliflower plants grown at the Indian Agricultural Research Institute (IARI), New Delhi, India, showed virus-like symptoms. Symptoms comprised chlorosis, stunted growth, mottling, necrosis, and mosaic. Additionally, the infected plants had deformed, curled leaves and reduced growth. The symptomatic plant leaf samples were collected and examined under the transmission electron microscope (TEM), which showed rigid, rod-shaped particles with tubular morphology resembling tobacco rattle virus (TRV, genus Tobravirus) infection (Basavaraj et al. 2020). TRV has a vast host range and is reported to infect many vegetable crops (beans, beets, peppers, potatoes, and spinach) and ornamental plants (lily, marigold, and tulip) (Adams et al. 2012; Katoch et al. 2004; MacFarlane, 1999). The reverse transcription (RT)-PCR also tested infected samples. Total RNA was extracted with Plant RNeasy Mini Kit (Qiagen, Germany). The cDNA was prepared using a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, US). A 600-bp-long coat protein gene of TRV was PCR amplified using coat protein gene (CPG)-specific primers (TRVCPF: ATGGGAGATATGTACGATGAATC and TRVCPR: CTAGGGATTAGGACGTATCGGA). The PCR reaction contained 5.0µl of 5× Go-Taq Flexi buffer, 2.5µl of 25mM MgCl2, 1.0µl of 10mM dNTPs, 0.75µl each of 10µm forward and reverse primers of TRVCP, 1.0µl of cDNA, 13.8µl of nuclease-free water, and 0.2µl of Go-Taq polymerase (Promega, US). No template control was run with this PCR. The PCR (Gradient thermocycler, C-1000TM, BIORAD) was carried out under the following conditions: 94°C for 2 min, followed by 35 cycles of 94°C for 1 min, 50°C for 30 sec, and 72°C for 1 min, and final elongation at 72°C for 10 min. TRV was amplified in three cauliflower samples at IARI, New Delhi (Lat 28.08° N and Long 77.12°E). The amplicon of partial CPG was sequenced by Sanger sequencing (AgriGenome Labs Pvt. Ltd., India). The BLASTN analysis of the CPG revealed 100% nucleotide homology with TRV isolates (Accession No. Z36974) (Hernandez et al. 1995). Three isolates were sequenced and submitted to the GenBank database (Accession Nos. ON983976, ON983977, and ON983978). The sap from the TRV-infected cauliflower leaves were used to confirm the infection of TRV in healthy cauliflower plants grown in the greenhouse condition. TRV may be a new threat to cauliflower production and needs further research to elaborate more about the virus-host interactions and disease resistance. As per our knowledge, this is the first report of TRV infecting cauliflower in India.
RESUMEN
Mustard (Brassica juncea L.) is an important oil seed crop in the Brassicaceae family. It is widely cultivated in India for its edible leaves, oil and medicinal properties. In January 2022, we noticed necrotic symptoms typical black rot disease on Brassica juncea (L.) cv. Pusa Bold grown in Indian Agricultural Research Institute, India. Initially, chlorotic lesions emerged on the leaf margin, which progressed to angular V-shaped necrotic lesions and blackened veins. Disease progression became a necrotic appearance in the leaf results browning and papery leaf texture appeared. The suspected causal agent was isolated from three different diseased plants of Pusa Bold on nutrient sucrose agar medium that formed pale yellow, mucoid, and fluidal colonies. Three representative isolates originated from three different plants were sub-cultured on YGCA medium. These isolates are Gram-negative, oxidase negative, KOH positive, nonfluorescent on King's Medium B agar, and positive for starch hydrolysis test (Schaad and White 1974). The 16S ribosomal RNA gene and avirulence genes - AvrBs1 and AvrGf1 were amplified and sequenced in these three isolates with other Xanthomonas campestris pv. campestris (Xcc) isolates. The DNA sequence analysis revealed that these isolates are within the species of X. campestris. The race 1 specific marker namely xcc-b100_4389 was used to characterized the race by detection of 1090bp fragment respectively from gDNA of Xcc isolates (Rubel et al., 2017). The pathogenicity of these isolates was tested twice on youngest leaves of 30-day-old plants of Pusa Bold to convey Koch postulates. Inoculum of three isolates were prepared in nutrient broth at 28°C for 48-h. The pathogenicity test was conducted by small scissors dipped in a bacterial suspension (~ 108 cfu/ml) to cut leaf near margins at 10 points per leaf and the three youngest leaves per plant with three replications. The number of infected points per leaf and the severity of symptoms were assessed 15 and 30 days after inoculation (Singh et al., 2011; 2016). The chlorotic lesions with V-shaped symptoms were appeared on all inoculated plants after 15 and 30 dpi (days post-inoculation). The bacteria were reisolated from inoculated plants and has the same identity as original isolates by using 16S rRNA, avr genes and race 1 specific marker PCR, thereby confirming Koch's postulates. The bacterial inoculation was repeated and the same symptoms appear. Most of the crucifers are infected with black rot disease e.g., cauliflower, cabbage, Brussels, sprout etc. (Vicente et al., 2001). The nucleotide BLAST analysis of 16S rRNA, AvrBs1, AvrGf1 showed a 100% identity with different Xcc strains reported from Germany (B100; AM920689), Brazil (ATCC 33913; AE008922), India (Xcc-C7; CP077958), France (CFBP 5817; CM002673) and China (8004; CP000050) (Singh et al. 2022). Whilst, the nBLAST analysis of xcc-b100_4389 showed 100% nucleotide identity with Xcc race 1 (B100; AM920689), Germany. The sequences were deposited in GenBank (16S rRNA: OM839780; AvrBs1: OM994397; AvrGf1: OM994398; xcc-b100_4389: OM994399). The XccAK1 strain (ITCCBH_0014) was deposited in Indian Type Culture Collection, ICAR-IARI, New Delhi, India. Presently, it is a first report of necrotic black rot on B. juncea cv. Pusa Bold incited by Xcc race 1, India. Previous research reported the black rot disease on other species of the Brassica genus e.g., B. oleracea, and B. napus in Serbia (Popovic et al., 2013) and Argentina (Gaetan et al., 2005).
RESUMEN
Seven edible plants including three unexplored species of high altitude (Ladakh) region were screened for antioxidant activity by bioassay guided fractionation method. The objective of the study was to dereplicate the complex phytochemical matrix of a plant in reference to antioxidant activity in vitro. The screening result showed that ethylacetate fraction of Nepeta longibracteata possesses maximum antioxidant activity, comparable to that of green tea. It also exhibited significant protecting effect against oxidative stress induced by t-BHP in human RBCs. Phytochemical profiling of the most active fraction by nontargeted RP-HPLC-MS and MS/MS technique showed that rosmarinic acid and methylrosmarinate constituted nearly 51 % of the total metabolites apart from twelve other major chemotypes.