RESUMEN
A polymerase chain reaction (PCR) procedure for simultaneous detection and identification of Bordetella pertussis, B. parapertussis, and B. bronchiseptica was developed and evaluated against culture in a study comprising nasopharyngeal aspirates and swabs from 166 patients with suspected pertussis, 54 of which were culture positive. A 239-base-pair sequence in the pertussis toxin promoter region was amplified using primers Bouni 1: 5'GCACCATCCCGCATACGTGTTG3', and Bouni 2: 5'GTGCAACGCATCCCGTCTTCC3'. The sequence contains mutations in B. parapertussis and B. bronchiseptica, and species were differentiated by restriction enzyme cleavage of the amplified product. The lowest detectable amount of B. pertussis DNA was 0.1 pg (equals approximately 30 bacteria). No false positives were found in clinical samples or among 18 other species. Treatment of 66 aspirates with a weak cation exchange resin increased the diagnostic sensitivity of PCR. Two culture-positive aspirates were negative by PCR, but grew with a single colony among contaminating flora and could be identified only after PCR analysis of the colony material. The amount of positive cases was increased from 13 by culture to 19 by the addition of PCR. Six samples positive by PCR were culture negative. All six patients showed clinical and epidemiologic evidence of pertussis, and three patients had been treated with antibiotics. PCR increased the sensitivity of pertussis case finding with retained specificity and can be used for laboratory diagnosis of whooping cough.
Asunto(s)
Infecciones por Bordetella/diagnóstico , Bordetella/aislamiento & purificación , Reacción en Cadena de la Polimerasa/métodos , Tos Ferina/diagnóstico , Secuencia de Bases , Bordetella/clasificación , Bordetella/genética , Bordetella/crecimiento & desarrollo , Infecciones por Bordetella/microbiología , Bordetella bronchiseptica/genética , Bordetella bronchiseptica/aislamiento & purificación , Bordetella pertussis/genética , Bordetella pertussis/aislamiento & purificación , Niño , Cartilla de ADN , ADN Bacteriano/aislamiento & purificación , Genes Bacterianos/genética , Bacterias Aerobias Gramnegativas/genética , Humanos , Datos de Secuencia Molecular , Nasofaringe/microbiología , Mapeo Restrictivo , Sensibilidad y Especificidad , Tos Ferina/microbiologíaRESUMEN
A polymerase chain reaction (PCR) technique for the detection of human enteroviruses in stool specimens was developed. The test was based on the synthesis of cDNA, followed by PCR and slot blot hybridization. The primers used were selected from a highly conserved sequence in the 5'non-coding region of the enteroviral genome. By this method 27 different enterovirus serotypes (15 echo, 6 coxsackie A, 4 coxsackie B, poliovirus type 2 and enterovirus 71) from 89 patients could be detected. Using positive virus culture as reference, the sensitivity of PCR was 69% after 30 cycles of amplification, 91% using 30 + 10 cycles and 100% following 2 rounds of amplification with ensuing hybridization. None of 23 stool samples from healthy individuals or patients with meningitis of proven non-enteroviral etiology were positive by the PCR. By contrast, 13/26 culture-negative, randomly chosen stool samples from patients with suspected enteroviral disease were positive by the test. These findings demonstrate a high sensitivity and an apparently high specificity of PCR for detection of enteroviruses in stool samples. Therefore, the methodology may be useful in the laboratory diagnosis of enterovirus infections.
Asunto(s)
Enterovirus/aislamiento & purificación , Heces/microbiología , ARN Viral/genética , Secuencia de Bases , Enterovirus/clasificación , Enterovirus/genética , Humanos , Datos de Secuencia Molecular , Hibridación de Ácido Nucleico , Reacción en Cadena de la Polimerasa , Sensibilidad y Especificidad , SerotipificaciónRESUMEN
Peripheral blood of 57 patients with antibodies to human immunodeficiency virus 1 (HIV-1) and of five HIV-1 seronegative subjects at risk for HIV-1 infection were analysed by polymerase chain reaction (PCR) and virus isolation. The virus was recovered from peripheral blood cells in 89% and from plasma in 75% of the HIV-1 seropositive cases. In contrast, proviral HIV-1 DNA was detected in all HIV-1 seropositive patients by dot blot hybridization of the amplified fragments. The intensities of the dot blot reactions were less pronounced in asymptomatic HIV-1 seropositive individuals than in patients with acquired immunodeficiency syndrome (AIDS) or AIDS-related complex (ARC), suggesting an increase in proviral DNA with advancing disease. Three of five seronegative patients with signs or symptoms suggesting HIV-1 infection, but none of the controls, were positive for HIV-1 DNA by one or two primer pairs. These results show a high sensitivity of the PCR for detecting HIV-1 DNA in patients of all stages of HIV-1 infection. Proviral DNA can also be detected in some individuals without detectable antibodies to the virus. The virus load in peripheral blood, as determined by virus cultivation and PCR, seems to increase with progression of the infection.
Asunto(s)
Infecciones por VIH/diagnóstico , VIH-1/aislamiento & purificación , Técnicas de Amplificación de Ácido Nucleico , Reacción en Cadena de la Polimerasa/métodos , Cultivo de Virus/métodos , Adulto , ADN Viral/aislamiento & purificación , Errores Diagnósticos , Estudios de Evaluación como Asunto , Femenino , Infecciones por VIH/microbiología , Seropositividad para VIH/diagnóstico , Seropositividad para VIH/microbiología , Humanos , Masculino , Hibridación de Ácido NucleicoRESUMEN
The polymerase chain reaction (PCR), using primer pairs in the gag, pol, and env regions, was used in a comparative study of HIV-1 DNA in peripheral mononuclear blood cells from HIV-1-seropositive individuals in Ethiopia and Sweden. Although all Swedish samples were positive by PCR, the reactivity was more pronounced in samples from late stages than in those from early stages of infection. Six of nine Ethiopian samples from HIV-1-seropositive patients were positive by PCR, but the reactions were much weaker than those observed for Swedish samples, and in most cases seen with one primer pair only. These results suggest that the burden of HIV-1 DNA in peripheral mononuclear blood cells increases with advancing disease. PCR using primer pairs designed to detect HIV-1 infection in Europe and North America is not always suitable for the detection of HIV-1 infection in Ethiopia. The differences in PCR reactivity could possibly be a consequence of differences regarding host responses to the virus in the two countries, but more likely due to genomic differences between HIV-1 strains prevalent in Ethiopia and Sweden.
Asunto(s)
ADN Viral/análisis , Amplificación de Genes , Infecciones por VIH/microbiología , VIH-1/genética , Reacción en Cadena de la Polimerasa , Provirus/genética , Complejo Relacionado con el SIDA/microbiología , Síndrome de Inmunodeficiencia Adquirida/microbiología , Electroforesis en Gel de Agar , Etiopía , Seropositividad para VIH/microbiología , Humanos , Immunoblotting , Hibridación de Ácido Nucleico , SueciaRESUMEN
We synthesized six peptides (15-22 amino acids) from the amino acid sequence of the S1 subunit of pertussis toxin. The antigenicity of the polypeptides was investigated by enzyme-linked immunosorbent assays, in which the polypeptides coupled to bovine serum albumin were used as coating antigens. The polypeptides were examined as antigens for reaction with pre- and postvaccination sera from infants receiving either a Bordetella pertussis whole-cell vaccine or a vaccine containing pertussis toxoid. An elevated serum titer was noted upon vaccination with both types of vaccines when bovine serum albumin conjugates of five synthetic peptides were used as antigens. Similarly, mice immunized with whole-cell pertussis vaccine showed an elevated titer against all five peptides that were reactive with human sera. Thus, we identified five peptide sequences of S1 against which, in two species, antibodies are formed upon exposure of these species to whole cells of B. pertussis.
Asunto(s)
Bordetella pertussis/inmunología , Toxina del Pertussis , Factores de Virulencia de Bordetella/inmunología , Animales , Epítopos , Ratones , Pentosiltransferasa/inmunología , Péptidos/síntesis química , Péptidos/inmunologíaRESUMEN
The equilibrium binding of [3H]propionyl neuropeptide Y ([ 3H]pNPY) to receptors in a crude synaptic membrane preparation from the rat striatum was influenced by GTP, which caused an apparent loss of high-affinity binding sites for [3H]pNPY. In the presence of GTP (10(-5) M), NPY and peptide YY (PYY) inhibited basal and forskolin-stimulated adenylate cyclase activity in a concentration-dependent manner in a cell-free preparation from rat striatum. The IC50 values for NPY and PYY were 1 X 10(-8) M and 1.4 x 10(-8) M respectively. The inhibitory action of NPY (10(-6) M) or of PYY (10(-6) M) was additive to that of acetylcholine (10(-4) M). The two peptides together also showed additivity (P less than 0.05) in inhibiting adenylate cyclase.
Asunto(s)
Adenilil Ciclasas/metabolismo , Cuerpo Estriado/enzimología , Neuropéptido Y/farmacología , Péptidos/farmacología , Animales , Colforsina/farmacología , Guanosina Trifosfato/farmacología , Masculino , Péptido YY , Ratas , Ratas Endogámicas , Receptores de Neuropéptido Y , Receptores de Neurotransmisores/efectos de los fármacos , Membranas Sinápticas/metabolismoRESUMEN
The presence of a single class of high affinity, saturable binding sites for [3H]neuropeptide Y (NPY) was demonstrated in membranes from human frontal and temporal cortex. The specific binding of [3H]NPY was sensitive to guanosine 5'-triphosphate (GTP) and guanylyl-imidodiphosphate (GMPP(NH)P; 100 microM) which lowered the total binding capacity (Bmax) value (35 +/- 2 fmol/mg in the frontal cortex and 82 +/- 3 fmol/mg in the temporal cortex) by 50%. GTP and GMPP(NH)P did not affect the dissociation constant (Kd) value which was 0.25 +/- 0.03 nM in a frontal cortex sample and 0.76 +/- 0.06 nM in the sample from the temporal cortex. The affinity and GTP sensitivity of the [3H]NPY binding to human brain membranes parallels that found in the rat brain. It was demonstrated that occupancy of NPY receptors by NPY (1 microM) inhibits the basal and forskolin (10 microM)-stimulated adenylate cyclase activity by 18-30% in a crude membrane preparation from human frontal cortex.
Asunto(s)
Adenilil Ciclasas/metabolismo , Lóbulo Frontal/fisiología , Receptores de Neurotransmisores/fisiología , Lóbulo Temporal/fisiología , Adenosina Trifosfato/farmacología , Adenilil Imidodifosfato/farmacología , Adulto , Femenino , Guanosina Trifosfato/farmacología , Guanilil Imidodifosfato/farmacología , Humanos , Masculino , Persona de Mediana Edad , Neuropéptido Y/metabolismo , Receptores de Neuropéptido Y , Receptores de Neurotransmisores/metabolismoRESUMEN
Porcine VIP was iodinated by the chloramine-T method. The reaction products, which were separated by high pressure liquid chromatography, included residual native VIP, oxidized VIP and at least two iodinated VIP species. The iodo-VIP derivatives were recognized by antibodies raised against VIP and by VIP receptors. Furthermore, they appear to be approximately equipotent agonists to VIP in activating the adenylate cyclase in membranes from the rat submandibular salivary gland and in the stimulation of pancreatic secretion in vivo.
Asunto(s)
Yodo , Páncreas/metabolismo , Receptores de la Hormona Gastrointestinal/metabolismo , Glándula Submandibular/enzimología , Compuestos de Tosilo , Péptido Intestinal Vasoactivo/análogos & derivados , Adenilil Ciclasas/metabolismo , Animales , Bicarbonatos/metabolismo , Gatos , Corteza Cerebral/metabolismo , Cloraminas , Cromatografía Líquida de Alta Presión , Activación Enzimática/efectos de los fármacos , Radioisótopos de Yodo , Marcaje Isotópico , Páncreas/efectos de los fármacos , Radioinmunoensayo , Ratas , Receptores de Péptido Intestinal Vasoactivo , Péptido Intestinal Vasoactivo/metabolismo , Péptido Intestinal Vasoactivo/farmacologíaRESUMEN
Chronic atropine treatment (14 days, 20 mg X day-1 X kg-1 SC) caused a 75% increase in the number of VIP receptors in the rat cerebral cortex. The affinity of these receptors for 125I-VIP was not altered significantly by the atropine treatment. The same treatment led to a 20% decrease in VIP tissue levels. Muscarinic receptor number was also increased by 26%. The results indicate that interactions between VIP- and muscarinic receptors may be of importance in the rat cerebral cortex.
Asunto(s)
Atropina/farmacología , Corteza Cerebral/metabolismo , Receptores de Superficie Celular/metabolismo , Péptido Intestinal Vasoactivo/metabolismo , Animales , Corteza Cerebral/efectos de los fármacos , Cinética , Masculino , Ratas , Ratas Endogámicas , Receptores de Superficie Celular/efectos de los fármacos , Receptores Muscarínicos/metabolismo , Receptores de Péptido Intestinal VasoactivoRESUMEN
Long-term treatment of rats with atropine induced large increases in the numbers of muscarinic receptors and receptors for vasoactive intestinal polypeptide in the salivary glands. Since receptors for vasoactive intestinal polypeptide coexist with muscarinic receptors on the same neurons in this preparation, the results suggest that a drug that alters the sensitivity of one receptor may also affect the sensitivity of the receptor for a costored transmitter and in this way contribute to the therapeutic or side effects of the drugs.