RESUMEN

Multiple choice results are inherently probabilistic outcomes, as correct responses reflect a combination of knowledge and guessing, while incorrect responses additionally reflect blunder, a confidently committed mistake. To objectively resolve knowledge from responses in an MC test structure, we evaluated probabilistic models that explicitly account for guessing, knowledge and blunder using eight assessments (>9,000 responses) from an undergraduate biotechnology curriculum. A Bayesian implementation of the models, aimed at assessing their robustness to prior beliefs in examinee knowledge, showed that explicit estimators of knowledge are markedly sensitive to prior beliefs with scores as sole input. To overcome this limitation, we examined self-ranked confidence as a proxy knowledge indicator. For our test set, three levels of confidence resolved test performance. Responses rated as least confident were correct more frequently than expected from random selection, reflecting partial knowledge, but were balanced by blunder among the most confident responses. By translating evidence-based guessing and blunder rates to pass marks that statistically qualify a desired level of examinee knowledge, our approach finds practical utility in test analysis and design.

RESUMEN

BACKGROUND: Expansion of the C9orf72 hexanucleotide repeat (GGGGCC)n·(GGCCCC)n is the most common cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Both strands of the C9orf72 repeat have been shown to form unusual DNA and RNA structures that are thought to be involved in mutagenesis and/or pathogenesis. We previously showed that the C-rich DNA strands from the C9orf72 repeat can form four-stranded quadruplexes at neutral pH. The cytosine residues become protonated under slightly acidic pH (pH 4.5-6.2), facilitating the formation of intercalated i-motif structures. METHODS: Using CD spectroscopy, UV melting, and gel electrophoresis, we demonstrate a pH-induced structural transition of the C-rich DNA strand of the C9orf72 repeat at pHs reported to exist in living cells under stress, including during neurodegeneration and cancer. RESULTS: We show that the repeats with lengths of 4, 6, and 8 units, form intercalated quadruplex i-motifs at low pH (pH < 5) and monomolecular hairpins and monomolecular quadruplexes under neutral-basic conditions (pH ≥ 8). Furthermore, we show that the human replication protein A (RPA) binds to the G-rich and C-rich DNA strands under acidic conditions, suggesting that it can bind to i-motif structures. CONCLUSIONS: In the proper sequence context, i-motif structures can form at pH values found in some cells in vivo. GENERAL SIGNIFICANCE: DNA conformational plasticity exists over broad range of solution conditions.

Asunto(s)

Ácidos/química , Proteína C9orf72/química , Citosina/química , Expansión de las Repeticiones de ADN , G-Cuádruplex , Estrés Fisiológico , Humanos , Concentración de Iones de Hidrógeno , Conformación de Ácido Nucleico

RESUMEN

Guanine-rich oligodeoxyribonucleotides (ODNs) can form non-canonical DNA structures known as G-quadruplexes, which are four stranded structures stabilized by sodium or potassium cations. The topologies of G-quadruplexes are highly polymorphic. H-Tel, an ODN with four consecutive repeats of the human telomeric sequence, [d(AGGGTTAGGGTTAGGGTTAGGG)], can assume different monomolecular G-quadruplex topologies depending on the type of cation present in solution. Our previous work demonstrated that at high concentrations of H-Tel, the monomolecular G-quadruplexes formed by H-Tel self-associate to form higher order structures. The aggregates display circular dichroism (CD) spectra similar to that of an all-parallel structure. In the current work, we present data for 19 ODNs for which we have modified the loop sequences of H-Tel in order to learn if concentration-dependent self-aggregation is a general phenomenon and to probe the contribution of the loops to the self-association of these ODNs. Our studies use CD spectroscopy and spectroscopically monitored heat denaturation. Our data show that the concentration-dependent formation of parallel G-quadruplex aggregates is a general phenomenon. We propose that one of the factors that might affect this process is the association of partially unfolded antiparallel structures.

Asunto(s)

G-Cuádruplex , Conformación de Ácido Nucleico , Oligodesoxirribonucleótidos/química , Dicroismo Circular , Guanina/química , Humanos

RESUMEN

Guanine-rich DNA sequences that may form G-quadruplexes are located in strategic DNA loci with the ability to regulate biological events. G-quadruplexes have been under intensive scrutiny owing to their potential to serve as novel drug targets in emerging anticancer strategies. Thermodynamic characterization of G-quadruplexes is an important and necessary step in developing predictive algorithms for evaluating the conformational preferences of G-rich sequences in the presence or the absence of their complementary C-rich strands. We use a combination of spectroscopic, calorimetric, and volumetric techniques to characterize the folding/unfolding transitions of the 26-meric human telomeric sequence d[A3G3(T2AG3)3A2]. In the presence of K+ ions, the latter adopts the hybrid-1 G-quadruplex conformation, a tightly packed structure with an unusually small number of solvent-exposed atomic groups. The K+-induced folding of the G-quadruplex at room temperature is a slow process that involves significant accumulation of an intermediate at the early stages of the transition. The G-quadruplex state of the oligomeric sequence is characterized by a larger volume and compressibility and a smaller expansibility than the coil state. These results are in qualitative agreement with each other all suggesting significant dehydration to accompany the G-quadruplex formation. Based on our volume data, 432±19 water molecules become released to the bulk upon the G-quadruplex formation. This large number is consistent with a picture in which DNA dehydration is not limited to water molecules in direct contact with the regions that become buried but involves a general decrease in solute-solvent interactions all over the surface of the folded structure.

Asunto(s)

G-Cuádruplex , Telómero , ADN/química , Guanina , Humanos , Conformación de Ácido Nucleico , Termodinámica

RESUMEN

Oligodeoxyribonucleotides (ODNs) that have four repeats of the human telomeric sequence d(TTAGGG)(n) can assume multiple monomolecular G-quadruplex topologies. These are determined by the cation species present, the bases at the 5' or 3' end, and the sample preparation technique. In this work, we report our studies of the concentration dependence of the circular dichroism (CD) and the vibrational modes probed by Raman scattering of three previously characterized monomolecular G-quadruplexes: H-Tel, d[5'-A(GGGTTA)(3)GGG-3']; hybrid-1, d[5'-AAA(GGGTTA)(3)GGGAA-3']; and hybrid-2, d[5'-TTA(GGGTTA)(3)GGGTT-3']. At high (millimolar) ODN concentrations, we observed a transformation of the CD spectrum of H-Tel, with a relaxation time on the order of 10 h. Analysis of the kinetics of this process is consistent with the formation of an aggregated complex of folded H-Tel monomers. Upon dilution, the aggregates dissociate rapidly, yielding spectra identical to those of monomeric H-Tel. Both hybrid sequences undergo a similar transition under high-salt (1 M) conditions. The measurements suggest that for these ODN concentrations, which are typically used in high-resolution spectroscopies, the monomolecular G-quadruplex structures undergo a transition to multimolecular structures at room temperature. Guided by our findings, we propose that the terminal bases of the hybrid-1 and hybrid-2 ODNs impede the formation of these aggregates; however, in solutions containing 1 M salt, the hybrid oligonucleotides aggregate.

Asunto(s)

Secuencia de Bases , Cromosomas Humanos/química , Conformación de Ácido Nucleico , Oligodesoxirribonucleótidos/química , Telómero/química , Humanos

RESUMEN

Oligodeoxyribonucleotides (ODNs) with long, terminal runs of consecutive guanines, and either a dA or dT tract at the other end form higher-order structures called DNA frayed wires. These aggregates self-assemble into species consisting of 2, 3, 4, 5, ... associated strands. Some of the remarkable features of these structures are their extreme thermostability and resistance to chemical denaturants and nucleases. However, the nature of the molecular interactions that stabilize these structures remains unclear. Based on dimethyl sulfate (DMS) methylation results, our group previously proposed DNA frayed wires to be a unique set of nucleic-acid assemblies in which the N7 of guanine does not participate in the guanine-guanine interactions. To probe the hydrogen bonding involved in the stabilization of d(A(15)G(15)) frayed wires, we used Raman spectroscopy in which the DNA sample is held in photonic crystal fibers. This technique significantly enhances the signals thus allowing the use of very low laser power. Based on our results for d(A(15)G(15)) and those of incorporating the isoelectronic guanine analog pyrazolo[3,4,-d]pyrimidine or PPG, into a frayed wire-forming sequence, we provide evidence that these structures are based on the G-quadruplex model. Furthermore, from the Raman spectrum, we observed markers that are consistent with the presence of deoxyguanosine residues in the syn conformation, this suggests the presence of anti-parallel G-quadruplexes. To identify the species that contain syn guanine residues, we used circular dichroism and gel electrophoresis to study an ODN in which all of the guanine residues were brominated, d(A(15)(8-Br)G(15)). In the presence of potassium, d(A(15)(8-Br)G(15)) forms what appears to be an anti-parallel dimeric G-quadruplex. To our knowledge, this is the first report of a DNA sequence having all its guanine residues replaced by 8-bromo-guanine and maintaining its ability to form a G-quadruplex structure.

Asunto(s)

Conformación de Ácido Nucleico , Oligodesoxirribonucleótidos/química , Metilación de ADN , Desnaturalización de Ácido Nucleico , Temperatura , Termodinámica

RESUMEN

G-quadruplexes are four-stranded nucleic acid complexes that exhibit a great deal of polymorphism. Recently a group described the polymorphism exhibited by the four-repeat of the Oxytricha nova telomeric sequences (Lee, J.Y., Yoon, J., Kihm, H.W., Kim, D.S., Biochemistry 2008, 47, 3389-3396). In this study we evaluated the effects of G-tract and loop lengths on this behaviour using circular dichroism (CD) and gel electrophoresis. The largest changes were detected for oligonucleotides with different numbers of consecutive G residues. Furthermore, decreasing the number of residues between the G runs, the loops, from four to three only results in minor alteration in the polymorphism. However, the shortening of the G-tract from four to three guanine residues led to characteristically anti-parallel G-quadruplex CD spectra. Finally, we show that adenine bases in the loop sequences are less likely to form G-quadruplexes in the presence of Na(+) cations than those comprised of thymine residues. The results presented here are an addition to the modest information available for predicting the type of G-quadruplex to be formed from G-rich sequences in aqueous solutions containing sodium or potassium ions.

Asunto(s)

ADN Protozoario/química , G-Cuádruplex , Oligodesoxirribonucleótidos/química , Oxytricha/química , Adenina/química , Animales , Autorradiografía , Dicroismo Circular , Electroforesis en Gel de Poliacrilamida , Guanina/química , Conformación de Ácido Nucleico , Radioisótopos de Fósforo , Sodio/química , Timina/química

RESUMEN

BACKGROUND: Most clinicians read only the abstract of papers in scientific journals. Therefore, it is very important that abstracts contain as much information as possible, to summarize the data succinctly. Our objectives were to evaluate the quality of information in abstracts reporting human fetal outcomes following drug exposure during pregnancy. METHODS: We developed quality criteria based on previous work, modifying them for use with pregnancy outcomes. Quality scores were calculated as present/absent for all of the equally weighted criteria, then expressed as percentages (present/[present + absent]). We examined a random sample of 100 abstracts obtained through searches of MEDLINE, EMBASE, and the Web of Science databases from 1990 to 2005. Average quality scores were compared across designs (cohort, case-control, meta-analysis, and mixed design) Using Kruskal-Wallis ANOVA and structured/unstructured formats using Student's t test. RESULTS: The overall average quality was 59.2% +/- 14% (median, 61.5%; range, 15.4-83.3%). Quality was not significantly different across designs (P = .16) or between structured and unstructured abstracts (P = .44). Quality scores increased over time (Rho = 0.23, P = .02). Most frequently absent were baseline risk (94%), drug dose (91%), nonsignificant P values (72%), confounders (69%), significant P values (57%), and risk difference (48%). CONCLUSIONS: Abstracts provide insufficient information, particularly baseline risk values, for readers to make evidence-based decisions regarding drug use during pregnancy. Efforts need to be made to improve the quality of abstracts and include critical information such as baseline risk.

Asunto(s)

Indización y Redacción de Resúmenes , Feto/efectos de los fármacos , Preparaciones Farmacéuticas/administración & dosificación , Edición , Indización y Redacción de Resúmenes/normas , Bases de Datos Factuales , Efectos Colaterales y Reacciones Adversas Relacionados con Medicamentos , Femenino , Humanos , MEDLINE , Embarazo , Edición/normas , Control de Calidad

RESUMEN

Nucleic acid-amino acid interactions are fundamental to understanding higher-order interactions made by nucleic acid-binding proteins. Here we employ electrophoresis to investigate DNA-amino acid interactions by using a set of amino acids (Ala, Gln, Gly, Met, Phe, Val, bicine and tricine) as trailing ions in a discontinuous buffer, and monitoring their interactions with duplex (from 12 to 3000 bp) and frayed wire [a set of self-assembled superstructures arising from d(A(15)G(15)) oligodeoxyribonucleotides] DNA by the change in their ionic mobility (in terms of %R(f)) as a function of amino acid concentration in a polyacrylamide matrix. By titration of the pH of Tris-HCl polyacrylamide gels (from 7 to 10), a span of steady-state amino acid concentrations and extents of ionization can be maintained. We found that with a decrease in pH (thereby increasing amino acid concentrations and the extent of ionization of the alpha-amino group), both the %R(f) and stacking limit were increased, but the extent varied among the trailing ions, resulting in an induced dispersion of %R(f) values for a given analyte. Using singular-value analysis to take into account the %R(f) dependence on fragment size (i.e., the %R(f) distribution), the degree of dispersion was found to be positively correlated with the accumulation of N-protonated trailing ions in the resolving phase. These results indicate that the modification of %R(f) of DNA is a mass-action effect involving DNA-amino acid interactions under essentially aqueous conditions.

Asunto(s)

Aminoácidos/metabolismo , ADN/metabolismo , Interpretación Estadística de Datos , Electroforesis , Concentración de Iones de Hidrógeno , Iones/metabolismo

RESUMEN

The orexin-2/hypocretin-2 (OX2R) receptor gene is mutated in canine narcolepsy and disruption of the prepro-orexin/hypocretin ligand gene results in both an animal model of narcolepsy and sporadic cases of the human disease. This evidence suggests that the structure of the OX2R gene, and its homologue, the OX1R gene, both members of the G protein-coupled receptor (GPCR) family, and the gene encoding the peptide ligands, the prepro-orexin/hypocretin gene, may be variables in the etiology of sleep disorders. We report a single stranded conformational polymorphism (SSCP) analysis of the coding regions of these genes in idiopathic sleep disorder patients diagnosed with excessive daytime sleepiness (EDS) (n = 28), narcolepsy (n = 28), Tourette's syndrome/chronic vocal or motor tic disorder (n = 70), and control subjects (n = 110). Two EDS patients showed a Pro11Thr change. One Tourette's syndrome patient was found to have a Pro10Ser alteration. The Pro10Ser and Pro11Thr variants were not found in non-disease populations. Analysis of the ability of the mutant receptors to mobilize calcium compared to the wild-type receptor in response to orexin agonists indicated that they resulted in decreased potency at high (etaM) concentrations of orexin ligands. Further work is warranted to study the variability of the orexin/hypocretin system in a variety of disorders characterized by EDS.

Asunto(s)

Trastornos de Somnolencia Excesiva/genética , Receptores de Neuropéptido/genética , Síndrome de Tourette/genética , Secuencia de Aminoácidos , Animales , Células COS , Calcio/metabolismo , Chlorocebus aethiops , Comorbilidad , ADN/química , ADN/genética , Análisis Mutacional de ADN , Trastornos de Somnolencia Excesiva/epidemiología , Relación Dosis-Respuesta a Droga , Humanos , Péptidos y Proteínas de Señalización Intracelular/farmacología , Espacio Intracelular/efectos de los fármacos , Espacio Intracelular/metabolismo , Mutación , Mutación Missense , Neuropéptidos/farmacología , Receptores de Orexina , Orexinas , Polimorfismo Conformacional Retorcido-Simple , Receptores Acoplados a Proteínas G , Receptores de Neuropéptido/agonistas , Receptores de Neuropéptido/fisiología , Síndrome de Tourette/epidemiología